Introduction
As one of the most popular consumed beverages, coffee has become an indispensable material in modern society because of the advantages of good taste and aroma, stimulating effects on the central nervous system as well as the impact on public health, such as antibacterial activity (Grosso et al., Reference Grosso, Godos, Galvano and Giovannucci2017; Nieber, Reference Nieber2017; Nguyen et al., Reference Nguyen, Cho, Song, Oh, Funada and Bae2019; Ogata et al., Reference Ogata, Takeshita, Shibata, Matsumi, Kageyama, Asakawa and Yamashita2019). Coffee is cultivated widely in tropical and subtropical regions, including India, Vietnam, and Thailand (Hall et al., Reference Hall, Cork, Phythian, Chittamuru, Jayarama, Venkatesha, Sreedharan, Vinod Kumar, Seetharama and Naidu2006; Venkatesha and Dinesh, Reference Venkatesha and Dinesh2012). In China, four provinces including Yunnan, Sichuan, Hainan, and Taiwan are the primary coffee-growing areas, and coffee production has been rising rapidly since the 1990s (Rigal et al., Reference Rigal, Vaast and Xu2018).
The coffee white stem borer, Xylotrechus quadripes Chevrolat (Coleoptera: Cerambycidae), which is widely distributed in many Asian countries, is one of the most destructive pest affecting the yield and quality of coffee beans (Venkatesha and Dinesh, Reference Venkatesha and Dinesh2012; Bharathi et al., Reference Bharathi, Santosh and Sreenath2017; Pang et al., Reference Pang, Zeng, Zhu and Liu2018). However, the host range of X. quadripes is relatively narrow. Coffea arabica L. (Gentianales: Rubiaceae) is considered as the most preferred and principal host plant. In the past few decades, the research on this pest has focused on the pests’ life history, biology, behavior, nature of the damage, flight periods, sex pheromones, natural enemies and pest control strategies (Rhainds et al., Reference Rhainds, Lan, King, Gries, Mo and Gries2001; Wei and Kuang, Reference Wei and Kuang2002; Venkatesha and Dinesh, Reference Venkatesha and Dinesh2012; Yang et al., Reference Yang, Wu, Xu, Wu, He and Qin2017). Few studies have been done on the molecular biology of X. quadripes. So far, only some olfactory-related genes have been identified by the antennal transcriptome of X. quadripes, including 33 odorant receptors, five gustatory receptors, 18 ionotropic receptors, and four sensory neuron membrane proteins (Pang et al., Reference Pang, Zeng, Zhu and Liu2018). However, their expression level in different tissues is still unclear. Therefore, it is difficult to confirm target genes and their function on olfactory mechanism of X. quadripes. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) is one of the most reliable, specific, sensitive, and economical methods for expression analysis of target genes at the transcriptional level (Shu et al., Reference Shu, Zhang, Cui, Sun, Sethuraman, Yi and Zhong2018; Satnam et al., Reference Satnam, Suneet, Mridula, Gurmeet and Pankaj2019; Wang et al., Reference Wang, Meng, Zhu, Sun, Gao, Gou and Liu2019). However, the accuracy and reliability of the results are easily influenced by the RNA quality reverse-transcription, and the primers amplification efficiency (Hu et al., Reference Hu, Fu, Qiao, Sun, Zhan, Jin, Jiang, Gong, Xiong and Wu2018). Therefore, the reference genes with a relatively stable expression in various conditions were introduced into qRT-PCR experiments to normalize the final results (Zhang et al., Reference Zhang, Liu, Yuan, Chen and Gao2018; Wang et al., Reference Wang, Meng, Zhu, Sun, Liu, Gao and Gou2020). In most cases, the internal reference genes are selected randomly for qRT-PCR results analyses. However, no single gene could be continuously expressed in different samples (Luo et al., Reference Luo, Ma, Li, Zhu, Zhang, Lei, Jin, Joe and Chen2018). It is essential to conduct internal reference gene stability testing before performing qRT-PCR experiments.
At present, the stability of several reference genes have been identified in Coleoptera or other insects, including the traditional reference genes actin (Act) in Tribolium castaneum (Sang et al., Reference Sang, He, Wang, Zhu-Salzman and Lei2015), elongation factor 1 alpha (EF1α) in Anthonomus eugenii Cano (Pinheiro and Siegfried, Reference Pinheiro and Siegfried2020), tubulin (Tub) in Bradysia odoriphaga (Tang et al., Reference Tang, Dai and Zhang2019), some ribosomal proteins RPS2 and RPL27 in grassland caterpillars (Zhang et al., Reference Zhang, Zhang, Wang, Yang, Li and Yuan2017), RPS3A and RPL13A in Helopeltis theivora (Wang et al., Reference Wang, Meng, Zhu, Sun, Gao, Gou and Liu2019), and eukaryotic initiation factor EIF4A in Diaphania caesalis (Wang et al., Reference Wang, Meng, Zhu, Sun, Liu, Gao and Gou2020). However, there is no relevant research on the selection of internal reference gene of X. quadripes. And the transcriptional levels of genes involved in the molecular mechanisms of sexual recognition, preference for C. arabica, genetic developmental adaptability and insecticide-resistant development have still been difficult to quantify using qRT-PCR in X. quadripes. Therefore, to find the reference genes with stable expression in different samples of X. quadripes, nine genes including EF1α, Act, α-Tub, three ribosomal proteins (RPS27a, RPL10a and RPS3), V-type proton ATPase catalytic subunit A (V-ATP), and two eukaryotic initiation factors (EIF3D and EIF4E) were identified and used as the candidate reference. In addition, in order to ensure that the designed primers are suitable for the qRT-PCR, we first evaluate the specificity and amplification efficiency of the candidate gene primers by establishing the standard curve. The expression stabilities of all the genes were assessed by four standard programs: NormFinder, BestKeeper, geNorm, and RefFinder. This study can provide stable internal reference genes for quantitative analysis of target genes, which will help to obtain accurate and reliable quantitative results of target genes, and provide reference for related molecular mechanisms in the expression pattern of target genes in X. quadripes.
Materials and methods
Insects
X. quadripes were collected from the coffee plants in Chengmai county, Hainan province. The branches with borer holes were taken to the laboratory and placed in insect cages. A laboratory colony was established and maintained at 26 ± 1 °C, 75 ± 5% relative humidity, and 14:10 light: dark cycle.
Biotic factors
Developmental stages
Individuals at three developmental stages were collected, including three larvae, three pupae, and three adults (whole-body). All samples were collected into 1.5 ml centrifuge tubes (50–100 mg for each tube) and kept at −80 °C. Each developmental stage set three biological replications.
Tissues and sexes
Six tissue samples of antennae (20 individuals), head (10 individuals), thorax (five individuals), abdomen (five individuals), leg (five individuals), and wing (10 individuals) were dissected by scalpel and washed in cold phosphate-buffered saline. The same sampling method was used in different gender groups. All samples were placed in 1.5 ml centrifuge tubes (50–100 mg for each tube) and kept at −80 °C. Each treatment contained three biological replications.
Abiotic factors
Insecticide treatment
Two normal stomach-toxicity insecticides of β-cypermethrin and chlorpyrifos, which are commonly used for controlling the larva and adults of X. quadripes, were selected for this study. The above two insecticides were diluted to three concentrations (1 × 105 dilution, 5 × 106 dilution, and 1 × 107 dilution) in gradient, respectively. Three alive adults were treated at each concentration for 10 h and collected into 1.5 ml centrifuge tubes. Finally, the samples were kept at −80 °C. Each treatment contained three biological replications.
Temperature stress
Three adults were exposed to two low temperatures (4°C and 10°C) and two high temperatures (32°C and 42°C) for 1 h, respectively. The treated alive adults were collected into 1.5 ml centrifuge tubes and kept at −80 °C. Each treatment contained three biological replications.
Total RNA isolation and cDNA synthesis
Total RNA from different tissues, developmental stages, sexes, insecticide treatment, and temperature stress was extracted by TRIzol Reagent (Invitrogen, USA). The sample was disrupt and homogenized in 1 ml TRIzol reagent. Then, 200 μl chloroform was added to the above solution after incubating it for 5 min at room temperature (RT). The tube was shaken vigorously for 15 s and incubated at RT for 3 min. After centrifuging the sample for 15 min at 12,000 rpm at 4 °C, transferred the aqueous phase containing the RNA to a new centrifuge tube, added the same volume of isopropanol, incubated at RT for 10 min, centrifuged with 12,000 rpm for 10 min at 4 °C, and discarded the supernatant. The precipitation was resuspended and vortexed briefly by 1 ml 75% ethanol for 2−3 times. Finally, the RNA pellet was air-dried for 5 min and dissolved with moderate amounts of RNase-free water. The total RNA concentration and purity were measured by a fluorescence microplate reader (BioTek, USA).
First-strand cDNAs were synthesized using 1 μg of total RNA with PrimeScript RT reagent kit (TIANGEN, China). In brief, 1 μg of total RNA, 2 μl of 5 × gDNA eraser buffer, and additional RNase-free water was added up to 10 μl. The mixture was incubated at 42 °C for 3 min and chilled in ice immediately. Another 10 μl mixture, which consists of 2 μl 10 × King RT Buffer, 1 μl FastKing RT Enzyme Mix, 2 μl FQ-RT Primer Mix, and 5 μl RNase-free water, was added to the mixture above. Make sure the final volume reaches 20 μl. The reaction was performed at 42 °C for 15 min, 95 °C for 3 min, and cooled with ice. Finally, the products were stored at −20 °C before use.
Reference gene selection and primer design
The nine selected sequences were obtained from the transcriptome data of male and female adults of X. quadripes, and were identified as candidate internal reference genes after NCBI alignment. The primers of these genes were designed by Primer Premier 5.0 software according to the predicted ORF and listed in Table 1. PCR amplifications were performed by the program of denaturing at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. The amplification products were detected by 1% agarose gel electrophoresis and purified by E.Z.N.A.™ Gel Extraction Kit (Omega, USA). After sequencing and comparing the amplification product to the predicted sequence from transcriptome data, the DNA fragments were ligated with pMD-19T and transformed into Escherichia coli DH5α (TaKaRa, China). After overnight culture in LB liquid medium containing ampicillin resistance, the plasmid was extracted by E.Z.N.A.™ Plasmid Miniprep Kit II (Omega, USA) and used as the templates to draw the standard curve of candidate genes.
Primer characteristics of nine candidate reference genes for qRT-PCR in X. quadripes
qRT-PCR
qRT-PCR reactions were performed with 2 × TB Green Premix Ex Taq (TaKaRa, China) on BioRad CFX96 Real-Time PCR detection system. Amplification conditions consisted of an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. After the reaction, a melting curve analysis from 65 °C to 95 °C was applied to all reactions to ensure consistency and specificity of the amplified product. Each template contained three technical replicates. A series of 10-fold dilutions of plasmids were used as templates to create the five-point standard curves using the linear regression model (Pfaffl et al., Reference Pfaffl, Tichopad, Prgomet and Neuvians2004). The regression equation was carried out to calculate the efficiency (E) and correlation coefficient (R 2) of each primer pair. The efficiencies (E) of corresponding primers were estimated according to equation:
Data analysis
The cycle threshold values (C t values) of different samples of the candidate reference genes were obtained by qRT-PCR. The stability of candidate reference genes was ranked using Microsoft Excel-based software tools (or algorithm), including NormFinder, BestKeeper, geNorm, and RefFinder. The relative quantities converted from the raw C t values (the highest relative quantity of gene was set to 1) were used as input data for NormFinder and geNorm. NormFinder provides a stability value (SV) for each gene, a direct measure of the estimated intra- and inter-group expression variation (Andersen et al., Reference Andersen, Jensen and Ørntoft2004). BestKeeper uses raw C t values and PCR efficiency to determine the optimal reference genes (Pfaffl et al., Reference Pfaffl, Tichopad, Prgomet and Neuvians2004). geNorm calculates the expression stability value (M) and pairwise variation (V). Gene expression is considered stable when the M value is below 1.5, and genes produce the lowest M values with the most stable expression. Besides, the value of Vn/Vn +1 was used to determine the optimal normalization reference gene number, and geNorm Vn/Vn +1 < 0.15 could be the standard for better normalization (Vandesompele et al., Reference Vandesompele, De Preter, Pattyn, Poppe, Van Roy, De Paepe and Speleman2002). Finally, the web-based program RefFinder (https://www.heartcure.com.au/reffinder/?type=reference), a comprehensive platform integrating the above three algorithms, provided an overall ranking of the stability of candidate reference genes (Xie et al., Reference Xie, Xiao, Chen, Xu and Zhang2012).
Validation of recommended reference genes
To evaluate the reliability of recommended reference genes, the transcription levels of X. quadripes odorant receptor (XquaOR) (Accession number: MW248459) were estimated in different development stages, tissues, and sexes using the forward primer: (ACATTCGTTGGTGAGAGCGT) and the reverse primer: (GCGTTCCAAGGGTACCAAGA). The relative expression levels of heat shock protein 70 (XquaHsp70) (Accession number: MW248460) were evaluated to verify the reliability of reference genes in temperature treatment, and the primers were used as the forward: CGTTCTACAGACAGGAGCCC and the reverse: GGTTTGCCTTCTGCATTGGG. For insecticide treatment, the treatment groups were the adults exposed to 1 × 105 dilution (chl0.1M) and 5 × 105 (chl0.5M) dilution of chlorpyrifos diluents, respectively. The control group (CK) was untreated adults. The relative expression levels of cytochrome P450 CYP18 (XquaCYP18) (Accession number: MW248461) were normalized by the reference genes in insecticide treatments, using the forward primer: AATCTGTGGGAGGATCCCGA and the reverse primer: ACCGACTCCGAAAGGTAGGA. Relative expression levels of XquaOR, XquaHsp, and XquaCYP450 were calculated based on the $2^{-{\Delta \Delta C_{\rm t}}}$
method (Livak and Schmittgen, Reference Livak and Schmittgen2001). All the treatments were performed with three biological and technical replicates. The one-way ANOVA test was used for data analyses. Expression differences of target genes in different treatments were performed by Student's t-tests using SPSS 20.0 (SPSS, Inc., United States).
Results
Primer specificity and amplification efficiency of candidate reference genes
The primer specificity and amplification efficiency of the nine candidate reference genes were analyzed and shown in fig. 1. Each gene had only one melting peak, revealing the high specificity of the primers. Besides, the primer amplification efficiency was among 94.51–109.61% along with the standard curve line R 2 ranged from 0.982 to 0.999 (Table 1). These results showed that the primers were suitable for qRT-PCR experiments.
Melt curve analysis of nine candidate reference genes.
Transcriptional profiles of candidate reference genes in different samples
The raw C t values of the candidate reference genes in different samples were obtained by qRT-PCR experiments. After statistics, The average C t values of EF1α, Act, RPS27a, RPL10a, V-ATP, α-Tub, RPS3, EIF3D and EIF4E were 19.87, 24.23, 21.02, 22.47, 23.25, 19.59, 21.43, 24.81 and 23.65, respectively. Moreover, all C t values fell in 15–30, which indicated that it was reliable for further evaluation of expression stability (fig. 2).
Average Ct values of nine candidate reference genes at all experimental groups in X. quadripes.
Identification of best reference genes by NormFinder
The stability value calculated by NormFinder was considered as an important parameter for judging the stability of internal reference genes. The lower the stability value, the better the stable gene. Therefore, in tissue samples, EIF4E, RPL10a, and α-Tub with the lower SV were ranked as the top three stable reference genes, and V-ATP with the highest SV was identified as the least stable gene. In samples of developmental stages, EIF3D and RPS3 were regarded as the most stable genes. Act was considered as the most unstable reference gene. In sex samples, V-ATP and RPS27a expressed and showed more stable among these genes. In insecticide tress and temperature treatment, RPS27a was considered to be the most stable internal reference gene. For all the samples, the order of reference gene stability was showed as follows: RPL10a > RPS27a > EIF4E > EF1α > EIF3D > α-Tub > RPS3 > V-ATP > Act (Table 2).
Expression stability of candidate reference gene in six treatments analyzed by NormFinder
Evaluation of reference genes-expression stabilities by BestKeeper
The standard deviation (SD) value, coefficient of variation (CV), and correlation coefficient (r) were three important parameters to evaluate the expression stability of reference genes according to Bestkeeper software. The best reference genes owned the lowest SD and CV value and the highest correlation coefficient. As shown in Table 3, RPL10a, EIF4E, and α-Tub, with the lowest SD value of 0.287, 0.432, and 0.453 and the lowest CV of 1.266, 1.813, and 2.242, were evaluated as the most stable genes in samples of tissues, while RPS3 and EF1α were the two least stable reference genes. Besides, in different developmental stages, RPS3, V-ATP, and EIF4E expressed more stability but Act and RPS27a expressed unstably. The top two ranked genes in sex samples were EF1α and V-ATP, while Act and EIF4E were not suitable as the reference genes for normalization. In the samples treated with different temperatures, EF1α and V-ATP expressed more stably, and α-Tub and Act had unstable expression profiles. In samples of insecticide stress, EIF3D and V-ATP were the ideal reference genes for qRT-PCR experiments. Finally, V-ATP and EF1α expressed more stability in all the samples, followed with RPS3, RPL10a, RPS27a, EIF4E, and EIF3D. Act and α-Tub showed the highest value of SD and expressed unstably.
Expression stability of candidate reference gene in six treatments analyzed by BestKeeper
Stability of candidate reference genes evaluated by geNorm
The optimal number of reference genes for qRT-PCR experiments can be confirmed by the pairwise variation (Vn/Vn +1) using geNorm. When the value of Vn/Vn +1 < 0.15, the number of recommended stable genes is n. According to the results, the pairwise variation (V 2/V 3) was less than 0.15 in the samples of developmental stages, sexes, temperatures, and insecticides treatments. Therefore, two reference genes should be selected for qRT-PCR normalization in these samples. For tissue samples and all the samples, the pairwise variations (V 2/V 3) were larger than 0.15. However, the values of V 3/V 4 were less than 0.15, which means three reference genes should be selected for tissue samples and all the samples (fig. 3).
The pairwise variations (Vn/Vn ＋1) of nine candidate genes analyzed by geNorm algorithm.
The software of geNorm evaluates the stability of candidate reference genes based on the M value. The lower M value indicated the more stable expression. As shown in Table 4, for biotic factors, RPS27a, EIF3D were identified as the most stable genes in tissue samples. EF1α and RPL10a were the most stable genes in developmental stage samples. EF1α and V-ATP expressed more stability in sex samples. For abiotic factors, V-ATP and EIF3D were the ideal reference genes in samples treated with different temperatures. RPS27a and RPL10a were verified as the two stable reference genes in samples treated with various insecticides. Finally, RPS27a and RPL10a were demonstrated to be the suitable reference genes for qRT-PCR normalization in all samples.
Expression stability of candidate reference gene in six treatments analyzed by geNorm
Comprehensive evaluation of candidate reference genes by RefFinder
RefFinder algorithm is an integrated web-based program, which can determine the stability of candidate reference genes by comprehensively analyzing the results of the above three softwares. The comprehensive rankings of reference genes for all treatments were shown in fig. 4. The most stable reference gene in tissues was EIF4E, followed by RPL10a and RPS27a. RPL10a and EIF3D were ranked as the top two stable reference genes in developmental stages. V-ATP and EF1α were recommended as the most two stable reference genes in sexes. For abiotic factors, EIF3D and V-ATP were the two ideal reference genes in temperature treatment. RPS27a and RPL10a were the most stable reference genes in insecticide treatment. For all samples, RPL10a, RPS27a, and EF1α were recommended as the stable reference genes.
Comprehensive ranking of expression stability of nine candidate reference genes in six experimental groups determined by RefFinder.
Validation of reference gene selection
To verify the reliability of recommended reference genes, the transcriptional levels of XquaOR, XquaHsp70, XquaCYP18 were standardized by using the most and least stable reference genes in biotic and abiotic factors, respectively. Among different tissues, the normalized transcript levels of XquaOR using the most stable gene EIF4E were similar to those calculated by combining the most two (EIF4E and RPL10a) or three (EIF4E, RPL10a, and RPS27a) stable genes. However, the expression levels of XquaOR obtained by using the least stable gene V-ATP were significantly different from that of using the most stable gene EIF4E only and using the two or three stable genes combination in samples of thorax, abdomen, and antenna (fig. 5a). XquaOR was higher expressed in adults than in larva and pupa at different development stages, whether the stable or unstable reference gene was used for normalization. The expression level of XquaOR normalized by the most stable gene RPL10a was consistent with that by the combination of the top two stable genes RPL10a and EIF3D, but it was significantly different from that normalized by the least stable gene Act in samples of pupa and adult (fig. 5b). In different sexes, no obvious difference was observed in the expression of XquaOR normalized with the most stable gene V-ATP or the combination of the most two stable genes (V-ATP and EF1α) in the same sample. However, the expression level of XquaOR normalized by the least stable gene Act showed a significant difference with that by the most stable gene (V-ATP) or the combination of most two (V-ATP and EF1α) stable genes (fig. 5c).
Validation of reference genes using different target genes. The relative expression levels of a target gene XquaOR were normalized by the recommended stable reference genes and unstable gene in tissues (a), development stages (b) and sexes (c). The expression level of another target gene XquaHsp70 was analyzed in temperature stress (d). For insecticide stress, the expression level of XquaCYP18 was respectively detected using the most and least stable reference genes (e).
A target gene XquaHsp70, which validated the stability of recommended reference genes in temperature treatment, was highly expressed in low temperatures (10°C). The expression level calculated by the most stable gene EIF3D were no significant differences with that normalized by the combination of the most two stable genes (EIF3D and V-ATP) no matter under high-temperature conditions (32°C) or the super high-temperature condition (42°C). However, the expression level of XquaHsp70 normalized by the least stable gene α-Tub were significantly different from that determined with the most one (EIF3D) or combination of two (EIF3D and V-ATP) stable genes (fig. 5d).
Across insecticide treatment, the target gene XquaCYP18 was higher expressed in treated groups than control. However, the expression level of XquaCYP18 under treatment samples normalized using the least stable gene Act was significantly different from that using the most stable gene RPS27a or the combination of the two best stable genes RPS27a and RPL10a (fig. 5e).
Discussion
The qRT-PCR is the most efficient, reliable, and widely used method for transcription level analysis of target genes, which could lead to a better understanding of the molecular mechanisms. The use of internal reference genes was essential for the normalization of qRT-PCR results. However, no single internal reference gene could keep stable under all the experimental conditions (Luo et al., Reference Luo, Ma, Li, Zhu, Zhang, Lei, Jin, Joe and Chen2018). Therefore, it is necessary to verify the expression stability of reference genes before conducting the qRT-PCR experiments. Recently, many studies have been performed to check the expression stability of reference genes in Coleoptera insects under biotic and abiotic factors. For example, the expression stabilities of six candidate reference genes in spotted cucumber beetle Diabrotica undecimpunctata howardi (Barber) were evaluated by geNorm, NormFinder, BestKeeper, and delta-CT under different experimental conditions, including developmental stage, neonate exposure, and different temperatures, and neonate starvation (Basu et al., Reference Basu, Pereira, Pinheiro, Wang, Valencia-Jiménez, Siegfried, Louis, Zhou and Vélez2019). Besides, the similar researches of other Coleoptera insects also have been reported, including Aquatica leii (Yang et al., Reference Yang, Zheng, Liu, Li, Jiang, Lin, Deng and Zhang2020), southern pine beetle Dendroctonus frontalis (Kyre et al., Reference Kyre, Rodrigues and Rieske2019), ladybird beetle Henosepilachna vigintioctomaculata (Lü et al., Reference Lü, Chen, Guo, Ye, Qiu, Wu, Yang and Pan2018a), Asian Ladybird Harmonia axyridis (Yang et al., Reference Yang, Pan, Yuan and Zhou2018), Galeruca daurica (Joannis) (Tan et al., Reference Tan, Zhou and Pang2017), biparental beetle, Lethrus apterus (Nagy et al., Reference Nagy, Németh, Juhász, Póliska, Rácz, Kosztolányi and Barta2017), Asian longhorned beetle Anoplophora glabripennis (Rodrigues et al., Reference Rodrigues, Dhandapani, Duan and Palli2017), Coleomegilla maculate (Yang et al., Reference Yang, Pan, Noland, Zhang, Zhang, Liu and Zhou2015) and Tribolium castaneum (Sang et al., Reference Sang, He, Wang, Zhu-Salzman and Lei2015). In this study, nine candidate reference genes were identified in X. quadripes, and their stabilities under different experimental conditions were evaluated by four software of NormFinder, BestKeeper, geNorm, and RefFinder. This study is the first investigation of reference gene selection in X. quadripes.
As the abundant proteins in the eukaryotic ribosome, ribosomal proteins involve ribosome assembly and protein translation, and various cellular processes (Shu et al., Reference Shu, Zhang, Cui, Sun, Sethuraman, Yi and Zhong2018; Feng et al., Reference Feng, Zhang, Wu, Wang, Xu, Yang, Li, Wei and Chou2019). Many ribosomal proteins, including ribosomal protein L7A, ribosomal protein L13A, ribosomal protein S13, ribosomal protein S20 were used as the reference genes for expression stability evaluation in many insects (Shu et al., Reference Shu, Zhang, Cui, Sun, Sethuraman, Yi and Zhong2018; Bin et al., Reference Bin, Pu, Shu, Kang, Luo, Tang, Wu and Lin2019). For example, four ribosomal proteins including RPL6, RPL13, RPS18, and RPL32 were selected for expression stability evaluation in Henosepilachna vigintioctomaculata, in which RPL13 and RPS18 were ranked as the most stable expression genes in different experimental conditions, including developmental stages, tissues, treatments with different temperatures and host plants (Lü et al., Reference Lü, Chen, Guo, Ye, Qiu, Wu, Yang and Pan2018a,). Besides, ribosomal protein 18 was verified as the most stable gene in different samples of Holotrichia oblita, Propylea japonica and Dendroctonus frontalis under RNA interference treatment (Lü et al., Reference Lü, Chen, Guo, Ye, Qiu, Yang and Pan2018b; Kyre et al., Reference Kyre, Rodrigues and Rieske2019; Xie et al., Reference Xie, Zhong, Lin, Zhang and Chen2020). In Thermobia domestica, RPL32 was appropriate for different developmental stages, in various body parts, under dsRNA microinjection and starvation stresse (Bai et al., Reference Bai, Lv, Zeng, Jia and Luan2020). In this study, three ribosomal proteins RPS3, RPL10a, and RPS27a were selected for the stability evaluation of reference genes. Except RPS3, RPL10a and RPS27a were identified as the best reference genes in most cases including tissue samples, developmental stage samples, insecticide treatment, and all samples.
Moreover, EF1α were considered as the most stable reference gene in some samples, such as the sex samples of Propylea japonica (Lü et al., Reference Lü, Chen, Guo, Ye, Qiu, Yang and Pan2018b), and different developmental stages and sex samples in Adelphocoris suturalis (Luo et al., Reference Luo, Ma, Li, Zhu, Zhang, Lei, Jin, Joe and Chen2018). In our results, EF1α was also recommended as a reference gene for target gene normalization in sex samples. In addition, V-ATP was rarely used as a reference gene for target gene normalization, but V-ATP was considered to be the most stable reference gene in some plants, such as Panax ginseng (Liu et al., Reference Liu, Wang, Sun, Zhu, Yang and Zhao2014). However, V-ATP was considered as another stable reference gene in sex samples in X. quadripes in this study .
The main cytoskeletal elements actin and tubulin are mainly responsible for the maintenance of cytoskeletal structure and morphology in all eukaryotic cells, as well as a variety of basic cellular processes, cell movement and adhesion, cell division, and protein and RNA transport (Caridi et al., Reference Caridi, Plessner, Grosse and Chiolo2019; van der Laan et al., Reference Van der Laan, Dubra and Rogowski2019). In general, actin or tubulin is commonly used as the internal reference genes to analyze qRT-PCR results. However, many studies have shown that the skeleton proteins could not be suitable as the reference genes for qRT-PCR normalization because of the unstable expression profiles under different conditions. For example, actin was recognized as the most unstable genes in Henosepilachna vigintioctomaculata under different experimental conditions, including samples of different developmental stages, tissues, as well as the samples treated with different temperatures or host plants (Lü et al., Reference Lü, Chen, Guo, Ye, Qiu, Wu, Yang and Pan2018a). Besides, tubulin has an unstable expression in tissues of Asian longhorned beetle Anoplophora glabripennis (Rodrigues et al., Reference Rodrigues, Dhandapani, Duan and Palli2017). Similarly, our results have revealed that Act and α-Tub expressed unstable in different types of samples of X. quadripes. It means that the selection of internal reference genes for qRT-PCR analysis should be cautious.
Our results confirmed that different algorithms obtained different results due to their different calculated methods. Take temperature treatment as an example, the order of reference gene stability was chaotic after evaluated by different algorithms. NormFinder algorithm recommended RPS27a as the most stable gene.. EF1α was considered as the most suitable gene for qRT-PCR by BestKeeper algorithm. However, V-ATP was evaluated as the ideal gene by geNorm algorithm. Therefore, the selection of reference genes could integrate all the results calculated by different algorithms. That's why we use the algorithm of RefFinder to determine the final results according to the results of all the algorithms.
In summary, nine candidate reference genes in X. quadripes were selected and the expression stabilities of these genes were systematically analyzed by NormFinder, BestKeeper, geNorm and RefFinder. Besides, the optimal number of reference genes was also obtained by geNorm. Taken together, the optimal reference gene combination in different experimental conditions were performed as following: EIF4E, RPL10a and RPS27a for tissue samples, RPL10a and EIF3D for developmental stage samples, V-ATP and EF1α for the sex samples, EIF3D and V-ATP for the samples treated with different temperatures, RPS27a and RPL10a for the samples exposed to different insecticides, RPL10a, RPS27a and EF1α for all the samples. Collectively, these findings may be practically valuable in performing the initial step for qRT-PCR standardization analyses and in functional research of target genes or genomics on molecular mechanisms in X. quadripes.
Acknowledgements
This work was supported by grants from Belt& Road Program, CAST (Grant No. 2020ZZGJB072046) and Central Public-interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (Grant No. 1630142017004).
