Introduction
Pseudexorchis Yamaguti, Reference Yamaguti1938 is an opisthorchioid genus with the type and only species, Pseudexorchis major (Hasegawa, Reference Hasegawa1935). This species was originally described on adult specimens obtained from the intestine of Silurus asotus Linnaeus, 1758 collected at an unknown locality in Japan (Hasegawa Reference Hasegawa1935). This genus is characterised by the presence of an unspecialised oral sucker, a median ventrogenital sac with a well-developed ventral sucker and genital pore, a ventral invagination located between the oral sucker and the ventrogenital sac, two opposite testes, a submedian, pretesticular, and lobated ovary, and some other features (Hasegawa Reference Hasegawa1935; Shimazu Reference Shimazu2007, Reference Shimazu2008, Reference Shimazu2017). The life cycle of P. major has been reported in detail: first intermediate hosts are cerithioid snails, Semisulcospira spp.; second intermediate hosts are various freshwater fishes; and definitive hosts are two species of silurid fish, S. asotus and Silurus biwaensis (Tomoda, 1961) (e.g., Hasegawa Reference Hasegawa1935; Ito Reference Ito1956; Shimazu Reference Shimazu2007; Shimazu et al. Reference Shimazu, Urabe and Grygier2011; Urabe Reference Urabe2003). To date, this parasite species has been found only in Japan and South Korea (e.g., Choi et al. Reference Choi, Lee, Lee and Hwang1966; Hasegawa Reference Hasegawa1934, Reference Hasegawa1935; Rhee et al. Reference Rhee, Lee, Baek and Kim1983; Shimazu Reference Shimazu2007, Reference Shimazu2008, Reference Shimazu2017; Shimazu et al. Reference Shimazu, Urabe and Grygier2011; Takahashi Reference Takahashi1929). For P. major, the sequences of the cox1 gene and ITS cluster previously obtained by Miura and Takisawa (Reference Miura and Takisawa2024) from rediae for DNA barcoding purposes are available. Shiraishi et al. (Reference Shiraishi, Tabata, Tanaka, Nakagaito, Okamura and Miura2027) report on newly generated 28S rRNA gene sequences for the metacercariae of this species. However, these data are not currently publicly available.
Yamaguti (Reference Yamaguti1938) originally recognised Pseudexorchis as a member of the Heterophyidae. Morozov (Reference Morozov and Skriabin1952) moved it to the Cryptogonimidae based on the idea that heterophyid digeneans are parasites exclusively of warm-blooded vertebrates, whereas cryptogonimids parasitise cold-blooded vertebrates. Yamaguti (Reference Yamaguti1958) concurred with Morozov (Reference Morozov and Skriabin1952) regarding the assignment of Pseudexorchis to the Cryptogonimidae, but considered it necessary to place this genus in the newly erected subfamily Pseudexorchiinae. Cribb (Reference Cribb1986), taking into account the rather large size of the excretory vesicle in cercariae of P. major, proposed to transfer this genus back to the Heterophyidae. Currently, Pseudexorchis is classified as a member of the Heterophyidae (Pearson Reference Pearson, Bray, Gibson and Jones2008). However, a reconnaissance phylogenetic analysis of P. major performed by Shiraishi et al. (Reference Shiraishi, Tabata, Tanaka, Nakagaito, Okamura and Miura2027) based on the 28S rRNA gene dataset did not support the assignment of Pseudexorchis to the Heterophyidae.
In this study, we focused on the problem of family affiliation of Pseudexorchis. For this purpose, we obtained and analysed the sequences of the 18S rRNA, 28S rRNA, and cox1 genes and ITS clusters from an adult specimen of P. major.
Materials and methods
Sampling and morphological study
Two host fish, S. asotus, were caught at two closely spaced locations near Lake Biwa, Hikone City, Shiga, Japan (35.248867° N, 136.212764° E and 35.271216° N, 136.24174° E) on 5 June 2024. A total of 30 P. major specimens were collected from their intestines; part of them was fixed in 90% ethanol and the rest were fixed in Alcohol-Formaline-Acetic Acid (AFA).
For morphological examination, 11 AFA-fixed voucher specimens from the two above-mentioned locations were stained with Heidenhain’s iron haematoxylin, dehydrated through a graded ethanol series, cleared in creosote, and permanently mounted in Canada balsam. Light microscopy of these specimens was performed using an AXIO Imager A1 microscope (ZEISS, Germany) with a digital camera uEye UI-147x-C (Imaging Development Systems GmbH, Germany). Contrast adjustment of micrographs obtained with this device was performed in Adobe Photoshop CC V.20.0.10. The vouchers were deposited in the Museum of Helminthological Collections at the Centre for Parasitology of the Severtsov Institute of Ecology and Evolution (14568, 14569, Figure 1).
Photographs of a voucher specimen of Pseudexorchis major ex Silurus asotus, Japan. (A) Whole body ventral view. (B–D) Fragments of body with optical focus on individual organs. Abbreviations: os, oral sucker; ov, ovary; rs, canalicular seminal receptacle; sv, bipartite seminal vesicle; t, testes; vi, ventral invagination; vs, ventral sucker; vt, vitellarium. Scale bars: 20 μm.
Figure 1. Long description
A multi-panel figure containing four grayscale micrographs labeled A through D.
Panel A shows the whole ventral body of the specimen. At the anterior end is a large circular O S (oral sucker). Below it is a smaller V I (ventral invagination) and a circular V S (ventral sucker). To the left of the V S is a large, clear S V (bipartite seminal vesicle). In the mid-body and posterior regions are two large, dark masses labeled t (testes), with an R S (canalicular seminal receptacle) positioned between them. Numerous dark, oval eggs are scattered throughout the lateral and posterior margins.
Panel B provides a focused view of the upper-mid body. Arrows point to the O V (ovary) located on the right side, adjacent to the central suckers.
Panel C focuses on the posterior end, highlighting the two large t (testes) and the dense clusters of eggs at the bottom left.
Panel D shows the lateral regions of the body. Arrows point to the V T (vitellarium), which appears as granular, dark-staining tissue distributed along the left and right sides of the specimen.
Each panel includes a vertical scale bar in the bottom right corner representing 20 micrometers.
Molecular data and phylogenetic analyses
DNA was isolated from one complete ethanol-fixed digenean specimen from a location with coordinates 35.248867° N, 136.212764° E. Genomic DNA was extracted using the alkaline lysis method (20 μL of 0.02 N NaOH at 95 °C for 10 min) (Birnboim and Doly Reference Birnboim and Doly1979). The partial 18S–complete ITS1–complete 5.8S–complete ITS2–partial 28S sequences of the nuclear ribosomal DNA and the partial cox1 gene of mitochondrial DNA were amplified using the polymerase chain reaction (PCR). For the 18S–ITS1–5.8S–ITS2–28S sequences, the forward primer WormA (5′–GCGAATGGCTCATTAAATCAG–3′) and the reverse primer 1500R (5′–GCTATCCTGAGGGAAACTTCG–3′) were used. The inner forward primers ITSF (5′–CGCCCGTCGCTACTACCGATTG–3′), ITS1130F (5′–TCACGATGCTCATAAAGTCGTGGC–3′), LSU5 (5′–TAGGTCGACCCGCTGAAYTTAAGC–3′), and the inner reverse primers WormB (5′–ACGGAAACCTTGTTACGACT–3′), ITS800R (5′–ACCAATCACTTGAACCATGTAAAACAG–3′), digl2R (5′–CCGCTTAGTGATATGCTT–3′), and ECD2 (5′–CTTGGTCCGTGTTTCAAGACGGG–3′) also were used to complete the target sequences (Itsukushima et al. Reference Itsukushima, Gosho, Tsuchida and Urabe2025). For the cox1 gene, the forward primer JB3 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) and the reverse primer CO1R-trema (5′–CAACAAATCATGATGCAAAAGG–3′) (Miura et al. Reference Miura, Kuris, Torchin, Hechinger, Dunham and Chiba2005) were used. PCR amplification was performed with a 20 μL mixture containing Gflex (TaKaRa Bio Inc, Otsu, Shiga, Japan), 2 × Gflex buffer, 0.5 μL template DNA, and 1.0 μM forward and reverse primers. The thermocycler protocol comprised 94 °C for 30 s, followed by 40 cycles of 94 °C for 10 s, 50 °C for 30 s, and 68 °C for 60 s. The DNA fragments were then extended at 68 °C for 7 min and stored at 4 °C. PCR was performed using a 2720 Thermal Cycler (Applied Biosystems, Life Technologies).
PCR products were electrophoresed on 2% agarose gels, then purified using the Wizard SV Gel and PCR Clean-up System (Promega). Sequencing was outsourced to FASMAC Co. (Kanagawa, Japan).
Assembling of all newly obtained sequences, alignments, and estimations of the number of variable sites and sequence differences were performed using MEGA 10 software (Kumar et al. Reference Kumar, Stecher, Li, Knyaz and Tamura2018). The assembled sequences were submitted to DNA Data Bank of Japan: 18S–ITS1–5.8S–ITS2–28S locus – LC940153 (4,292 bp) and cox1 gene – LC940154 (915 bp).
Phylogenetic analyses were performed based on partial 28S rRNA, 18S rRNA, and cox1 gene sequences, and complete ITS1–5.8S–ITS2 locus sequences separately, and the concatenated 28S rRNA + ITS2 dataset using the Bayesian inference (BI) algorithms with BEAST v.10.5.0 software (Suchard et al. Reference Suchard, Lemey, Baele, Ayres, Drummond and Rambaut2018). The best nucleotide substitution models were estimated with jModelTest v. 2.1.5 software (Darriba et al. Reference Darriba, Taboada, Doallo and Posada2012) using Akaike’s information criterion (Akaike Reference Akaike1974). The optimal evolutionary model for datasets of the 18S rRNA gene (1,736 bp), 28S rRNA gene (1,236 bp), ITS1–5.8S–ITS2 locus (1,009 bp), and ITS2 + 28S rRNA gene (2,467 bp) was GTR + G + I (Tavaré Reference Tavaré1986), and for the dataset of the cox1 gene (759 bp) – HKY + G (Hasegawa et al. Reference Hasegawa, Kishino and Ta1985).
The Markov chain Monte Carlo algorithm was run for 10,000,000 generations. The priors were applied in the BI algorithm for each sequence dataset according to the parameters of the chosen optimal evolutionary models. Summary parameters and the phylogenetic tree were calculated with a burn-in of 2,500,000 generations. Nodal support was estimated as posterior probabilities in the Bayesian inference analyses (Huelsenbeck et al. Reference Huelsenbeck, Ronquist, Nielsen and Bollback2001). Accession numbers, authority, and supporting information on sequences from GenBank National Center of Biotechnology Information (NCBI)used for the phylogenetic analyses are provided in Supplementary material (Table S1).
Results
The cox1 gene and ITS1–5.8S–ITS2 locus datasets allow us to identify the molecularly characterised digenean specimen as a member of the phylogenetic lineage P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) (Figures 2 and 3). In turn, this lineage appeared as a sister to the lineage P. major Type A of Miura and Takisawa (Reference Miura and Takisawa2024). The mean value of p-distances between the cox1 gene sequences of P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) was 0.2 ± 0.1%, and between the ITS1–5.8S–ITS2 rDNA – 0.1 ± 0.1%. The same mean value for the cox1 gene sequences of P. major Type A of Miura and Takisawa (Reference Miura and Takisawa2024) was 0.3 ± 0.1%; the ITS1–5.8S–ITS2 rDNA sequences were identical. At the same time, the mean values of p-distances between the corresponding sequences of P. major Type A of Miura and Takisawa (Reference Miura and Takisawa2024) and P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) were 11.5 ± 1.1% and 1.5 ± 0.4%.
Position of the newly collected isolate within the Pseudexorchis major clade from the Bayesian phylogenetic tree based on mitochondrial DNA cox1 gene partial sequences (full tree in Supplementary material: Figure S1). Posterior probability values lower than 0.9 are not shown. Newly collected isolate highlighted in bold.
Figure 2. Long description
The phylogenetic tree branches from a single root on the left into two primary clades.
Top Clade (Type B): Highlighted with a light red background.
- Branching nodes show posterior probability values of 0.95, 1.0, and 0.94.
- Terminal isolates from top to bottom are: L C 8 0 5 5 1 7 P. major, L C 8 0 5 5 0 5 P. major, L C 9 4 0 1 5 4 P. major (bolded), L C 8 0 5 5 0 6 P. major, L C 8 0 5 4 9 9 P. major, and L C 8 0 5 5 1 0 P. major.
Bottom Clade (Type A): Highlighted with a light blue background.
- Branching nodes show posterior probability values of 0.9, 1.0, 1.0, and 0.99.
- Terminal isolates from top to bottom are: L C 8 0 5 5 0 7 P. major, L C 8 0 5 5 0 1 P. major, L C 8 0 5 5 0 2 P. major, L C 8 0 5 5 0 0 P. major, L C 8 0 5 5 0 8 P. major, L C 8 0 5 5 1 1 P. major, L C 8 0 5 5 0 3 P. major, and L C 8 0 5 5 0 4 P. major.
Phylogenetic position of the newly collected isolate of Pseudexorchis major reconstructed with the Bayesian inference algorithm based on ITS1–5.8S–ITS2 rDNA sequences. Posterior probability values lower than 0.9 are not shown. Newly collected isolate highlighted in bold.
Figure 3. Long description
The phylogenetic tree branches from a single root on the left, with posterior probability values of 1.0 at major nodes. The tree is divided into four main colored clades and an outgroup at the bottom.
* Cryptogonimidae Clade I: The largest group at the top, shaded in blue, containing numerous species including Latuterus, Siphoderina, Beluesca, Varialvus, and Exorchis species.
* Opisthorchiidae: Shaded in green, containing species such as Metorchis ussuriensis, Clonorchis sinensis, and Amphimerus species.
* Heterophyidae: Shaded in purple, containing Metagonimus species including M. miyatai and M. romanicus.
* Cryptogonimidae Clade II: Shaded in red, containing Acanthostomum and Pseudexorchis major. The newly collected isolate, L C 9 4 0 1 5 3 P. major Type B, is highlighted in bold text within this clade.
* Outgroup: At the bottom, containing Neopsilotrema affine and Psilochasmus oxyurus.
A scale bar at the bottom left indicates a genetic distance of 0.06.
In the tree based on sequences of the ITS1–5.8S–ITS2 locus, the P. major clade comprising the P. major Type A of Miura and Takisawa (Reference Miura and Takisawa2024) and P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) lineages was grouped with a cryptogonimid digenean originally identified by Martínez-Aquino et al. (Reference Martínez-Aquino, Vidal-Martínez and Aguirre-Macedo2017) as Acanthostomum cf. americanum (Pérez-Vigueras, 1956) (Figure 3, Clade Cryptogonimidae II). The P. major + Acanthostomum cf. americanum clade (Clade Cryptogonimidae II) had a strongly supported sister relationship with the Opisthorchiidae + Heterophyidae clade. The large clade formed by all the above-mentioned digeneans was sister to the group of other cryptogonimids included in our phylogenetic analysis (Figure 4, Clade Cryptogonimidae I).
Phylogenetic position of the newly collected isolate of Pseudexorchis major reconstructed with the Bayesian inference algorithm based on partial 28S rRNA gene sequences. Posterior probability values lower than 0.9 are not shown. Newly collected isolate highlighted in bold.
Figure 4. Long description
A horizontal rectangular cladogram with branch lengths indicated by a scale bar of 0.02 at the bottom left. The tree branches from a single root on the left, with posterior probability values of 1.0 or 0.98 at major nodes. The terminal nodes are organized into five distinct color-coded blocks from top to bottom.
* Green block: Opisthorchiidae, containing species such as Opisthorchis felineus, Clonorchis sinensis, and Apophallus species.
* Purple block: Heterophyidae, containing Metagonimus species including M. kinoi and M. pusillus, and Centrocestus formosanus.
* Red block: Cryptogonimidae Clade I I, containing Neocladocystis species, Tanganyikatrema species, and the newly collected isolate L C 9 4 0 1 5 3 Pseudexorchis major Type B highlighted in bold.
* Blue block: Cryptogonimidae Clade I, the largest group, containing Caecincola species, Cryptogonimus chili, Stemmatostoma species, Siphodera species, and Exorchis oviformis.
* Bottom section: Outgroup, containing Psilotrema limosum, Neopsilotrema affine, and Sphaeridiotrema monorchis.
Most nodes show a posterior probability of 1.0, indicating high confidence in the branching structure.
In the tree based on the partial 28S rRNA gene sequence, the newly collected P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) specimen was nested within Clade Cryptogonimidae II, which also included the cryptogonimid digenean Acanthostomum yahuarcaquense Cajiao-Mora & Bullard in Cajiao-Mora, Brule, Dutton, Caicedo-Portilla & Bullard, Reference Cajiao-Mora, Brule, Dutton, Caicedo-Portilla and Bullard2025, Neocladocystis spp. Manter & Pritchard, 1969, and Tanganyikatrema spp., and the nonugens (as per Roberts et al. Reference Roberts, Halanych, Arias, Curran and Bullard2018) KC489791 and KC489792 (Figure 4). This group was a strongly supported sister to the Opisthorchiidae + Heterophyidae clade. The internal topology of the Opisthorchiidae + Heterophyidae clade was similar to that obtained by Sokolov et al. (Reference Sokolov, Kalmykov, Frolov and Atopkin2022). Other cryptogonimids included in our phylogenetic analysis formed the Clade Cryptogonimidae I, which was sister to the large Cryptogonimidae II+ (Opisthorchiidae + Heterophyidae) clade (Figure 4).
In the tree based on the concatenated partial sequences of the 28S rRNA gene and complete sequences of the ITS2 region, the newly collected P. major Type B of Miura and Takisawa (Reference Miura and Takisawa2024) specimen was closer to A. yahuarcaquense, and the clade of these digeneans (Figure 5, Clade Cryptogonimidae II) appeared as a sister to the Opisthorchiidae + Heterophyidae clade. In turn, the large clade of all mentioned digeneans formed a sister relationship with the clade of other cryptogonimids included in this analysis (Figure 5, Clade Cryptogonimidae I).
Phylogenetic position of the newly collected isolate of Pseudexorchis major reconstructed with the Bayesian inference algorithm based on concatenated 28S rRNA + ITS2 rDNA sequence dataset. Posterior probability values lower than 0.9 are not shown. Newly collected isolate highlighted in bold.
Figure 5. Long description
The phylogenetic tree branches from a single root on the left with a posterior probability of 1.0.
Top clade (green): Opisthorchiidae, containing Metorchis orientalis, Metorchis bilis, Clonorchis sinensis, Erschoviorchis anuiensis, and Cryptocotyle lingua.
Second clade (purple): Heterophyidae, containing Metagonimus katsuradai, Metagonimus pusillus, and Metagonimus romanicus.
Third clade (red): Cryptogonimidae Clade II, containing Acanthostomum yahuarcaquense and the newly collected isolate LC940153 Pseudexorchis major Type B highlighted in bold.
Fourth clade (blue): Cryptogonimidae Clade I, the largest group containing Cryptogonimus chili, Caecincola longiscens, Caecincola duttonae, Pseudoacanthostomum floridense, Siphoderina hustoni, Stemmatostoma pearsoni, Stemmatostoma sp., Stemmatostoma cribbi, Exorchis oviformis, Timoniella imbutiformis, and Neochasmus sogandaresi.
Bottom group (bracketed): Outgroup, containing Psilochasmus oxyurus, Sphaeridiotrema pseudoglobulus, and Apopharynx bolodes.
Nodes are labeled with posterior probability values ranging from 0.96 to 1.0. A scale bar at the bottom left indicates a genetic distance of 0.03.
The cox1 and 18S rRNA genes are poorly informative for assessing the phylogenetic relationships of Pseudexorchis (Supplementary material, Figures S1 and S2).
Discussion
Miura and Takisawa (Reference Miura and Takisawa2024) studied the cox1 gene and ITS cluster sequences obtained from rediae of P. major collected from Semisulcospira libertina (Gould, 1859) in different regions of Japan and showed that this taxon of digeneans is represented by two phylogenetic lines, which they named P. major Type A and P. major Type B. The authors themselves did not discuss the taxonomic status of these lineages. It is worth noting that these lineages are apparently sympatric, as they were discovered in the same water system, the River Yodo basin (Miura and Takisawa Reference Miura and Takisawa2024; Shiraishi et al. Reference Shiraishi, Tabata, Tanaka, Nakagaito, Okamura and Miura2027; our data). There are different approaches to interpreting taxonomic statuses of morphologically similar trematodes differentiated from each other by the cox1 gene and ITS1–5.8S–ITS2 locus with p-distance values greater than 5% and 1%, respectively (Cribb et al. Reference Cribb, Bray, Martin, Wee and Cutmore2026; Vilas et al. Reference Vilas, Criscione and Blouin2005). We believe that the level of divergence between Type A and Type B allows us to hypothesise the presence of hidden species diversity within P. major. Until this issue is clarified, we propose to consider all adult specimens corresponding to the morphotype of P. major as P. major sensu lato. Due to the small size of these worms themselves, we were unable to preserve a hologenophore. We cannot guarantee that the vouchers we preserved for morphological study (Figure 1) belong to the same phylogenetic lineage of P. major sensu lato as the molecularly characterised specimens. Therefore, we identify these vouchers only as P. major sensu lato without assigning them to the specific phylogenetic lineage.
The presented data do not support the hypothesis that Pseudexorchis belongs to the Heterophyidae and demonstrate the integration of this genus into the Clade Cryptogonimidae II, which also contains A. yahuarcaquense, Neocladocystis spp., Tanganyikatrema spp., and the nonugens KC489791 and KC489792, currently considered within the concept of Cryptogonimidae (Cajiao-Mora et al. Reference Cajiao-Mora, Brule, Dutton, Caicedo-Portilla and Bullard2025, Reference Cajiao-Mora, Curran, Brule, Gordillo-González, Dutton, Warren and Bullard2026; Kmentová et al. Reference Kmentová, Bray, Koblmüller, Artois, De Keyzer, Gelnar, Vanhove and Georgieva2020). In our phylogenetic analyses, the Clade Cryptogonimidae II was closer to the clade formed by opisthorchids and heterophyids than to the Clade Cryptogonimidae I, which includes other cryptogonimids (Figures 4 and 5).
The Clade Cryptogonimidae II contains exclusively freshwater species (Cajiao-Mora et al. Reference Cajiao-Mora, Brule, Dutton, Caicedo-Portilla and Bullard2025; Jayawardena et al. Reference Jayawardena, Tkach, Navaratne, Amerasinghe and Rajakaruna2013; Kmentová et al. Reference Kmentová, Bray, Koblmüller, Artois, De Keyzer, Gelnar, Vanhove and Georgieva2020; Shimazu Reference Shimazu2017), in contrast to the Clade Cryptogonimidae I, which contains both marine and freshwater species (e.g., Martin and Cutmore Reference Martin and Cutmore2022; Solodovnik et al. Reference Solodovnik, Tatonova, Urabe, Besprozvannykh, Nakao and Inoue2021; Truong et al. Reference Truong, Curran, Simcox, Bybel and Bullard2025; Velázquez-Urrieta et al. Reference Velázquez-Urrieta, García Varela and Pérez-Ponce de León2024). The morphological synapomorphies of the Clade Cryptogonimidae II are not yet clear, since Pseudexorchis is similar to Neocladocystis spp., Tanganyikatrema spp., and A. yahuarcaquense only in terms of generalised cryptogonimid characters (cf. Kmentová et al. Reference Kmentová, Bray, Koblmüller, Artois, De Keyzer, Gelnar, Vanhove and Georgieva2020; Miller and Cribb Reference Miller, Cribb, Bray, Gibson and Jones2008; Shimazu Reference Shimazu2017).
If the paraphyly of cryptogonimids we identified is reproduced in future reconstructions, then the Clades Cryptogonimidae I and II will undoubtedly have to be assigned to different families: Cryptogonimidae sensu stricto (Clade Cryptogonimidae I containing the type genus of the family) and probably Acanthostomidae (Clade Cryptogonimidae II). The Acanthostomidae was erected by Poche (Reference Poche1925). Cable and Hunninen (Reference Cable and Hunninen1942) questioned the need to separate the Acanthostomidae and the Cryptogonimidae. The view of these authors was developed by Brooks (Reference Brooks1980), who downgraded the family Acanthostomidae to a subfamily within the Cryptogonimidae. Miller and Cribb (Reference Miller, Cribb, Bray, Gibson and Jones2008) do not recognise the need to separate the Acanthostominae or any other subfamilies within the Cryptogonimidae. However, the question of whether the genus Acanthostomum Looss, Reference Looss1899 belongs to the Clade Cryptogonimidae II requires clarification. Originally, the nonugens KC489791 and KC489792 were assigned to the genus Acanthostomum and identified as Acanthostomum burminis (Bhalerao, 1926) and Acanthostomum sp. (Jayawardena et al. Reference Jayawardena, Tkach, Navaratne, Amerasinghe and Rajakaruna2013). Cajiao-Mora et al. (Reference Cajiao-Mora, Brule, Dutton, Caicedo-Portilla and Bullard2025) consider this identification erroneous because A. burminis of Jayawardena et al. (Reference Jayawardena, Tkach, Navaratne, Amerasinghe and Rajakaruna2013) and Acanthostomum sp. of Jayawardena et al. (Reference Jayawardena, Tkach, Navaratne, Amerasinghe and Rajakaruna2013) (i.e., the nonugens KC489791 and KC489792) turned out to be phylogenetically closer to the group of the genera Neocladocystis Manter & Pritchard, 1969 and Tanganyikatrema Kmentová, Georgieva & Bray in Kmentová, Bray, Koblmüller, Artois, De Keyzer, Gelnar, Vanhove & Georgieva, Reference Kmentová, Bray, Koblmüller, Artois, De Keyzer, Gelnar, Vanhove and Georgieva2020 than to the species A. yahuarcaquense described by them from Colombia. A similar topology is also reproduced in our phylogenetic analysis (Figure 4). However, the genus affiliation of A. yahuarcaquense also requires confirmation, as the type species of Acanthostomum was described from the Old World (Egypt) rather than the New World (Looss Reference Looss1896, Reference Looss1899). The sequences of Acanthostomum cf. americanum included in our ITS1–5.8S–ITS2 tree can also hardly be considered reliably belonging to the genus Acanthostomum, since the identification of the specimens from which they were generated was not supported by morphological evidence. Obviously, the question of the true genus affiliation of Acanthostomum-like digeneans requires a molecular study of the type species of Acanthostomum or at least a significant number of morphologically reliably identified representatives of this genus.
Supplementary material
The supplementary material for this article can be found at http://doi.org/10.1017/S0022149X26102508.
Acknowledgements
We sincerely thank Ms. Momoko Eki and Mr. Sho Mototani for their help in catching the fishes.
Financial support
The study was carried out as part of the state assignment of the Ministry of Science and Higher Education of the Russian Federation, projects №. 124012400285-7 (D.M. Atopkin, phylogenetic analyses, editing) and FFER-2024-0027 (S.G. Sokolov, interpretation of phylogenetic tree), and Sakhalin State University, project FEFF-2026-0008 (S.G. Sokolov, conceptualisation, data curation, draft writing, editing).
Competing interests
The authors declare none.
Ethical standards
The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of animals.
