Introduction
Among the trematodes that infect marine mammals as the definitive hosts, the family Brachycladiidae is a remarkable example of successful colonisation. This is the most species-rich trematode taxon restricted to marine mammals (Lehnert and Hernández-Orts Reference Lehnert, Hernández-Orts, Smit and Sures2025). A broad range of their definitive hosts includes cetaceans, pinnipeds, and the sea otter (Fraija-Fernández et al. Reference Fraija-Fernández, Aznar, Fernández, Raga and Fernández2016). The brachycladiids inhabit various organs of marine mammals, commonly the biliary system, but also the intestine, lungs, nasal sinuses, and brain (Lehnert and Hernández-Orts Reference Lehnert, Hernández-Orts, Smit and Sures2025). The associated pathogenic load varies, spanning from lesions of the liver and bile ducts to parasitic pneumonia and meningoencephalitis (Andersen-Ranberg et al. Reference Andersen-Ranberg, Lehnert, Leifsson, Dietz, Andersen, Siebert, Measures and Sonne2018; de Amorim et al. Reference de Amorim, Piva, Ribeiro, Perosa, Gris, Perin, Nunes, Cony, Hoppe, Soares and Sonne2024; Díaz-Delgado et al. Reference Díaz-Delgado, Fernández, Sierra, Sacchini, Andrada, Vela, Quesada-Canales, Paz, Zucca, Groch and Arbelo2018; Estarrona et al. Reference Estarrona, Peñín, Lekube, Valenciano, Díaz de Cerio, Soto, Izagirre and Benito2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Lehnert et al. Reference Lehnert, Raga and Siebert2005, Reference Lehnert, Seibel, Hasselmeier, Wohlsein, Iversen, Nielsen, Heide-Jørgensen, Prenger-Berninghoff and Siebert2014; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020; Nakagun et al. Reference Nakagun, Shiozaki, Ochiai, Matsuda, Tajima, Matsuishi, Watanabe, Horiuchi and Kobayashi2018). Although the Brachycladiidae may directly affect the health and survival of marine mammals, their biology remains rather poorly studied. The systematics of the family is confused, as diagnostic morphological characters are often poor and highly susceptible to decomposition (Adams and Rausch Reference Adams and Rausch1989; Gibson and Bray Reference Gibson and Bray1997). Genetic data for the brachycladiids are also scarce and, beyond a few exceptions (Briscoe et al. Reference Briscoe, Bray, Brabec and Littlewood2016), limited to three main markers: 18S and 28S rDNA and nad3 mtDNA (Fraija-Fernández et al. Reference Fraija-Fernández, Olson, Crespo, Raga, Aznar and Fernández2015, Reference Fraija-Fernández, Aznar, Fernández, Raga and Fernández2016; Marigo et al. Reference Marigo, Thompson, Santos and Iñiguez2011). It is not surprising, thus, that intra- and interspecies boundaries remain indistinct for the Brachycladiidae (Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025).
Another major gap is the circulation pathways of the brachycladiids, as no data on their intermediate hosts were available until very recently (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020, Reference Kremnev, Krapivin and Krupenko2025). A moonsnail from the family Naticidae, Cryptonatica affinis (Gmelin, 1791), was identified as the first intermediate host for two brachycladiid species in the White Sea (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). Free-swimming cercariae of the Brachycladiidae have a simple tail and can bear a pair of pigmented eyespots. Similar cercariae, also from C. affinis, were described in the adjacent Barents Sea by Chubrik (Reference Chubrik1966). Previously, we predicted that these life-cycle stages may belong to a third, as-yet-unidentified brachycladiid species (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020).
Campula oblonga Cobbold, Reference Cobbold1858, a common brachycladiid species in the North-East Atlantic with an unknown life cycle (Gibson and Bray Reference Gibson and Bray1997; Gibson et al. Reference Gibson, Harris, Bray, Jepson, Kuiken, Baker and Simpson1998), is a plausible candidate to match the intramolluscan stages described by Chubrik (Reference Chubrik1966). This parasite infects small odontocetes, mostly porpoises, in the cold-temperate waters of the Northern Hemisphere (Adams et al. Reference Adams, Hoberg, McAlpine and Clayden1998; Cobbold Reference Cobbold1858; Gibson et al. Reference Gibson, Harris, Bray, Jepson, Kuiken, Baker and Simpson1998; Kuramochi et al. Reference Kuramochi, Kikuchi, Okamura, Tatsukawa, Doi, Nakamura, Yamada, Koda, Yoshida, Matsuura and Sakakibara2000; Price Reference Price1932; Yamaguti Reference Yamaguti1951). Maritae (sexual adults) of C. oblonga occupy the bile and pancreatic ducts of their cetacean hosts, causing various lesions. In the North Atlantic harbour porpoise Phocoena phocoena (Linnaeus, 1758), they range from mild, diffuse chronic inflammation in most infections (Lehnert et al. Reference Lehnert, Seibel, Hasselmeier, Wohlsein, Iversen, Nielsen, Heide-Jørgensen, Prenger-Berninghoff and Siebert2014; Ryeng et al. Reference Ryeng, Lakemeyer, Roller, Wohlsein and Siebert2022; Siebert et al. Reference Siebert, Wünschmann, Weiss, Frank, Benke and Frese2001, Reference Siebert, Tolley, Vikingsson, Olafsdottir, Lehnert, Weiss and Baumgärtner2006) to severe fibrosis and, in extreme cases, biliary cirrhosis (Jaber et al. Reference Jaber, Pérez, Rotstein, Zafra, Herráez, Carrascosa and Fernandez2013). Broadly comparable lesions were reported for the North Pacific porpoises as well, including harbour porpoise, Dall’s porpoise Phocoenoides dalli (True, 1885), and narrow-ridged finless porpoise Neophocaena asiaeorientalis Pilleri & Gihr, 1972 (Conlogue et al. Reference Conlogue, Ogden and Foreyt1985; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020). Beyond this shared pathological picture, however, maritae of C. oblonga show signs of genetic and morphological heterogeneity across their range, including partially host-restricted lineages among sympatric North Pacific porpoises, pairwise mitochondrial divergence between geographically distant isolates without resolved reciprocal monophyly, and some morphometric differences (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020). This raises the possibility that C. oblonga may obscure several distinct taxa under a single name, yet neither Kim et al. (Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025) nor Buchmann et al. (Reference Buchmann, Jensen, Quaade and Kania2026) reached any definitive taxonomic conclusion.
Here we explored parasites of C. affinis moonsnails from the Barents Sea and found them infected with rediae and ocellate cercariae similar to those described by Chubrik (Reference Chubrik1966). As the generated mitochondrial and nuclear ribosomal sequences showed that the newly discovered life-cycle stages belong to C. oblonga, we analysed the available genetic, morphological, host, and distribution data, following an integrative taxonomic approach (Bray et al. Reference Bray, Cutmore and Cribb2022). Developing the evidence from previously published studies (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020), we propose a taxonomic hypothesis for C. oblonga and argue for the likely presence of three distinct lineages within this complex: C. oblonga, C. folium Ozaki, Reference Ozaki1935, and Campula sp. NWP1 (a putative undescribed species). For C. oblonga, we partially elucidated the life cycle, demonstrating that C. affinis moonsnails act as its first intermediate host.
Materials and methods
Sampling
Moonsnails from the family Naticidae were sampled in 2021–2025 from intertidal and subtidal zones of the Barents Sea (Kola Peninsula: Dalniye Zelentsy, 69°06′N 36°03′E). Gastropods were collected either by sieving sand during low tide or by hand from depths of 2–18 m using scuba diving equipment. To check for cercariae emission, some of the collected moonsnails were kept separately in individual jars containing seawater for several days at 9–10°C. To determine the presence or absence of infection, all the molluscs were removed from their shells and dissected under a stereomicroscope. Altogether, we inspected 353 specimens of moonsnails belonging to three species: Cryptonatica affinis, n = 308; Euspira pallida (Broderip & G. B. Sowerby I, 1829), n = 42; and Pseudopolinices nanus (Møller, 1842), n = 3.
Molecular analysis
The putative life-cycle stages of the brachycladiids were fixed with 96% ethanol for molecular analysis. We used pieces of rediae for DNA extraction, taking one redia from each infected moonsnail specimen, with a total of eight samples (isolates). Before extraction, samples from 96% ethanol were dried completely and incubated in 200 μL of 5% Chelex® 100 resin (Bio-Rad, Hercules, CA, USA) with 0.2 mg/mL proteinase K (Evrogen, Moscow, Russia) at 56°C for 4 h, then heated for 8 min at 90°C to inactivate proteinase K, and next centrifuged for 10 min at ~16,000 g. The supernatant with DNA was transferred into a new tube and stored at −20°C.
We amplified partial cox1 and nad3 mitochondrial genes, fragments of 18S and 28S rDNA, and fragments containing near-complete ITS1, complete 5.8S rDNA, complete ITS2, and the beginning of 28S rDNA with primers and conditions listed in Table 1. The PCR mixture contained 4 μL of ScreenMix-HS (Evrogen), 0.5 μL of each primer (10 pmol μL−1), 2 μL of DNA matrix, and 13 μL of PCR-grade water (Evrogen). PCRs were run on a T100 Thermal Cycler (Bio-Rad, CA, USA). PCR products were stained with ethidium bromide and visualised through electrophoresis on a 1% agarose gel. Sequencing was performed with PCR primers on an AB3500xL genetic analyser (Applied Biosystems, MA, USA). Geneious Prime 2025.2.2 software (https://www.geneious.com) was used to analyse chromatograms and build alignments. The Basic Local Alignment Search Tool (BLAST) was used to find similar sequences. The relevant data were obtained for comparison from GenBank. Annotated sequences of the ribosomal operon (KR703279) and mitochondrial genome (KR703278) of Brachycladium goliath (van Beneden, 1858) Fraija-Fernández, Aznar, Raga, Gibson & Fernández, 2014 (Briscoe et al. Reference Briscoe, Bray, Brabec and Littlewood2016) were used to map our sequences.
Primers and PCR temperature profiles used in this study
Table 1. Long description
The table contains six columns and six main fragment rows.
1. Fragment 18S r D N A: Includes four primers. Forward primer 18S1A (GGCGATCGAAAAGATTAAGCCATGCA) and Reverse primer 32 (CGAAGTCCTATTCCATTATTC); Forward primer 652 (GCAGCCGCGGTAATTCCAGCTC) and Reverse primer 28 (AGCGACGGGCGGTGTGT). Reference: Hernández-Mena et al. 2017. Profile: 95 degrees Celsius for 5 minutes; 35 cycles of 94 degrees Celsius for 1 minute, 52 degrees Celsius for 1 minute, 72 degrees Celsius for 1 minute; final extension 72 degrees Celsius for 10 minutes.
2. Fragment I T S 1: Forward primer B D 1 (GTCGTAACAAGGTTTCCGTA) and Reverse primer 4S (TCTAGATGCGTTCGAARTGTCGATG). Reference: Luton et al. 1992. Profile: 95 degrees Celsius for 5 minutes; 35 cycles of 95 degrees Celsius for 30 seconds, 55 degrees Celsius for 30 seconds, 72 degrees Celsius for 1 minute; final extension 72 degrees Celsius for 10 minutes.
3. Fragment 5.8S r D N A plus I T S 2: Forward primer 3S (GGTACCGGTGGATCACGTGGCTAGTG) referenced by Morgan and Blair Reference Morgan and Blair1995; Reverse primer I T S 2.2 (CCTGGTTAGTTTCTTTTCCTCCGC) referenced by Cribb et al. Reference Cribb, Anderson, Adlard and Bray1998. Profile: 95 degrees Celsius for 5 minutes; 40 cycles of 94 degrees Celsius for 30 seconds, 55 degrees Celsius for 30 seconds, 72 degrees Celsius for 1 minute; final extension 72 degrees Celsius for 10 minutes.
4. Fragment 28S r D N A: Forward primer digl2 (AAGCATATCACTAAGCGG) referenced by Tkach et al. 1999; Reverse primer 1500R (GCTATCCTGAGGGAAACTTCG) referenced by Olson et al. 2003. Profile: 95 degrees Celsius for 3 minutes; 40 cycles of 95 degrees Celsius for 30 seconds, 54 degrees Celsius for 30 seconds, 72 degrees Celsius for 2 minutes; final extension 72 degrees Celsius for 10 minutes.
5. Fragment cox1 gene: Forward primer J B 3 (TTTTTTGGGCATCCTGAGGTTTAT) referenced by Bowles et al. 1993; Reverse primer C O I R-Trema (CAACAAATCATGATGCAAAAGG) referenced by Miura et al. 2005. Profile: 95 degrees Celsius for 5 minutes; 35 cycles of 95 degrees Celsius for 30 seconds, 50 degrees Celsius for 30 seconds, 72 degrees Celsius for 1 minute; final extension 72 degrees Celsius for 10 minutes.
6. Fragment nad3 gene: Forward primer N D 3F (GCTTAATTKKTAAAGCYTTGRATTCTTACT) and Reverse primer N D 3R (CTACTAGTCCCACTCAACRTAACCYT). Reference: Fraija-Fernández et al. 2016. Profile: 95 degrees Celsius for 5 minutes; 35 cycles of 95 degrees Celsius for 30 seconds, 50 degrees Celsius for 30 seconds, 72 degrees Celsius for 50 seconds; final extension 72 degrees Celsius for 7 minutes.
Pairwise genetic distances were calculated in MEGA 11 (Tamura et al. Reference Tamura, Stecher and Kumar2021) using the maximum composite likelihood method. Haplotype networks were constructed in PopART 1.7 (Leigh and Bryant Reference Leigh and Bryant2015) using the TCS network algorithm (Clement et al. Reference Clement, Snell, Walke, Posada and Crandall2002). Species delimitation was conducted based on the nad3 gene fragments, with a barcode gap approach implemented in Assemble Species by Automatic Partitioning (ASAP) software (Puillandre et al. Reference Puillandre, Brouillet and Achaz2021).
Phylogenetic analysis was run using the nad3 mtDNA datasets. The list of involved GenBank sequences is provided in Table 2. The selected outgroup was Tormopsolus orientalis Yamaguti, 1934 (KT180219; Fraija-Fernández et al. Reference Fraija-Fernández, Aznar, Fernández, Raga and Fernández2016), a representative of the closest relative of the brachycladiids, the Acanthocolpidae clade A (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). The substitution model selected by smart model selection as implemented in PhyML 3.0 (Lefort et al. Reference Lefort, Longueville and Gascuel2017) for the maximum likelihood (ML) analysis was HKY+G. The substitution model selected by bModelTest (Bouckaert and Drummond Reference Bouckaert and Drummond2017) for the Bayesian inference (BI) analysis was TN93+G+I. The BI analysis was conducted using Markov chain Monte Carlo (MCMC) analysis available in Bayesian Evolutionary Analysis by Sampling Trees (BEAST2) v2.7.7 (Bouckaert et al. Reference Bouckaert, Vaughan, Barido-Sottani, Duchêne, Fourment, Gavryushkina, Heled, Jones, Kühnert, De Maio, Matschiner, Mendes, Müller, Ogilvie, Du Plessis, Popinga, Rambaut, Rasmussen, Siveroni, Suchard, Wu, Xie, Zhang, Stadler and Drummond2019) on XSEDE at the CIPRES Science Gateway (https://www.phylo.org). Three independent runs of MCMC were performed, each with 10,000,000 generations and sampling every 1,000 generations. The trace files were checked for convergence with Tracer v1.7.2 (Rambaut et al. Reference Rambaut, Drummond, Xie, Baele and Suchard2018). The log files were combined using LogCombiner, discarding the first 10% as burn-in. Trees were summarised with TreeAnnotator using the maximum clade credibility tree option and with node heights as mean heights. The ML analysis was run using the web version (http://www.atgc-montpellier.fr/phyml/) of PhyML 3.0 software (Guindon et al. Reference Guindon, Dufayard, Lefort, Anisimova, Hordijk and Gascuel2010) with transfer bootstrap analysis (Lemoine et al. Reference Lemoine, Domelevo Entfellner, Wilkinson, Correia, Dávila Felipe, De Oliveira and Gascuel2018) and 1,000 replicates. The robustness of the tree was additionally assessed using the add random starting tree option (n = 10).
The sequences used for the phylogenetic analysis. The putative species identification for the genus Campula is provided based on the information presented in the Results section
Table 2. Long description
The table consists of six columns: Species, Stage, Host species, Region, GenBank accession numbers for n a d 3, and References. It is divided into two main taxonomic sections.
Section 1: Brachycladiidae
- Brachycladiidae gen. sp. 1 W S: redia with cercariae stage, host Cryptonatica affinis, White Sea, M T 1 5 3 5 8 9.
- Brachycladium atlanticum: marita stage, host Stenella coeruleoalba, Spain, K T 1 8 0 2 1 7.
- Brachycladium nipponicum: marita stage, host Grampus griseus, Japan, L C 5 4 1 9 0 6.
- Campula oblonga: Four entries for redia with cercariae stage in host C. affinis from the Barents Sea with accession numbers P Z 5 3 3 9 4 0, P Z 5 3 3 9 4 1, P Z 5 3 3 9 4 2, and P Z 5 3 3 9 4 5. Six entries for marita stage in hosts Phocoena phocoena or Phocoenoides dalli across Baltic Sea, North Sea, and Japan, with accession numbers A F 0 3 4 5 5 4, P X 7 0 5 4 1 1, L C 5 3 2 1 4 4, L C 5 3 2 1 4 5, L C 5 3 2 1 4 6, and L C 5 3 2 1 4 7.
- Campula sp. N W P 1: Four marita stage entries, host P. phocoena, Japan, L C 5 3 2 1 4 8 through L C 5 3 2 1 5 1.
- Campula sp. N W P 2: Two marita stage entries, host Neophocaena asiaeorientalis, Yellow Sea, M Z 2 6 9 0 6 4 and M Z 2 6 9 0 6 5.
- Nasitrema spathulatum and Nasitrema sunameri: marita stage, host N. asiaeorientalis, South Korea, both M Z 2 6 9 0 6 6.
- Orthosplanchnus arcticus: metacercaria stage, host Serripes groenlandicus, White Sea, M T 1 5 3 5 8 7.
- Oschmarinella macrorchis: marita stage, host Mesoplodon carlhubbsi, Japan, L C 3 2 6 0 6 4.
- Oschmarinella rochebruni: marita stage, host S. coeruleoalba, Spain, K T 1 8 0 2 1 5.
- Synthesium pontoporiae: marita stage, host Pontoporia blainvillei, Brazil, J X 6 4 4 1 0 7.
- Synthesium tursionis: marita stage, host Sotalia guianensis, Brazil, M N 2 6 4 2 9 9.
Section 2: Acanthocolpidae clade A (outgroup)
- Tormopsolus orientalis: marita stage, host Seriola dumerili, Spain, K T 1 8 0 2 1 9.
Morphology
Cercariae morphology was studied using a combination of approaches, including temporary mounts of live specimens, stained whole mounts, histological sections, and confocal laser scanning microscopy (CLSM). Morphology of rediae was studied on whole mounts.
For whole mounts, rediae and cercariae were fixed in a hot saturated solution of mercury(II) chloride with acetic acid (100:1) and stained with toluidine blue. Stained samples were dehydrated in a graded ethanol series, clarified in xylol, and mounted in Canada balsam. Whole mounts of isogenophores were deposited in the Helminths collection of the Zoological Institute of the Russian Academy of Sciences (ZISP), section Trematoda (non-type material) under accession numbers 2026.06.14.001 (isolate D12.12), 2026.06.14.002 (isolate G11.9), and 2026.06.14.003 (isolate G15.2).
Pieces of infected molluscs were fixed in Zenker’s solution with 40% formaldehyde (10:1) to make histological sections. After a two-hour fixation and a two-hour wash in tap water, the specimens were incubated in 70% ethanol with iodine for one hour. Next, they were transferred to 70% ethanol, dehydrated through a graded ethanol series, and embedded in Paraplast medium (Leica Microsystems, Wetzlar, Germany). Sections were cut at 5 μm and stained either with Ehrlich’s H&E or Azur II-eosin.
Temporary mounts were examined under a Leica DM500 optical microscope, and whole mounts and sections were viewed under a Leica DM2500 optical microscope (Leica Microsystems) using bright-field or differential interference contrast (DIC) optics. Photographs were taken using a Nikon DS-Fi3 (Nikon, Tokyo, Japan). Measurements were made using Fiji software (Schindelin et al. Reference Schindelin, Arganda-Carreras, Frise, Kaynig, Longair, Pietzsch, Preibisch, Rueden, Saalfeld, Schmid, Tinevez, White, Hartenstein, Eliceiri, Tomancak and Cardona2012). All measurements are in micrometres. In morphological descriptions, ranges of values are shown in parentheses after means.
To visualise the muscular, nervous, and protonephridial systems of cercariae, we utilised CLSM. Specimens were fixed in 4% paraformaldehyde in 0.01 M phosphate-buffered saline, stained with antibodies against acetylated α-tubulin and phosphotyrosine (phospho Y), tetramethylrhodamine B isothiocyanate (TRITC)-labelled phalloidin, and DAPI. All the protocols were the same as previously described (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). Stained mounts were examined under a CLSM Leica TCS SPE or a CLSM Leica TCS SP5 (Leica Microsystems). Fiji software was used to process the generated data.
Results
General observations
Among 308 dissected Cryptonatica affinis, eight specimens were infected by rediae and cercariae with a simple tail and a pair of pigmented eyespots. These cercariae resembled previously described brachycladiid larvae (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). Other inspected species of moonsnails, including all 42 specimens of Euspira pallida and 3 specimens of Pseudopolinices nanus, were not infected with putative brachycladiids.
nad3 gene
The partial nad3 gene was sequenced for all eight isolates, trimmed to 323 bp, and deposited in GenBank under the accession numbers PZ533939–46. The closest BLAST hits were nad3 sequences of the brachycladiid C. oblonga: AF034554 (Fernández et al. Reference Fernández, Aznar, Latorre and Raga1998a), KT180214 (Fraija-Fernández et al. Reference Fraija-Fernández, Aznar, Fernández, Raga and Fernández2016), LC532144–51 (Nakagun and Kobayashi Reference Nakagun and Kobayashi2020), MZ269064–5 (Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025), and PX705411 (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026). We put them with our sequences into a single alignment, which was 315 bp long after trimming and contained 44 polymorphic sites. Based on this alignment, we built a haplotype network which comprised 17 haplotypes (Figure 1).
Haplotype network of Campula spp. isolates based on partial nad3 (n = 21) gene sequences. Colours of circles refer to the geographic origin of each haplotype. The relative size of circles is proportional to the number of sequences of this haplotype. The black dots indicate missing haplotypes. The number of hatch marks corresponds to the number of substitutions between haplotypes. Coloured backgrounds indicate three putative species: C. oblonga, Campula sp. NWP1, and Campula sp. NWP2. Isolates from the definitive host are coloured in black, and those from the first intermediate host are in blue. Abbreviations of host species: Cry_aff, Cryptonatica affinis; Neo_asi, Neophocaena asiaeorientalis; Pho_dal, Phocoenoides dalli; Pho_pho, Phocoena phocoena.
Figure 1. Long description
A radial diagram illustrating genetic distances between haplotypes.
At the West is the Campula oblonga N E A group, shaded in light brown. It features a large central circle representing multiple samples from the Barents Sea (pink) and North Sea (orange). Radiating from this center are several smaller circles:
- To the North-West, purple (Baltic Sea) and orange (North Sea) haplotypes separated by 2 and 3 hatch marks respectively.
- To the South and East, pink haplotypes (Barents Sea) labeled G 15.5, G 15.8, G 15.3, and D 12.12, separated by 1 to 2 hatch marks.
- An arrow points North to a list of isolates including K T 180214 Pho_pho and several Cry_aff samples.
Moving East via a series of black dots (missing haplotypes) and connecting lines with multiple hatch marks:
- To the North-East is the Campula sp. N W P 2 group, shaded in light blue. It contains two yellow circles (Yellow Sea) labeled M Z 269064 and M Z 269065, both from Neo_asi hosts, separated by 2 hatch marks.
- To the far East is the Campula sp. N W P 1 group, shaded in purple. It contains four blue circles (Pacific coast of Japan) from Pho_pho hosts, connected in a linear and branched fashion with 1 to 2 hatch marks between them.
- To the South-East is the Campula oblonga N W P group, shaded in brown. It contains four blue circles from Pho_dal and Pho_pho hosts. This group is connected to the N W P 1 group by a long line with 10 hatch marks.
A legend at the bottom identifies geographic origins: Baltic Sea (purple), North Sea (orange), Barents Sea (pink), Pacific coast of Japan (blue), and Yellow Sea (yellow). Host abbreviations include Cry_aff (blue text for intermediate host) and Neo_asi, Pho_dal, and Pho_pho (black text for definitive hosts).
In the ASAP analysis, the minimum score of 2.0 suggested that the dataset was partitioned into three species. The largest group contained sequences from the type host (Phocoena phocoena) and the type locality (the North Sea) of the C. oblonga species (Figure 1). The sequence from the Baltic Sea (ex P. phocoena), as well as four sequences from the North-West Pacific (ex P. phocoena and Phocoenoides dalli) and all newly generated sequences of rediae from Arctic moonsnails, also nested within C. oblonga. The second group consisted of four specimens obtained from P. phocoena from the Pacific coast of Japan (Figure 1). It is labelled as Campula sp. NWP1. The last ASAP-derived group united two sequences that originated from Neophocaena asiaeorientalis from the Yellow Sea (Figure 1). We labelled it as Campula sp. NWP2.
The barcode gap between the three putative Campula species was distinct. The maximal intragroup variation (within C. oblonga) was 0.037 ± 0.019 or 11 substitutions, and the minimal intergroup variation (between C. oblonga and Campula sp. NWP1) was 0.044 ± 0.013 or 13 substitutions (Figures 1 and 2). Additionally, the C. oblonga sequences were subdivided into two groups of different geographic origin: the North-East Atlantic (NEA) and the North-West Pacific (NWP). The variation between geographically isolated groups of C. oblonga ranged from 0.020 ± 0.008 to 0.037 ± 0.011, or 6 to 11 substitutions (Figures 1 and 2). These differences were smaller than in sympatric isolates of three putative Campula species in the NWP (Figure 2).
Pairwise genetic distances between putative species of Campula in a 315-bp-long fragment of the nad3 gene. The number of base substitutions per site between sequences is shown below the diagonal and coloured in purple. The number of bases which are not identical is shown above the diagonal and coloured in green. GenBank accession numbers for newly obtained sequences are in bold. Abbreviations: NEA, North-East Atlantic; NWP, North-West Pacific.
Figure 2. Long description
A square matrix compares 20 GenBank accession numbers. The vertical axis on the left lists GenBank accession number, Species (Campula oblonga, Campula sp. N W P 1, or Campula sp. N W P 2), and Location (N E A or N W P). The horizontal axis at the top lists the same GenBank accession numbers.
Above the white diagonal, the cells are shaded in green and contain integers representing the number of non-identical bases. Values range from 0 (light green) to 25 (dark green). For example, the top-right cell comparing K T 1 8 0 2 1 4 and M Z 2 6 9 0 6 4 shows 22.
Below the white diagonal, the cells are shaded in purple and contain decimal values representing base substitutions per site. Values range from 0.000 (light purple) to 0.093 (dark purple). For example, the bottom-left cell comparing M Z 2 6 9 0 6 4 and K T 1 8 0 2 1 4 shows 0.080.
Two color scale bars are provided. A vertical green scale on the right is labeled from 0 to 25. A horizontal purple scale at the bottom is labeled from 0.00 to 0.08.
Accession numbers in bold include: P Z 5 3 3 9 4 4, P Z 5 3 3 9 4 3, P Z 5 3 3 9 4 6, P Z 5 3 3 9 3 9, P Z 5 3 3 9 4 0, P Z 5 3 3 9 4 2, P Z 5 3 3 9 4 5, and P Z 5 3 3 9 4 1.
Seven haplotypes were present within the NEA group of C. oblonga, with one central dominant haplotype comprising four isolates from the Barents Sea and one from the North Sea. The other six haplotypes (one from the Baltic Sea, one from the North Sea, and four from the Barents Sea) were unique; they differed from the central one by 1–3 substitutions (Figure 1). Four haplotypes were present within the NWP group of C. oblonga; they differed from each other by 1–3 substitutions. The intraspecific variation within the Campula sp. NWP1 was 1–4 substitutions, and four unique haplotypes were present (Figures 1 and 2). The two sequences of Campula sp. NWP2 differed from each other by two substitutions (Figure 1).
To further test the hypothesis that our sample contains three putative species, we performed a phylogenetic analysis of the nad3 dataset. We built another alignment, which included all Campula spp. sequences (except the identical ones of the NEA group), two sequences of Oschmarinella spp. (the closest relatives), eight sequences of other brachycladiid species, and the sequence of Tormopsolus orientalis Yamaguti, 1934 (Acanthocolpidae clade A) as an outgroup (Table 2). The final alignment was 315 bp long after trimming and contained 27 sequences. The Bayesian phylogenetic tree is presented in Figure 3. The clade Campula+Oschmarinella was resolved as monophyletic with strong nodal support (Figure 3). The order of divergence within this clade, however, was uncertain in both the BI and the ML analyses. The genus Campula was resolved as monophyletic only in the BI analysis (Figure 3). All three putative species within Campula were reciprocally monophyletic in both the BI and ML analyses. Each species had high BI and moderate to high ML nodal support (Figure 3). The interrelationships between these three species, however, remained unresolved (Figure 3). Within C. oblonga, the NEA group had moderate nodal support; the NWP group was recovered as monophyletic only in the BI analysis (Figure 3).
Bayesian phylogenetic tree for putative Campula species inferred from the nad3 dataset. Posterior probabilities are shown at nodes, followed by bootstrap support from the tree reconstructed for the same dataset with the ML method. Support values lower than 0.9 (BI) and 75 (ML) are not displayed. The scale bar shows the substitution rate. GenBank accession numbers for newly obtained sequences are in bold. Colours of circles refer to the geographic origin of Campula spp. sequences. Coloured rectangles mark the three putative species within Campula.
Figure 3. Long description
The image consists of three main sections.
On the left, a legend for definitive hosts shows illustrations of three porpoises: Phocoena phocoena (harbour porpoise), Phocoenoides dalli (Dall’s porpoise), and Neophocaena asiaeorientalis (narrow-ridged finless porpoise). A geographic legend identifies North-East Atlantic (N E A) origins with purple (Baltic Sea), pink (Barents Sea), and orange (North Sea) circles, and North-West Pacific (N W P) origins with blue (Pacific coast of Japan) and yellow (Yellow Sea) circles. A scale bar indicates 0.08 substitutions per site.
In the center and right, a phylogenetic tree displays relationships within the Brachycladiidae family. The tree branches are labeled with posterior probabilities and M L bootstrap support values. Four colored rectangles highlight specific Campula groups:
* A brown rectangle at the top contains the Campula oblonga N E A group, including bolded accessions P Z 5 3 3 9 4 0, P Z 5 3 3 9 4 2, P Z 5 3 3 9 4 1, and P Z 5 3 3 9 4 5, associated with Barents, Baltic, and North Sea origins and harbour porpoise hosts.
* A second brown rectangle contains the Campula oblonga N W P group (accessions L C 5 3 2 1 4 4 to L C 5 3 2 1 4 7), associated with the Pacific coast of Japan and Dall’s porpoise hosts.
* A purple rectangle contains Campula species N W P 1 (accessions L C 5 3 2 1 4 8 to L C 5 3 2 1 5 1), also from the Pacific coast of Japan and harbour porpoise hosts.
* A light blue rectangle contains Campula species N W P 2 (accessions M Z 2 6 9 0 6 4 and M Z 2 6 9 0 6 5), associated with the Yellow Sea and finless porpoise hosts.
Below these groups, the tree includes other species such as Oschmarinella macrorchis, Brachycladium species, Orthosplanchnus arcticus, Synthesium species, and Nasitrema species. The outgroup at the bottom is Tormopsolus orientalis.
Intramolluscan stages of Campula oblonga. (A) Redia, (B) infective cercaria body structure, and (C) general view. (D) Mucoid glands and caudal excretory duct in underdeveloped cercaria.
Figure 4. Long description
The illustration consists of four panels labeled A through D.
Panel A shows a redia, a long, slender, worm-like structure containing numerous developing cercariae inside. A vertical scale bar indicates 300 micrometers.
Panel B provides a detailed anatomical view of an infective cercaria body. At the anterior end is an oral sucker followed by a complex system of mucoid glands and ducts. The central region contains a ventral sucker and a developing digestive system. The posterior region shows the excretory bladder and the base of the tail. A vertical scale bar indicates 50 micrometers.
Panel C presents a general view of the cercaria, showing a simplified oval body with an oral sucker, eyespots, and a ventral sucker, attached to a long, thin, undulating tail. A vertical scale bar indicates 200 micrometers.
Panel D depicts an underdeveloped cercaria. The body highlights the mucoid glands in a darker shade and shows the caudal excretory duct extending from the body into the tail. A vertical scale bar indicates 100 micrometers.
Structure and development of Campula oblonga cercariae. (A) Infective cercaria, general structure and mucoid in the tegument (toluidine blue), whole mount (WM), differential interference contrast (DIC). (B, C) Body structure, WM, DIC. (D–H) Mucoid structures in underdeveloped (D–G) and infective (H) cercariae; toluidine blue, WM, DIC (D–F) and Azur II-eosin, sagittal (G) and frontal (H) histological sections. Scale bars are 50 μm. Abbreviations: c, caecum; ev, excretory vesicle; ga, cerebral ganglion; mg, mucoid gland; os, oral sucker; pd, penetration gland ducts; pe, pigmented eyespot; pg, penetration glands; ph, pharynx; pr, reproductive system primordium; sg, sheath-forming glands; t, tail; tg, tegument; vp, vitellarium primordium; vs, ventral sucker.
Figure 5. Long description
A multi-panel figure with eight micrographs labeled A through H. Scale bars in each panel represent 50 micrometers.
Panel A: A wide view of infective cercariae. The central specimen shows an oral sucker (o s) at the top, followed by pigmented eyespots (p e), penetration gland ducts (p d), penetration glands (p g), a ventral sucker (v s), and an excretory vesicle (e v) at the base of the tail (t). A nearby specimen stained with toluidine blue highlights dark purple mucoid glands (m g) around the ventral sucker.
Panel B: A high-magnification view of the body. Labels from top to bottom identify the o s, p e, pharynx (p h), p d, p g, reproductive system primordium (p r), and vitellarium primordium (v p).
Panel C: Focuses on the digestive and excretory systems, showing the o s, p d, p g, caecum (c), v s, and e v.
Panels D and E: Micrographs of underdeveloped cercariae. Panel D shows m g and p e near the v s. Panel E shows m g clusters and sheath-forming glands (s g) along the body margin and tail.
Panel F: A large vertical panel showing an infective cercaria with prominent dark purple m g clusters surrounding the o s and v s. The s g are visible as dark spots along the lateral margins of the body and extending down the length of the tail.
Panel G: A sagittal histological section stained with Azur II-eosin. It shows the internal arrangement of the o s, v s, e v, and large purple-stained m g and s g.
Panel H: A frontal histological section. Labels identify the o s, cerebral ganglion (g a), p h, tegument (t g), p g, p r, c, and e v.
Structure of Campula oblonga cercariae visualised by confocal laser scanning microscopy and TRITC-phalloidin, acetylated α-tubulin, and phospho-Y antibody staining. Anterior body end of cercariae (A) and whole body (B, C). Scale bars are 50 μm. Abbreviations: c, caecum; ev, excretory vesicle; ga, cerebral ganglion; os, oral sucker; pe, pigmented eyespot; ph, pharynx; t, tail; ue, unpigmented eyespot; vs, ventral sucker. Arrowheads on B mark flame cells.
Figure 6. Long description
A three-panel C L S M micrograph series with 50 micrometer scale bars.
Panel A shows a close-up of the anterior body end. At the top center is an unpigmented eyespot labeled u e. Below this are two dark circular pigmented eyespots labeled p e. Green phospho-Y staining highlights the cerebral ganglion labeled g a on either side of the eyespots, while magenta alpha-tubulin staining reveals a dense network of fibers.
Panel B displays the whole body stained for actin in green and alpha-tubulin in magenta. Two prominent circular structures are visible along the midline: the oral sucker labeled o s at the anterior and the ventral sucker labeled v s in the center. Multiple white arrowheads along the right side of the body point to small magenta-stained flame cells.
Panel C shows the whole body stained for actin in grayscale. Starting from the top, the oral sucker o s leads to a pharynx labeled p h. Two intestinal caeca labeled c extend down the sides of the body, flanking the central ventral sucker v s. At the posterior end is a large excretory vesicle labeled e v, which connects to the base of the tail labeled t.
cox1 gene
The partial cox1 gene was successfully sequenced for seven isolates. The obtained sequences were trimmed to 751 bp and deposited in GenBank under the accession numbers PZ530543–PZ530549. No other cox1 data are available for Campula spp. in GenBank. The variation among the generated cox1 sequences of the NEA C. oblonga ranged from 1 to 11 substitutions.
Nuclear ribosomal markers
The fragment of 28S rDNA was sequenced for two of our isolates, D12.12 and G11.9. Both sequences were 1275 bp long and identical. One of them was deposited in GenBank under the accession number PZ530474. We built an alignment which included our 28S rDNA sequence of C. oblonga (PZ530474) and the 28S rDNA sequences of C. oblonga from the NEA group (KM258671; Fraija-Fernández et al. Reference Fraija-Fernández, Olson, Crespo, Raga, Aznar and Fernández2015) and Campula sp. NWP2 (MZ265262; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025). After trimming to match the shortest sequence, the alignment was 1012 bp long. All three sequences (KM258671, MZ265262, and PZ530474) were identical.
The partial 18S rDNA was sequenced for a single isolate, D12.12. The obtained sequence was 1704 bp long and deposited in GenBank under the accession number PZ530539. We built an alignment which included the obtained sequence and the 18S rDNA sequences of C. oblonga from the NEA group (AJ004970 and KM258665; Fernández et al. Reference Fernández, Littlewood, Latorre, Raga and Rollinson1998b; Fraija-Fernández et al. Reference Fraija-Fernández, Olson, Crespo, Raga, Aznar and Fernández2015). The resulting alignment was 1861 bp long, including gaps. The variation within the NEA group of C. oblonga was 0–1 substitution. As the 28S rDNA between the putative species (C. oblonga and Campula sp. NWP2) was identical and the 18S rDNA sequences were limited to the NEA group of C. oblonga, we omitted phylogenetic analysis of the ribosomal dataset.
No other nuclear ribosomal markers are available for any putative Campula species in GenBank. For future comparisons, we generated a 973-bp-long sequence containing almost the entire ITS1, the complete 5.8S rDNA, the entire ITS2, and the beginning of the 28S rDNA for the isolate D12.12. The sequence was deposited in GenBank under the accession number PZ530585.
Description of Campula oblonga intramolluscan stages
Host: Cryptonatica affinis (Gmelin, 1791).
Locality: Dalnezelenetskaya Bay (Barents Sea).
Prevalence: 2.60% (N = 308).
Site: Reproductive and digestive glands.
Daughter rediae (Figure 4A)
Measurements based on 10 specimens fixed in a hot saturated solution of mercury(II) chloride with acetic acid. Rediae elongated, 1192 (506–1615) × 106 (74–132). Posterior end slightly pointed. Mouth terminal, pharynx small, oval, 28 (21–34) × 29 (24–34). Caecum oval, short, 41 (26–75) × 27 (17–39). Body wall thin, brood cavity voluminous, filled with cercarial embryos at different stages of development. Birth pore with distinct birth canal posterior to pharynx. Germinal mass at posterior body end, embedded in parenchyma.
Cercariae (Figures 4B, C; 5A–C; 6)
Measurements based on 20 specimens fixed in a hot saturated solution of mercury(II) chloride with acetic acid. Distome larvae with pair of pigmented eyespots and simple tail. Body 213 (183–267) long, 91 (81–100) wide, with slightly narrowed anterior and slightly dilated posterior ends. Spines small, simple; size and density decreasing towards posterior end. Tail simple, 462 (402–512) long, 28 (22–35) wide at base, 2.2 times longer than body. Oral sucker subterminal, oval, 45 (37–51) × 40 (33–45). Ventral sucker spherical, 36 (30–41) × 40 (36–45), closer to posterior body end. Sucker ratio: 1:0.81 (0.63–1). Prepharynx long. Pharynx pyriform, 17 (15–19) × 11 (8–12). Oesophagus primordium short. Posterior caeca primordia as rows of cells, extending to posterior body end, lateral to excretory vesicle. Anterior caeca primordia not identified. Cerebral ganglion dorsal to prepharynx. Two pigmented eyespots, small, oval, lateral to oesophagus. Small phospho Y-positive structure (unpaired unpigmented eyespot) anteromedial to pigmented eyespots. Nine unicellular penetration glands in forebody. Ducts of four glands running medially to pigmented eyespots, ducts of remaining five cells running laterally to pigmented eyespots, all going towards anterior body end. Each duct opening through individual pore located dorsally to anterior edge of oral sucker, nine pores in total, arranged in formula of (1 + 2 + 2) + (2 + 2). Cystogenous glands not detected. Excretory vesicle in hindbody, I-shaped, slightly asymmetrical. Excretory vesicle wall thick. Excretory system of ‘Mesostoma’ type. Main collecting ducts dividing into anterior and posterior parts anteriorly to midlevel of ventral sucker. Excretory formula 2[(3 + 3 + 2) + (2 + 2 + 2)] = 28. Caudal excretory duct present in underdeveloped cercariae and absent in infective cercariae. Very small testes primordia in hindbody, slightly oblique. Cirrus-sac primordium as reversed C-shaped group of cells. Primordium of female reproductive system crooked, compact (including metraterm, uterus, ootype, oviduct, and ovary); from its dorsal part, vitellarium primordium passing laterally as two strands of cells, which then turn posteriorly, running along caeca primordia.
Developing cercariae and mucoid structures (Figures 4D and 5D–H)
Cercariae leave daughter rediae underdeveloped; their morphogenesis is completed in the digestive gland of the host. Development of pigmented eyespots begins before the developing cercariae leave the daughter rediae and soon after the formation of the tail bud. We identified mucoid substances in two types of structures: (1) ten ventral mucoid glands, four pairs in the forebody and one pair in the hindbody; and (2) sheath-forming glands, located at the dorsal side of the body and in the tail. Development of mucoid glands begins before the larvae leave the rediae, simultaneously with the formation of pigmented eyespots. Sheath-forming glands first became evident in the tail, and later in the body of the developing cercariae. The exact number of mucoid glands is easily seen in younger cercariae. In more developed specimens, three pairs of mucoid glands overlap. During the final stages of cercarial development outside rediae, the mucoid substance is transferred into the tegument, which becomes swollen.
Cercariae behaviour
In August 2023, two Arctic moonsnails shed a large number of cercariae. The emission occurred during the night. We transferred the emitted cercariae from jars containing molluscs to an embryo dish, then stored it in the cold room at 9–10°C. Cercariae were alive and moved actively for three days. Emitted cercariae had a clear photopositive reaction. They swam continuously, with resting phases being rare.
Remarks
The intramolluscan stages of C. oblonga are similar to those previously described for other brachycladiids, Orthosplanchnus arcticus Odhner, 1905 and Brachycladiidae gen. sp. 1 WS (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). The daughter parthenogenetic generations are rediae. The cercariae share the following common traits: development finishing in the host tissues, outside rediae; a simple tail; oral and ventral suckers present; presence of simple tegumental spines; 8–9 penetration glands; a digestive system including the prepharynx, pharynx, short oesophagus primordium, and caeca primordia; thick-walled excretory vesicle; and the excretory system of ‘Mesostoma’ type. Furthermore, cercariae of all three species have specialised structures filled with mucoid secretions. These include several pairs of mucoid glands in the body and sheath-forming glands in the body and tail. Previously, we referred to the latter as ‘mucoid cytons’ (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020, Reference Kremnev, Gonchar, Krapivin, Uryadova, Miroliubov and Krupenko2021). The conventional term, however, for this type of cercarial gland is ‘sheath-forming glands’, following the terminology of Galaktionov and Dobrovolskij (Reference Galaktionov and Dobrovolskij2003).
Cercariae of C. oblonga and O. arcticus are similar in body size, have a pair of pigmented eyespots and an unpaired unpigmented eyespot, along with nine penetration glands in the forebody. They differ in body-to-tail length ratio, which is near 1:1 in O. arcticus and 1:2.2 in C. oblonga. Additionally, cercariae of O. arcticus have primordia of anterior caeca, which are absent in C. oblonga. Cercariae of Brachycladiidae gen. sp. 1 WS and C. oblonga are similar in their body-to-tail length ratio, and they are both devoid of anterior caeca primordia. The body of Brachycladiidae gen. sp. 1 WS cercariae, however, is smaller, and this species has only eight penetration glands and lacks pigmented eyespots. Finally, cercariae of all three species differ in their excretory formula.
Discussion
Life cycle data for Campula oblonga
This study was initiated to check the taxonomic position of rediae and cercariae described by Chubrik (Reference Chubrik1966) from the Arctic moonsnail Cryptonatica affinis from the Barents Sea. She assigned these intramolluscan stages to Neophasis oculata (Levinsen, 1881) Miller, 1941, a fish parasite from the family Acanthocolpidae. The genuine first intermediate hosts of N. oculata, however, are buccinid gastropods Buccinum undatum Linnaeus, 1758 and Neptunea despecta (Linnaeus, 1758) (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Uryadova, Miroliubov and Krupenko2021). Additionally, two facts suggested that the rediae and cercariae described by Chubrik (Reference Chubrik1966) might belong to the Brachycladiidae: the gastropod host from the family Naticidae, and morphological similarities with cercariae of Brachycladiidae gen. sp. 1 WS (yet-unidentified-to-species brachycladiid intramolluscan stages from C. affinis found in the White Sea) and Orthosplanchnus arcticus (Kremnev et al. Reference Kremnev, Gonchar, Krapivin, Knyazeva and Krupenko2020). Nonetheless, the cercariae described by Chubrik (Reference Chubrik1966) differ from O. arcticus in their longer tail and, unlike Brachycladiidae gen. sp. 1 WS, they have a pair of pigmented eyespots. These features indicated that these cercariae might belong to another brachycladiid species. In any case, our suggestion required testing with molecular genetic data.
We sampled moonsnails from the Dalnezelenetskaya Bay of the Barents Sea, the same area where Chubrik (Reference Chubrik1966) conducted her research, and found rediae and cercariae similar to those described by Chubrik (Reference Chubrik1966) in C. affinis. The obtained molecular genetic data showed that these rediae and cercariae belong to Campula oblonga, a parasite of toothed whales (Figures 1–3).
Integrative species hypothesis for the genus Campula
The brachycladiid genus Campula currently contains only two recognised species: the type species C. oblonga and C. folium (WoRMS 2026a). Campula oblonga is reported from a variety of hosts, including porpoises (Neophocaena asiaeorientalis, Phocoena phocoena, and Phocoenoides dalli), dolphins (Delphinus delphis Linnaeus, 1758), and occasionally even the thresher shark (Adams et al. Reference Adams, Hoberg, McAlpine and Clayden1998). Additionally, this species is known from both the North Atlantic and North Pacific (Adams et al. Reference Adams, Hoberg, McAlpine and Clayden1998; Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Cobbold Reference Cobbold1858; Gibson et al. Reference Gibson, Harris, Bray, Jepson, Kuiken, Baker and Simpson1998; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Kuramochi et al. Reference Kuramochi, Kikuchi, Okamura, Tatsukawa, Doi, Nakamura, Yamada, Koda, Yoshida, Matsuura and Sakakibara2000; Price Reference Price1932; Yamaguti Reference Yamaguti1951). Campula folium, by contrast, is restricted to the Sea of Japan in the North Pacific and infects only the narrow-ridged finless porpoise N. asiaeorientalis as the definitive host (Ozaki Reference Ozaki1935).
Several studies provided molecular genetic data (18S and 28S rDNA, nad3 mtDNA) for the maritae of C. oblonga (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Fernández et al. Reference Fernández, Aznar, Latorre and Raga1998a, b; Fraija-Fernández et al. Reference Fraija-Fernández, Aznar, Fernández, Raga and Fernández2016; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020). These were obtained from three porpoise species, N. asiaeorientalis, P. dalli, and P. phocoena, and included specimens across both the NEA and NWP. Thus, the generated genetic data covered most reported cetacean hosts for C. oblonga and roughly half of the known range. The results highlighted clear genetic differences in nad3 mtDNA sequences between NEA and NWP isolates, as well as genetic heterogeneity among sympatric NWP samples (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020). The ML phylogenetic analysis in these studies, however, did not reveal reciprocally monophyletic lineages among the analysed nad3 sequences of C. oblonga, which prevented phylogeny-based delimitation of putative species (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020).
Notably, the maritae studied by Kim et al. (Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025) shared several important features with C. folium. These included the host, the geographic origin of the samples, the overall morphology of the worms, and even some morphometric matching (including egg size). Despite these similarities, Kim et al. (Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025) considered their samples conspecific with C. oblonga and agreed with the previously suggested synonymy of C. folium and C. oblonga (Adams et al. Reference Adams, Hoberg, McAlpine and Clayden1998; Kuramochi et al. Reference Kuramochi, Kikuchi, Okamura, Tatsukawa, Doi, Nakamura, Yamada, Koda, Yoshida, Matsuura and Sakakibara2000). This tentative decision was based on: (1) the genetic proximity of their samples to available sequences of C. oblonga; (2) the presence of a uroproct in their specimens, which was reportedly lacking in the original description of C. folium by Ozaki (Reference Ozaki1935); (3) the overlapping morphometric ranges between the two species; and (4) the absence of morphological features reliably distinguishing them. Shortly afterwards, however, Buchmann et al. (Reference Buchmann, Jensen, Quaade and Kania2026) identified potential morphometric differences, demonstrating that the NEA isolates of C. oblonga have a shorter body, a shorter pharynx, and a smaller ventral sucker compared to the worms studied by Kim et al. (Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025). Additionally, the nad3 genetic data from Buchmann et al. (Reference Buchmann, Jensen, Quaade and Kania2026) showed that the NEA and NWP isolates of C. oblonga are distantly related. Nevertheless, they also interpreted the observed genetic and morphological variation as rather intraspecific. Combining the evidence from previous studies (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025; Nakagun and Kobayashi Reference Nakagun and Kobayashi2020) with our results and the established criteria of species delimitation in trematodes (Bray et al. Reference Bray, Cutmore and Cribb2022; Cribb et al. Reference Cribb, Barton, Blair, Bott, Bray, Corner, Cutmore, De Silva, Duong, Faltýnková, Gonchar, Hechinger, Herrmann, Huston, Johnson, Kremnev, Kuchta, Louvard, Luus-Powell, Martin, Miller, Pérez-Ponce de León, Smit, Tkach, Truter, Waki, Vermaak, Wee, Yong and Achatz2025), we provide the following synthesis as a preliminary hypothesis for the Campula oblonga species complex.
The available nad3 mtDNA sequences of C. oblonga clearly cluster in three groups (Figures 1 and 2), each resolved as reciprocally monophyletic, with posterior probability of 1.0 and ML bootstrap support ranging from 76 to 96% (Figure 3). The maximal intragroup difference is 3.7% (11 substitutions), while the intergroup variation ranges from 4.4% to 9.2%, or 13–25 substitutions (Figures 1 and 2). Despite being suggestive, neither barcode gap nor reciprocal monophyly alone can reliably distinguish separate species from geographically structured populations of a single species, particularly when based on a single mitochondrial locus, as in our case (Bray et al. Reference Bray, Cutmore and Cribb2022). Nevertheless, the intergroup variation in our sample exceeds the intraspecific nad3 divergence reported for most other brachycladiid species (Kim et al. Reference Kim, Youn, Lee, Lee, Kim, Kang, Choe and Georgieva2023; Kremnev et al. Reference Kremnev, Krapivin and Krupenko2025; Marigo et al. Reference Marigo, Cunha, Bertozzi, Souza, Rosas, Cremer, Barreto, de Oliveira, Cappozzo, Valente, Santos and Vicente2015), except for 10.9% intraspecific divergence in Synthesium tursionis (Marchi, 1873) Stunkard & Alvey, 1930 (Shiozaki et al. Reference Shiozaki, Amano, Fernández and Fraija-Fernández2019). This value, however, is ambiguous, as the data and analysis in Shiozaki et al. (Reference Shiozaki, Amano, Fernández and Fraija-Fernández2019) fail to distinguish between genuine intraspecific variation and a potential species complex. Without an additional study, the reported 10.9% divergence should be treated with much caution as a validated upper intraspecific variation within the Brachycladiidae. Thus, unlike the S. tursionis case, the nad3 genetic data for Campula spp. are consistent and indicate the possible presence of multiple species in the studied sample.
The largest nad3 genetic lineage combines all the isolates from the NEA (including our sequences from the first intermediate host, C. affinis) and four isolates from the NWP (Figure 1). Importantly, this group contains the sequences from the type host, P. phocoena, and from the type locality, the North Sea, of C. oblonga (Figures 1 and 3). The smallest lineage unites two isolates from N. asiaeorientalis, the type host of C. folium (Figures 1 and 3). Additionally, these isolates originate from the Yellow Sea, a basin close to the type locality of C. folium, the Sea of Japan. These two neighbouring seas are only separated by the Korean Peninsula. Thus, we consider that Campula sp. NWP2 may tentatively be identified as C. folium, a conclusion that should be tested by sequencing samples from the type locality. No other species is currently recognised within the genus Campula. We therefore regard the remaining nad3 genetic lineage as a potentially separate and new-to-science species (Figures 1 and 3). Since Nakagun and Kobayashi (Reference Nakagun and Kobayashi2020) did not supplement their nad3 sequences with any morphological data, the formal description of Campula sp. NWP1 is currently impossible.
In addition to the barcode gap and reciprocal monophyly, all three putative Campula species co-occur in the NWP (Figures 1–3). However, sympatric coexistence of divergent lineages alone cannot distinguish separate species from secondary contact between populations (Bray et al. Reference Bray, Cutmore and Cribb2022). Host range seems a more promising line of evidence. Specifically, putative C. folium is so far known only from N. asiaeorientalis, whereas C. oblonga is confirmed from both P. phocoena and P. dalli across the NEA and NWP (Figure 3). Well-documented cases of broad specificity among brachycladiids, however, including the already mentioned S. tursionis infecting both delphinids and phocoenids as definitive hosts (Shiozaki et al. Reference Shiozaki, Amano, Fernández and Fraija-Fernández2019), indicate that the seeming difference in host range between putative C. folium and C. oblonga might be a bias due to sampling limitations. Finally, when focusing exclusively on studies integrating both morphometric and genetic data (Buchmann et al. Reference Buchmann, Jensen, Quaade and Kania2026; Kim et al. Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025), some morphological distinctions between maritae of putative C. folium and C. oblonga appear. Reinterpreting the morphometric comparison in Table 1 of Buchmann et al. (Reference Buchmann, Jensen, Quaade and Kania2026), with the Korean samples of Kim et al. (Reference Kim, Kang, Lee, Opara, Bia, Lee, Lee, Kim, Lee, Kim, Kim, Do, Kim, Lee, Lee, Park, Kim, Choe and Youn2025) as putative C. folium, indicates that C. folium possesses a slightly longer body and a larger ventral sucker than C. oblonga. Strikingly, their egg sizes show the opposite pattern, with eggs being smaller in C. folium (mean 69 × 37 μm) and larger in C. oblonga (mean 85 × 48.8 μm). These minor differences can arguably be considered intraspecific, as even broader morphological variation within a single nominal brachycladiid species (like S. tursionis) can be induced by different host species and even host individuals (Fernández et al. Reference Fernández, Balbuena, Pertusa and Raga1995; Shiozaki et al. Reference Shiozaki, Amano, Fernández and Fraija-Fernández2019). The only feature that remains stable, however, is egg size, in contrast to the differences observed between putative Campula species. Thus, the available genetic, ecological, and morphological data taken together represent a plausible, though not unequivocal, hypothesis that C. folium and C. oblonga are potentially two distinct species. Another challenge for this interpretation is the absence of nucleotide substitutions in the 28S rDNA sequences between them. However, having the same 28S rDNA sequences is quite common among closely related trematode species. Cribb et al. (Reference Cribb, Barton, Blair, Bott, Bray, Corner, Cutmore, De Silva, Duong, Faltýnková, Gonchar, Hechinger, Herrmann, Huston, Johnson, Kremnev, Kuchta, Louvard, Luus-Powell, Martin, Miller, Pérez-Ponce de León, Smit, Tkach, Truter, Waki, Vermaak, Wee, Yong and Achatz2025) summarised multiple examples of otherwise distinct congeners with identical nuclear ribosomal sequences.
Despite sharing the same definitive host, P. phocoena, host specificity differs between C. oblonga and another putative species in the sample, Campula sp. NWP1, since the former also infects P. dalli (Figure 3). The absence of morphological data for Campula sp. NWP1 precludes any comparison of the maritae structure. Given that the identity of this lineage rests solely on a single mitochondrial marker, combined with the host-specificity and co-occurrence caveats discussed above, we regard Campula sp. NWP1 as a candidate rather than a confirmed separate species.
The isolates of C. oblonga split into two groups, delineated by their geographic origin (Figures 1 and 2), namely the NEA and NWP. The genetic differences between the two allopatric groups of C. oblonga fall below the intergroup distances observed among the three putative Campula species co-occurring in the NWP (Figure 2). Moreover, the NWP group of C. oblonga was not resolved as monophyletic in the ML analysis (Figure 3). A broadly similar pattern, including clear population structure and a lack of reciprocal monophyly, was previously reported for another widespread cetacean-restricted digenean, Pholeter gastrophilus (Kossack, 1910) Odhner, 1914 (Fraija-Fernández et al. Reference Fraija-Fernández, Fernández, Lehnert, Raga, Siebert and Aznar2017). Similarly, we interpret our genetic data as indicating that C. oblonga is a single species with at least two populations: one in the NEA and another in the NWP. Their divergence is probably linked to the geographic isolation of the populations of the definitive host, P. phocoena, dating back to the mid-to-late Pleistocene glaciations (Ben Chehida et al. Reference Ben Chehida, Thumloup, Schumacher, Harkins, Aguilar, Borrell and Fontaine2020). As the geographic range of P. phocoena is still interrupted in most of the Arctic Ocean, the NEA and NWP populations of C. oblonga remain isolated.
Summing up, two alternative explanations for the reported variation of C. oblonga are viable. This may be a single, widespread species, with broad specificity to porpoises, clear genetic structure among and within ocean basins, and subtle but consistent differences in maritae structure. Alternatively, this complex may contain three putative species (Figure 3): C. oblonga infecting Dall’s and harbour porpoise in the NWP and harbour porpoise in the NEA, and two NWP-restricted species, C. folium from N. asiaeorientalis and Campula sp. NWP1, a yet-to-be-described species ex P. phocoena. We regard the three-species hypothesis as more plausible, yet the current evidence does not decisively favour it over the alternative. The following steps are needed to resolve the C. oblonga taxonomic case definitively: (1) sequencing additional markers, including nuclear ribosomal (18S rDNA, ITS1, and ITS2) and mitochondrial (cox1) fragments for putative species, and (2) a further search for morphological distinctions between maritae based on larger, directly comparable hologenophore samples. Obtaining genetic data to cover new combinations of hosts and localities for Campula spp., including sequencing of C. folium from the type locality, is also required. An accurate resolution of the single- versus three-species hypothesis for C. oblonga evidently extends far beyond brachycladiid taxonomy. Validating these species boundaries seems essential for understanding the epidemiology of cetacean diseases, as it may assist in managing endangered phocoenid populations (Koschinski et al. Reference Koschinski, Owen, Lehnert and Kamińska2024; Park et al. Reference Park, Sohn, An, Kim and An2015).
The life cycles of Campula spp
The genetic data obtained here partially elucidate the life cycle of C. oblonga (Figure 7). To our knowledge, this is the first unambiguous identification of the intermediate host for a named trematode species restricted to cetaceans. In the NEA, the first intermediate host of C. oblonga is the Arctic moonsnail, C. affinis (Figure 7). This mollusc species has a broad distribution, which includes the NWP (Chen and Nomaki Reference Chen and Nomaki2021; WoRMS 2026b). It is therefore possible that C. affinis acts as the first intermediate host of C. oblonga in this region as well. The broad range of the Arctic moonsnail, however, has never been thoroughly tested with molecular genetic methods. Moreover, studies indicate the actual presence of deeply diverged genetic lineages within sympatric samples of C. affinis from the Canadian Arctic (Layton et al. Reference Layton, Martel and Hebert2014). Thus, we cannot rule out the possibility that another species of a naticid gastropod is involved in the C. oblonga life cycle from the NWP. The first intermediate hosts of the other two putative Campula species are unknown. We expect, however, that these are also naticid gastropods, possibly those species restricted to the North Pacific Ocean, given the NWP-restricted distribution of putative C. folium and Campula sp. NWP1. Identification of their first intermediate hosts may strengthen the proposed three-species hypothesis. The identity of the mollusc host, as is known, can sometimes reliably distinguish trematode congeners (Gonchar and Galaktionov Reference Gonchar and Galaktionov2021; Krupenko et al. Reference Krupenko, Kremnev, Gonchar, Uryadova, Miroliubov, Krapivin, Skobkina, Gubler and Knyazeva2022; Petkevičiūtė et al. Reference Petkevičiūtė, Stunžėnas and Stanevičiūtė2023).
Diagram of the partially elucidated life cycle of Campula oblonga.
Figure 7. Long description
The flowchart depicts a clockwise cycle with four main stages.
1. Top Stage: A line drawing of a porpoise labeled Phocoena phocoena, Phocoenoides dalli. A circular inset shows an adult fluke with internal organs visible. An arrow points clockwise toward the next stage.
2. Right Stage: A circular inset contains several larval forms, including two tailed cercariae, two smaller oval forms, and one long tubular sporocyst containing multiple developing larvae.
3. Bottom Stage: A line drawing of a sea snail labeled Cryptonatica affinis. An arrow continues clockwise to a circular inset on the left.
4. Left Stage: A circular inset shows a single cercaria with a distinct head and a long, thin tail. An arrow points upward toward the porpoise, accompanied by the text: Presumably fish and or cephalopods, indicating the likely transmission vector back to the definitive host.
The resting phases in continuously swimming cercariae of C. oblonga are rare, indicating these larvae likely use an ‘active search’ strategy (Prokofiev and Galaktionov Reference Prokofiev and Galaktionov2009). Thus, both the behaviour and morphology of cercariae strongly indicate that the second intermediate host is mandatory for the life cycle completion (Figure 7). The nature of this host is yet unknown. The diet composition of the harbour and Dall’s porpoises (Andreasen et al. Reference Andreasen, Ross, Siebert, Andersen, Ronnenberg and Gilles2017; Börjesson et al. Reference Börjesson, Berggren and Ganning2003; Heße et al. Reference Heße, Boyi, Das, Jung, Lehnert, Piette, Pinzone, Schückel, Schückel, Siebert and Gilles2025; Matsui et al. Reference Matsui, Matsuda and Matsuishi2020; Ohizumi et al. Reference Ohizumi, Kuramochi, Kubodera, Yoshioka and Miyazaki2003; Recchia and Read Reference Recchia and Read1989; Stedt et al. Reference Stedt, Brokmar, Neimanis, Englund, Carlsson and Roos2025; Walker Reference Walker1996) suggests fish and/or cephalopods are the most probable hosts of C. oblonga metacercariae.
Acknowledgements
We thank the fieldwork infrastructure provided by the Biological Research Station of the Murmansk Marine Biological Institute of the Russian Academy of Sciences in Dalnie Zelentsy. We extend our sincere thanks to all who contributed to the sampling, especially Alexandra Uryadova, Dr Alexey Miroliubov, Dr Anastasia Lianguzova, Arseniy Gubler, Olga Skobkina, Stepan Ivanov, Dr Valeriia Khabibulina, Vladimir Krapivin, and Yulia Efremenkova. During the research, we used the equipment of the resource centres ‘Molecular and Cell Technologies’ and ‘Center for Microscopy and Microanalysis’ of the Research Park of Saint Petersburg University, and the ‘Taxon’ Research Resource Center (http://www.ckp-rf.ru/ckp/3038/) of the Zoological Institute RAS. We are particularly grateful to Dr Anna Romanovich for excellent sequencing. Our sincere thanks are due to Dr Alexandra Chava for her help with the visualisation of Figure 2. We are also grateful to two anonymous reviewers for their valuable comments, which greatly elevated the initial version of the manuscript.
Financial support
This work was financially supported by the Russian Science Foundation, project No. 25-24-00386, https://rscf.ru/project/25-24-00386/.
Competing interests
The authors declare none.
Ethical standards
This study was conducted in compliance with all institutional, national, and international guidelines on the care and use of animals.
