Introduction
Dictyocaulus species are lungworms that occur in wild and domestic ungulates across many parts of the world. These lung nematodes cause dictyocaulosis, a parasitic pneumonia and bronchitis (Panuska, Reference Panuska2006; Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017). The number of worms in the lungs affects the severity of the infection. While a small number of worms may cause no noticeable symptoms, a large infestation can be fatal (Panuska, Reference Panuska2006; Cârstolovean et al., Reference Cârstolovean, Taulescu, Hodor, Cotuțiu, Aldea, Șerban, Cazan, Gherman and Mihalca2024). Morphological characteristics alone are insufficient for species-level identification of Dictyocaulus parasites. Prior to 2016, 6 Dictyocaulus species had been described: Dictyocaulus viviparus, Dictyocaulus filaria, Dictyocaulus arnfieldi, Dictyocaulus cameli, Dictyocaulus eckerti and Dictyocaulus capreolus. Since 2017, 2 additional species, Dictyocaulus cervi and Dictyocaulus skrjabini, have been described using combined morphological and molecular identification methods (Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017, Reference Pyziel, Laskowski, Klich, Demiaszkiewicz, Kaczor, Merta, Kobielski, Nowakowska, Anusz and Höglund2023). Accurate identification of Dictyocaulus species is essential not only for clarifying their taxonomy but also for understanding host specificity, geographical distribution, potential cross-transmission among different host species (e.g. between cervids and bovines), and implementing effective control strategies for dictyocaulosis (Gasser et al., Reference Gasser, Jabbar, Mohandas, Höglund, Hall, Littlewood and Jex2012).
In Lithuania, 4 species of native wild ungulates are free-ranging: moose (Alces alces), roe deer (Capreolus capreolus), red deer (Cervus elaphus) and European bison (Bison bonasus). As the populations of these animals grow and increasingly share grazing areas with domestic ruminants, they may act as reservoirs of Dictyocaulus lungworms and facilitate parasite transmission between wildlife and livestock (Cafiso et al., Reference Cafiso, Castelli, Tedesco, Poglayen, Pederzoli, Robetto, Orusa, Corlatti, Bazzocchi and Luzzago2023; González-velo et al., Reference González-Velo, Espinosa-Sánchez, Ripa, Hurtado-Preciado, Martínez-Estéllez, Fernández-García and Bazo-Pérez2025). In Europe, several Dictyocaulus species have been reported in wild and domestic ruminants, including D. cervi, which is commonly associated with cervids, and D. viviparus, which primarily infects cattle but has been detected in wildlife (Ploeger, Reference Ploeger2002; Höglund et al., Reference Höglund, Morrison, Mattsson and Engström2006; González-velo et al., Reference González-Velo, Espinosa-Sánchez, Ripa, Hurtado-Preciado, Martínez-Estéllez, Fernández-García and Bazo-Pérez2025). However, the distribution and host range of these species may vary geographically, and their occurrence in wild ungulates is still insufficiently characterized in many regions.
Available data on Dictyocaulus spp. in Lithuania remain scarce, and to date no comprehensive studies have investigated their diversity and distribution. Early studies on the helminth fauna of roe deer in Lithuania reported a low prevalence of Dictyocaulus species; however, species-level identification remains uncertain and no detailed information on their geographical distribution was provided (Kazlauskas and Pužauskas, Reference Kazlauskas and Pužauskas1974). Therefore, the diversity, host associations and distribution of these parasites in Lithuanian wildlife are still poorly understood, and their molecular characterization has not been sufficiently investigated. The aim of this study was to determine the distribution and species composition of Dictyocaulus parasites infecting different wild ungulate hosts using genetic markers for species-level identification.
Materials and methods
Sample collection and morphological identification
Between 2021 and 2024, lower respiratory tracts (trachea and lungs) were collected from a total of 41 red deer, 33 roe deer, 14 moose and 41 European bison in Lithuania. Red deer were legally hunted in 4 municipalities: Akmenė (n = 1), Jurbarkas (n = 1), Raseiniai (n = 3) and Kėdainiai (n = 36); roe deer in 2 municipalities: Jurbarkas (n = 5) and Kėdainiai (n = 28); and moose in 1 municipality: Kėdainiai (n = 14). In accordance with the European bison protection plan, sampling was conducted with permission from the Environmental Protection Department under the Ministry of Environment of the Republic of Lithuania. Samples were obtained only from individuals that had died naturally, were killed in road traffic accidents, or were removed from the population for health-related reasons as part of an approved management plan. These samples were collected in 2 municipalities: Kėdainiai (n = 28) and Varėna (n = 3) (Supplementary Fig. 1).
Tracheas, bronchi and bronchioles were examined for the presence of nematodes by dissecting and flushing. The fluid was collected and sediment was examined under an SMZ-171-BLED stereomicroscope (Motic, Hong Kong). The adult nematodes were isolated, briefly washed in water solution for any host debris removal, and stored in 70 % ethanol at +4 °C for further morphological and molecular investigation. Primary identification of nematode species was done by morphological criteria (Divina et al., Reference Divina, Wilhelmsson, Mattsson, Waller and Höglund2000; Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017, Reference Pyziel, Laskowski, Klich, Demiaszkiewicz, Kaczor, Merta, Kobielski, Nowakowska, Anusz and Höglund2023; Jurankova et al., Reference Jurankova, Jirsova, Pafco and Forejtek2019). The species representing the figures were taken and processed by coauthors at Daugavpils University using Nikon Eclipse 90i microscope equipped with Nikon DS-5MC camera 5.0 M and NIS-Elements Advanced Research software. Parasitological indices, including parasite prevalence, mean intensity and mean abundance, were calculated according to Bush et al. (Reference Bush, Lafferty, Lotz and Shostak1997).
DNA extraction, polymerase chain reaction and sequencing
Genomic DNA from adult lungworms was extracted using a QIAamp DNA Mini Kit (QIAGEN, Germany), following the manufacturer’s protocol. Molecular identification of lungworm species was performed by conventional polymerase chain reaction (PCR) assays targeting 2 genetic markers: a 658 bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (cox1) and an approximately 1200 bp fragment of the 18S small subunit ribosomal DNA (SSU rDNA) gene (Table 1), as previously described (Folmer et al., Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994; Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017).
PCR target genes and primers used in this study for identification of Dictyocaulus spp
Table 1 Long description
Columns list target gene, primer, oligonucleotide sequences from five prime to three prime, and reference. For target gene, cox1, primer, lco1490 has sequence, five prime ggtcaacaaatcataaagatattgg three prime, with reference, folmer et al., 1994. Under the same target gene, primer, hco2198 has sequence, five prime taaacttcagggtgaccaaaaaatca three prime, with no reference shown in its row. For target gene, ssu rdna, primer, nf50 has sequence, five prime tgaaatgggaacggctcat three prime, with reference, pyziel et al., 2017. Under the same target gene, primer, bnr1 has sequence, five prime acctacagataccttgttacgac three prime, with no reference shown in its row.
PCR amplification of the cox1 gene was carried out in a total volume of 20 μL, containing 4 μL of DNA template, 10 μL of Dreamtaq Green PCR Master Mix (Thermo Fisher Scientific, Vilnius, Lithuania) and 1.7 μL of 10 mM forward and reverse primers (Table 1). The following conditions were used for PCR amplification: an initial denaturation at 94°C for 1 min, followed by 5 cycles of 94°C for 60 s, 45°C for 90 s and 72°C for 90 s, then 35 cycles of 94°C for 60 s, 50°C for 90 s and 72°C for 60 s, with a final extension at 72°C for 5 min (Folmer et al., Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994).
Amplification of the SSU rDNA fragment was also performed in a total volume of 20 μL, consisting of 4 μL of DNA template, 10 μL of Dreamtaq Green PCR Master Mix (Thermo Fisher Scientific, Vilnius, Lithuania) and 2 μL of 10 mM each primer (Table 1). The PCR thermal profile included an initial denaturation at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s, with a final extension at 72°C for 5 min (Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017). For each PCR run, molecular-grade nuclease-free water was used as a negative control.
PCR products of good quality were extracted from the 1.5% agarose gel and purified with a GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Lithuania) according to the manufacturer’s instructions and sequenced (Macrogen, the Netherlands). The obtained sequences were edited, aligned with one other and compared with the gene sequence data available from GenBank, using the MEGA X software package (Kumar et al., Reference Kumar, Stecher, Li, Knyaz and Tamura2018). Phylogenetic trees were constructed using the maximum-likelihood method with the Tamura–Nei model. Bootstrap support was calculated by means of 1000 replicates. A cox1 haplotype network of the Dictyocaulus spp. was generated using the TCS method implemented in PopART v1.7 (Leigh and Bryant, Reference Leigh and Bryant2015).
The obtained cox1 gene sequences for representative samples were deposited in the GenBank database under the following accession numbers: PV176498 – PV176509 for D. skrjabini, PV176479 – PV176497 for D. cervi, PV176475 – PV176478 and PV523589 for D. capreolus and PV444367 – PV444371 for D. viviparus bisontis. The SSU rDNA sequences were also submitted to GenBank and are available under the following accession numbers: PV195231 – PV195242 for D. skrjabini, PV195243 – PV195251 for D. cervi, PV195252 – PV195261 for D. capreolus and PV654200 – PV654203 for D. viviparus bisontis.
Results
Parasitological examination revealed the presence of Dictyocaulus spp. in 78.1% of red deer (32/41), 21.2% of roe deer (7/33), 57.1% of moose (8/14) and 12.2% of European bison (5/41). Infections were detected across all sampling sites, with prevalence varying among host species and locations (Supplement Table 1).
Based on cox1 and SSU rDNA sequences, 4 Dictyocaulus species were identified: D. capreolus, D. cervi, D. skrjabini and D. viviparus subsp. bisontis. Representative individuals of each molecularly confirmed species were photographed for visual documentation (Figures 1–6). Species assignment based on 2 genetic markers yielded identical results, with no discrepancies observed between cox1 and SSU rDNA.
Dictyocaulus cervi. (A) Female anterior end in optical section showing H, head; C.V., cephalic vesicle; E, oesophagus; N.R., nerve ring. (B) Female anterior end in optical section showing B.C., Buccal capsule; B.C.W., Buccal capsule wall. (C) Female middle part in optical section showing PSPH, posterior sphincter; PINF, posterior infundibulum.
Dictyocaulus cervi. (A) Female tail in optical section showing A, anus; PH, phasmids. (B and C) Male genital system in optical section showing GUB, gubernaculum; SPI, spicules.
Dictyocaulus skrjabini. (A) Female anterior end in optical section showing H, head; C.V., cephalic vesicle; E, oesophagus. (B) Female anterior end in optical section showing B.C., Buccal capsule; B.C.W., Buccal capsule wall. (C) Female middle part in optical section showing PSPH, posterior sphincter; PINF, posterior infundibulum.
Dictyocaulus skrjabini. (A and B) Female tail in optical section showing A, anus; PH, phasmids. (C–E) Male genital system in optical section showing SPI, spicules.
Dictyocaulus capreolus. (A) Female anterior end in optical section showing H, head; C.V., cephalic vesicle; E, oesophagus; B.C., Buccal capsule; B.C.W., Buccal capsule wall. (B) Female middle part in optical section showing PSPH, posterior sphincter; PINF, posterior infundibulum.
Dictyocaulus capreolus. (A) Female tail in optical section showing A, anus; PH, phasmids. (B and D) Male genital system in optical section showing SPI, spicules; (C) showing EG, eggs.
Infection parameters varied among host species and Dictyocaulus species (Table 2). The highest prevalence and mean abundance were recorded for D. cervi in red deer (C. elaphus), followed by D. skrjabini, whereas D. capreolus occurred only sporadically in this host. In roe deer (C. capreolus), only D. capreolus was detected. Moose (A. alces) harboured both D. cervi and D. skrjabini, with similar prevalence and mean abundance values. In European bison (B. bonasus), only D. viviparus bisontis was detected.
Infection of ungulates by lungworms in Lithuania
Table 2 Long description
Host species are listed with the number studied, the number infected, Dictyocaulus spp. identified, prevalence with a 95% confidence interval, mean abundance, and infection intensity range. For C. elaphus, N 41 and n 27, D. skrjabini has prevalence 29.3% with 95% confidence interval 17.6 to 44.5, mean abundance 2.73, and intensity 1 to 45; D. capreolus has prevalence 2.4% with 95% confidence interval 0.4 to 12.6, mean abundance 0.27, and intensity 11 to 11. For C. capreolus, N 33 and n 7, D. capreolus has prevalence 21.2% with 95% confidence interval 10.5 to 37.0, mean abundance 0.88, and intensity 1 to 9. For A. alces, N 14 and n 5, D. cervi has prevalence 35.7% with 95% confidence interval 16.3 to 61.2, mean abundance 1.79, and intensity 1 to 10. For A. alces, D. skrjabini has N 6, prevalence 42.9% with 95% confidence interval 21.4 to 67.4, mean abundance 1.71, and intensity 2 to 11. For B. bonasus, N 41 and n 5, D. viviparus bisontis has prevalence 12.2% with 95% confidence interval 5.3 to 25.3, mean abundance 2.51, and intensity 5 to 57.
N, number of hosts studied; n, number of host infected; P (95%CI), prevalence with 95% confidence interval; MA, mean abundance; I min–I max, infection intensity range.
Co-infections with multiple Dictyocaulus species were observed in red deer and moose (Table 3). In red deer, most co-infections involved D. cervi and D. skrjabini, while 1 animal harboured 3 species: D. capreolus, D. cervi and D. skrjabini. In moose, co-infections involved D. cervi and D. skrjabini. No co-infections were recorded in roe deer or European bison.
Dictyocaulus spp. numbers in different hosts, hosts with co-infections
Table 3 Long description
Counts of lungworms are listed by host species and parasite species, split by male and female worms, plus a column for hosts with co-infection per number of infected hosts. For red deer, D. capreolus counts were 4 males and 7 females; D. cervi counts were 321 males and 591 females; D. skrjabini counts were 54 males and 58 females; D. viviparus bisontis was shown as a dash for males and blank for females. Red deer co-infections were 6 of 32 for D. cervi plus D. skrjabini, and 1 of 32 for D. capreolus plus D. cervi plus D. skrjabini with an asterisk marker. For roe deer, D. capreolus counts were 10 males and 19 females, while D. cervi, D. skrjabini, D. viviparus bisontis, and both co-infection columns were shown as dashes. For moose, D. cervi counts were 7 males and 18 females and D. skrjabini counts were 9 males and 15 females, with D. capreolus and D. viviparus bisontis shown as dashes or blanks. Moose co-infection for D. cervi plus D. skrjabini was 4 of 8, and the three species co-infection column was a dash. For European bison, only D. viviparus bisontis had counts, 37 males and 66 females, and all other parasite and co-infection entries were shown as dashes or blanks.
a D.ca, D. capreolus; D.ce, D. cervi; D.sk, D. skrjabini.
The TCS haplotype network based on cox1 sequences was constructed using sequences generated in this study together with reference sequences obtained from GenBank (Supplement Table 2). The analysis revealed 5 clearly separated Dictyocaulus clusters, with no shared haplotypes between taxa (Figure 7). Four of these clusters corresponded to species identified in the analysed samples: D. capreolus, D. cervi, D. skrjabini and D. viviparus bisontis. Dictyocaulus skrjabini formed a distinct, well-supported cluster composed of several closely related haplotypes, primarily detected in moose. Dictyocaulus cervi exhibited the highest haplotype diversity, forming a dense network of interconnected haplotypes largely associated with red deer. Dictyocaulus capreolus also formed a separate cluster characterized by moderate diversity, with haplotypes mainly originating from roe deer. The D. viviparus group consisted of 2 well-defined units: a compact cluster corresponding to D. viviparus bisontis detected in European bison, and a small, clearly separated cluster representing D. viviparus from cattle. No intermediate or transitional haplotypes were observed between D. viviparus bisontis and D. viviparus, supporting their genetic distinctiveness. Several sequences previously identified as D. eckerti clustered within the D. cervi haplotype network. In contrast, a single D. eckerti haplotype originating from New Zealand formed a distinct and well-separated cluster. Reference sequences from Hungary were also grouped within the D. cervi cluster. A separate TCS haplotype network based on SSU rDNA sequences was also constructed (Supplementary Fig. 2, Supplement Table 3). In comparison with the cox1 dataset, the SSU sequences showed markedly lower variability, with only minimal nucleotide differences among most haplotypes. As a result, the SSU-based network provided limited resolution for distinguishing closely related Dictyocaulus taxa. In particular, D. viviparus and D. viviparus bisontis were not clearly separated.
Statistical parsimony phylogenetic network based on 125 Dictyocaulus spp. Cox1 sequences (592 bp) obtained in this study and retrieved from GenBank. Each circle represents a unique haplotype, with circle size proportional to its frequency. Circle colours indicate host species. Hatch marks along connecting lines denote the number of mutational steps, and black dots represent missing (unsampled) intermediate haplotypes.
Figure 7 Long description
The diagram is a statistical parsimony phylogenetic network based on 125 sequences. It features several clusters, each represented by circles of varying sizes, indicating unique haplotypes. The size of each circle is proportional to its frequency and different colors represent different host species. The clusters are labeled as D. capreolus, D. viviparus, D. viviparus bisontis, D. cervi, D. skrjabini and D. eckerti. Hatch marks along the connecting lines denote the number of mutational steps, while black dots represent missing intermediate haplotypes. The D. capreolus cluster is shown in blue, D. viviparus in green, D. viviparus bisontis in yellow, D. cervi in red, D. skrjabini in purple and D. eckerti in grey. Each cluster is visually separated by shaded areas, indicating distinct groups with no shared haplotypes between them.
A total of 101 cox1 sequences and 102 SSU rDNA sequences were obtained and analysed. Phylogenetic analysis of cox1 sequences revealed 4 well-supported clades corresponding to D. capreolus, D. cervi, D. skrjabini and D. viviparus bisontis (Supplementary Fig. 3). A similar clustering pattern was observed in the SSU rDNA phylogenetic tree (Figure 8).
Phylogenetic analysis using the Maximum Likelihood method based on SSU rDNA gene sequences (1355 bp) of Dictyocaulus spp. From ungulate lungworms. Sequences obtained in this study are marked with ●.
Figure 8 Long description
The phylogenetic tree is constructed using the Maximum Likelihood method based on gene sequences of Dictyocaulus species. The tree is oriented vertically, with branches extending from a common ancestor at the bottom. Each branch represents a different sequence, labeled with identifiers and host information. The tree includes sequences from various hosts such as Cervus elaphus, Alces alces and Bos taurus, among others. The tree is divided into several clades, with bootstrap values indicated at the nodes, such as 88, 53 and 85, representing the confidence of the branching. Sequences obtained in this study are marked with a black circle. The tree shows distinct clades for D. skrjabini, D. viviparus bisontis and D. cervi, with sequences from different geographical locations like Lithuania, Poland and Sweden. The scale bar at the bottom represents genetic distance.
Analysis of cox1 sequences identified 130 variable positions. The highest genetic diversity was observed in D. cervi, which exhibited 12 haplotypes, whereas D. skrjabini, D. capreolus and D. viviparus bisontis showed 9, 3 and 3 haplotypes, respectively.
The SSU rDNA sequences showed lower variability, with 22 variable positions. Correspondingly, lower haplotype diversity was observed, with a single haplotype detected for D. cervi and D. viviparus bisontis and 2 and 3 haplotypes for D. skrjabini and D. capreolus, respectively.
Comparison of the phylogenetic trees derived from the mitochondrial cox1 and nuclear SSU rDNA revealed differences in the topology of Dictyocaulus species. In the cox1-based tree, D. viviparus and D. capreolus were placed as neighbouring clades, whereas D. skrjabini and D. cervi formed separate species-level clades. In contrast, the SSU rDNA tree showed a different arrangement, in which D. skrjabini was placed closest to D. viviparus, while D. capreolus and D. cervi formed separate lineages.
Discussion
This study presents the first report of Dictyocaulus spp. infection in free-ranging wild ungulates from Lithuania. Molecular analysis confirmed the presence of 4 species: D. skrjabini, D. capreolus, D. cervi and D. viviparus bisontis. The prevalence of Dictyocaulus infections varied among host species and according to the nematode species identified. Mixed infection patterns were uncovered, with single Dictyocaulus species found in roe deer and European bison and co-infections in red deer and moose. The highest parasite diversity and the greatest degree of aggregation were observed in red deer, highlighting their potential role as a key host in the maintenance and transmission of Dictyocaulus spp. in the study area.
Dictyocaulus skrjabini is a recently described nematode species. It was first identified in red deer in Poland and subsequently reported in both fallow deer (Dama dama) and red deer in Sweden (Pyziel et al., Reference Pyziel, Laskowski, Klich, Demiaszkiewicz, Kaczor, Merta, Kobielski, Nowakowska, Anusz and Höglund2023). The species has also been recorded in fallow deer in Australia (Brown et al., Reference Brown, Jenkins, Gofton, Smith, Francis, Shamsi and Barton2024) and in red deer in Hungary, where it was previously identified as Dictyocaulus sp. (Ács et al., Reference Ács, Hayward and Sugár2016). In the present study, D. skrjabini was detected in both red deer and moose. Based on the available scientific literature, this represents the first confirmed record of this species in moose. Its occurrence in multiple cervid hosts suggests a broader host range than initially assumed, particularly in regions where host species coexist. The confirmation of D. skrjabini in Lithuanian red deer further supports its widespread distribution across Europe.
Dictyocaulus capreolus is a lungworm species originally described in roe deer and moose in Sweden (Gibbons and Höglund, Reference Gibbons and Höglund2002). Since then, it has been widely reported in roe deer populations across Europe, including Spain, Ukraine, Turkey, Hungary, Poland, the Czech Republic and Germany (Carreno et al., Reference Carreno, Diez-baños, Hidalgo-Argüello Mdel and Nadler2009; Kuzmina et al., Reference Kuzmina, Kharchenko and Malega2010; Bolukbas et al., Reference Bolukbas, Gurler, Beyhan, Acici and Umur2012; Ács et al., Reference Ács, Hayward and Sugár2016; Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017; Jurankova et al., Reference Jurankova, Jirsova, Pafco and Forejtek2019; Wild et al., Reference Wild, Ehrmantraut, Dahl, Langer, Kiess, Simon, Meissner and König2025). In the present study, D. capreolus was detected predominantly in roe deer, but also occurred in red deer. Previous studies have also documented this species in other hosts, including moose in Sweden (Divina et al., Reference Divina, Wilhelmsson, Mörner, Mattsson and Höglund2002), chamois (Rupicapra rupicapra) in Spain (Carreno et al., Reference Carreno, Diez-baños, Hidalgo-Argüello Mdel and Nadler2009) and red deer in Hungary (Ács et al., Reference Ács, Hayward and Sugár2016). Although D. capreolus is generally considered to be closely associated with roe deer, these findings support the view that the species is capable of infecting a broader range of ungulate hosts, particularly in areas where different host species occur sympatrically (Pyziel et al., Reference Pyziel, Laskowski, Klich, Demiaszkiewicz, Kaczor, Merta, Kobielski, Nowakowska, Anusz and Höglund2023). Nevertheless, its predominance in roe deer in the present study is consistent with a high degree of host specificity.
Dictyocaulus cervi was first described in red deer population in Poland (Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017). Subsequent studies have reported this species in moose in Poland (Filip-Hutsch et al., Reference Filip-Hutsch, Demiaszkiewicz, Chęcińska, Hutsch, Czopowicz and Pyziel2020), in fallow deer in Australia (Brown et al., Reference Brown, Jenkins, Gofton, Smith, Francis, Shamsi and Barton2024) and again in red deer in Spain (González-Velo et al., Reference González-Velo, Espinosa-Sánchez, Ripa, Hurtado-Preciado, Martínez-Estéllez, Fernández-García and Bazo-Pérez2025). In addition, D. cervi-like lungworms have been identified in rocky mountain elk (Cervus canadensis nelsoni) in the USA (Bangoura et al., Reference Bangoura, Brinegar and Creekmore2021). Prior to its formal description, D. cervi was frequently misidentified as D. eckerti in cervid hosts, reflecting the morphological similarity between these taxa and the limitations of traditional identification methods (Ács et al., Reference Ács, Hayward and Sugár2016). In the present study, D. cervi was confirmed in both red deer and moose in Lithuania, consistent with previous observations. Notably, this species was the dominant lungworm in red deer, accounting for the majority of recovered specimens. Its high prevalence and abundance suggest that D. cervi plays a central role in shaping lungworm infection dynamics in cervid populations in Lithuania. The occurrence of this species in multiple host taxa further indicates a relatively broad host range compared with other Dictyocaulus species.
Dictyocaulus viviparus is the most widely distributed lungworm species infecting domestic and wild bovids (Ploeger, Reference Ploeger2002). A distinct subspecies, D. viviparus bisontis, was originally described in the European bison population in Poland based on morphological characteristics, molecular analysis and host specificity (Pyziel et al., Reference Pyziel, Laskowski, Dolka, Kołodziej-sobocińska, Nowakowska, Klich, Bielecki, Żygowska, Moazzami, Anusz and Höglund2020). In the present study, this taxon was confirmed in European bison in Lithuania, further supporting its occurrence in free-ranging bison populations in Northern Europe. Notably, despite the relatively low prevalence observed in this host species, infected individuals harboured comparatively high parasite burdens. This pattern may reflect limited exposure but increased susceptibility, potentially associated with host population structure or restricted gene flow. The apparent host specificity of this taxon also suggests a well-adapted parasite–host relationship within European bison populations (Pyziel et al., Reference Pyziel, Laskowski, Dolka, Kołodziej-sobocińska, Nowakowska, Klich, Bielecki, Żygowska, Moazzami, Anusz and Höglund2020). A comparable host-associated pattern has been reported in North American bison (Bison bison), which harbour a genetically distinct and currently undescribed Dictyocaulus species. This taxon differs from both cattle-associated D. viviparus and D. viviparus bisontis described in European bison, suggesting independent parasite–host associations within the 2 bison species (Danks et al., Reference Danks, Sobotyk, Saleh, Kulpa, Luksovsky, Jones and Verocai2022).
In this study, co-infections involving Dictyocaulus spp. were observed in both moose and red deer, with mixed infections of D. skrjabini and D. cervi occurring in both host species, and occasional involvement of D. capreolus in red deer. Previous studies have reported co-infections of D. cervi with protostrongylid lung nematodes in moose, which were associated with more severe parasitic bronchitis and pulmonary pathology (Filip-Hutsch et al., Reference Filip-Hutsch, Demiaszkiewicz, Chęcińska, Hutsch, Czopowicz and Pyziel2020). Experimental cross-transmission studies have further demonstrated that both red deer and cattle can be infected with D. viviparus and D. eckerti (Johnson et al., Reference Johnson, Mackintosh, Labes, Taylor and Wharton2003), although host-specific differences in establishment success were observed. In particular, D. eckerti appears to infect cervids more successfully, whereas D. viviparus establishes more efficiently in cattle. Together, these findings suggest that co-infections and cross-species transmission may play an important role in shaping lungworm community structure in wild ungulates, particularly in ecosystems where multiple host species coexist.
In the present study, mitochondrial (cox1) and nuclear (SSU rDNA) markers reliably resolved all 4 Dictyocaulus species, providing strong molecular support for their distinct taxonomic status. Given the close morphological similarity among Dictyocaulus species, morphology alone is insufficient for accurate species identification, highlighting the necessity of molecular confirmation. Sequences of both markers clearly differentiated D. skrjabini, D. capreolus, D. cervi and D. viviparus bisontis, with no evidence of overlapping or intermediate genotypes among taxa. These findings are consistent with previous studies demonstrating that molecular markers enable reliable discrimination of closely related Dictyocaulus species (Divina et al., Reference Divina, Wilhelmsson, Mattsson, Waller and Höglund2000, Reference Divina, Wilhelmsson, Mörner, Mattsson and Höglund2002; Höglund et al., Reference Höglund, Morrison, Divina, Wilhelmsson and Mattsson2003; Ács et al., Reference Ács, Hayward and Sugár2016; Pyziel et al., Reference Pyziel, Laskowski, Demiaszkiewicz and Höglund2017, Reference Pyziel, Laskowski, Klich, Demiaszkiewicz, Kaczor, Merta, Kobielski, Nowakowska, Anusz and Höglund2023; Cafiso et al., Reference Cafiso, Castelli, Tedesco, Poglayen, Pederzoli, Robetto, Orusa, Corlatti, Bazzocchi and Luzzago2023), and confirm the value of these markers as essential tools for accurate species identification in epidemiological studies.
Although both cox1 and SSU rDNA enabled molecular identification of the analysed Dictyocaulus species, the 2 markers differed in their ability to resolve phylogenetic relationships among taxa. The mitochondrial cox1 marker showed greater sequence variability and provided a more resolved phylogenetic structure, whereas SSU rDNA was considerably more conserved. Consequently, some internal relationships in the SSU rDNA tree received low bootstrap support, particularly the grouping of D. viviparus and D. skrjabini, which was supported by a bootstrap value of only 53%. However, this value should be interpreted in the context of the limited variability of the SSU rDNA marker. The low bootstrap support does not necessarily indicate weak molecular differentiation between these species but rather may reflect the small number of phylogenetically informative sites available in the SSU rDNA dataset. Thus, while SSU rDNA allows these species to be distinguished at the molecular level, it provides limited resolution for inferring their relative evolutionary proximity. Therefore, the observed topological differences between the mitochondrial and nuclear phylogenies are more likely to reflect differences in marker variability and phylogenetic signal than genuine discordance between mitochondrial and nuclear evolutionary histories. Further studies incorporating multiple independent mitochondrial and nuclear loci, analysed both separately and in concatenated datasets, would provide a more robust framework for resolving evolutionary relationships within Dictyocaulus, as demonstrated in multilocus studies of other nematode taxa (Lefoulon et al., Reference Lefoulon, Giannelli, Makepeace, Mutafchiev, Townson, Uni, Verocai, Otranto and Martin2017; Kulpa et al., Reference Kulpa, Lefoulon, Beckmen, Allen, Malmberg, Crouse, Thompson, Benedict, Goldsmith, McCarthy, Jones, Yabsley, Crum, Kutz and Verocai2025).
Furthermore, the interpretation of GenBank sequences labelled as D. eckerti requires caution. Some of these sequences were deposited before the recent taxonomic revision of the genus, and therefore their original species assignment may not fully correspond to the present taxonomy. Consequently, sequences annotated as D. eckerti were not considered definitive evidence of a separate D. eckerti lineage in the present analysis. This highlights the importance of critically evaluating public database annotations when interpreting phylogenetic relationships.
Phylogenetic analyses based on cox1 and SSU rDNA revealed complex evolutionary relationships among the examined Dictyocaulus species. Discrepancies between mitochondrial and nuclear markers have also been reported in other animal groups (Li et al., Reference Li, Davis, Eizirik and Murphy2016; Kumar et al., Reference Kumar, Lammers, Bidon, Pfenninger, Kolter, Nilsson and Janke2017), and are often attributed to processes such as hybridization, introgression or incomplete lineage sorting. In the present study, co-infections with multiple Dictyocaulus species within the same host were relatively common, potentially creating opportunities for such processes to occur. Although direct evidence for hybridization or gene flow was not observed, the detected phylogenetic patterns may be consistent with these mechanisms. Further studies, including population-level genetic analyses, are required to clarify the evolutionary relationships and potential genetic exchange among Dictyocaulus species.
The true prevalence of Dictyocaulus infections is likely underestimated, as assessments often rely solely on the detection of adult nematodes in the bronchi and bronchioles. This limitation underscores the need for the integration of molecular diagnostic approaches and more systematic surveillance across host species and geographic regions. Further studies are required to clarify the epidemiology, clinical significance and ecological interactions associated with co-infections involving different Dictyocaulus species, particularly in wildlife populations where multiple taxa may circulate simultaneously.
Conclusions
This study provides the first comprehensive report of Dictyocaulus spp. infections in free-ranging wild ruminants in Lithuania, combining morphological and molecular approaches. Four species (D. skrjabini, D. capreolus, D. cervi and D. viviparus bisontis) were identified, revealing clear differences in prevalence, host specificity and infection patterns among host species. Red deer were identified as the principal host, exhibiting the highest prevalence, parasite diversity and mean abundance, whereas European bison showed low prevalence but relatively high infection intensity. The detection of co-infections and the occurrence of multiple Dictyocaulus species within the same host highlight the complexity of lungworm transmission dynamics in wildlife. The application of molecular markers proved essential for accurate species identification, particularly given the morphological similarity among taxa. These findings contribute to a better understanding of the epidemiology and host–parasite relationships of Dictyocaulus spp. and emphasize the need for integrated surveillance approaches in wildlife populations.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0031182026102704.
Author contributions
All authors contributed to the writing, editing and conceptualization of this manuscript.
Financial support
This research was partially supported by the Research Fund of Vytautas Magnus University (Kaunas, Lithuania) through project No. P-N-24-01.
Competing interests
The authors declare that there are no conflicts of interest.
Ethical standards
Not applicable.
Open access
