Introduction
The morphology and the taxonomic status of the Skrjabinotaenia Akhumyan, 1946 species of North African gerbilline murids have been unclear for a long time (Haukisalmi et al. Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018), particularly in the case of Skrjabinotaenia oranensis (Joyeux and Foley, 1930) and Skrjabinotaenia psammomi Mikhail and Fahmy, 1968, which is actually Gerbillitaenia psammomi (Mikhail and Fahmy, 1968) (see Haukisalmi and Elmahy Reference Haukisalmi and Elmahy2025). Skrjabinotaenia oranensis was originally described as Catenotaenia oranensis Joyeux and Foley, 1930 parasitizing Meriones shawi (Rozet, 1833) from Algeria (Joyeux and Foley, Reference Joyeux and Foley1930). Posteriorly, the new genus Skrjabinotaenia was created to encompass C. oranensis, which became the type species for this new genus (Akhumyan Reference Akhumyan1946). Posteriorly, this catenotaeniid has also been reported parasitizing M. shawi in Morocco and Psammomys obesus Cretzschmar, 1828 in Egypt (Joyeux et al. Reference Joyeux, Baer and Gaud1951; Wolfgang Reference Wolfgang1956). However, the redescription of S. oranensis performed by Joyeux et al. (Reference Joyeux, Baer and Gaud1951) with specimens found in M. shawi from Morocco displayed some characteristics that were not compatible with the original description of the species (Joyeux and Foley Reference Joyeux and Foley1930). The original description of G. psammomi, as a species of the genus Skrjabinotaenia, was made by Mikhail and Fahmy (Reference Mikhail and Fahmy1968) with specimens found parasitizing P. obesus in Egypt. Recently, Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018) and Haukisalmi and Elmahy (Reference Haukisalmi and Elmahy2025) considered all the findings of S. oranensis subsequent to the original description as G. psammomi. It is also noticeable that Meggittina numida Jrijer and Neifar, 2014, described parasitizing M. shawi in Tunisia (Jrijer and Neifar Reference Jrijer and Neifar2014; Khemiri et al. Reference Khemiri, Jrijer, Neifar and Nouira2017), was synonymized with S. oranensis (Haukisalmi et al. Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018). In addition to the erection of the new genus Gerbillitaenia Haukisalmi and Elmahy, 2025, the authors also divided Skrjabinotaenia sensu stricto into two subgenera (Skrjabinotaenia and Meggittina) (Haukisalmi and Elmahy Reference Haukisalmi and Elmahy2025).
The aim of the present study was to describe, for the first time, the presence of G. psammomi in fat sand rats from Tunisia and to analyze the relationship between parasite burden and the size of G. psammomi due to the crowding effect. Moreover, this catenotaeniid is genetically characterized by partial 28S rDNA sequences.
Materials and methods
Specimens
A total 72 fat sand rats, P. obesus, were trapped in different localities of Tunisia during 2023 and 2024: El Fejij (33°13’59.628" N, 10°9’42.82" E), El Menzela (33°15’28.29" N, 9°58’58.17" E), Ksar El Hallouf (33°17’36.978" N, 10°8’50.16" E), and Tamaghza (34°23’4.402" N, 7°58’10.621" E) (Figure 1). Additionally, one Shaw’s jird, M. shawi, was trapped in Zahrat al Qubur (33°12’52.278" N, 10°12’42.402" E) The studied rodents were captured using snap traps. Later, they were sacrificed by cervical dislocation in the field laboratory and, finally, quickly examined for intestinal parasites under the steromicroscope Heerbrugg Wild M3Z (Leica Microsystems, Wetzlar, Germany). The helminthological analysis of the captured P. obesus revealed the presence of numerous G. psammomi in the intestine. The study of M. shawi allowed us to recover 11 specimens of S. oranensis.
Sampling localities of Meriones shawi and Psammomys obesus in the South of Tunisia. Images captured from Google Earth Pro and modified using Adobe Photoshop 2025 v. 26.5.0 and Adobe Illustrator 2025 v. 29.4 software (Adobe).
Light microscopy study and identification
The recovered living tapeworms were fixed during the field work in hot ethanol at 70%. In the laboratory, they were stained with Semichon’s acetic carmine, differentiated in 50% acid-alcohol solution, dehydrated in an ethanol series and with 2-propanol, cleared in clove oil, and, finally, mounted on slides with Canada balsam. Cestodes were identified in a Leitz Laborlux K microscope (Leica Microsystems) by comparison with previous records of the species (Haukisalmi and Elmahy Reference Haukisalmi and Elmahy2025; Joyeux and Foley Reference Joyeux and Foley1930; Joyeux et al. Reference Joyeux, Baer and Gaud1951; Jrijer and Neifar Reference Jrijer and Neifar2014; Mikhail and Fahmy Reference Mikhail and Fahmy1968). The original drawings were made with the aid of a drawing tube and later modified using Adobe Illustrator 2025 v. 29.4 software (Adobe, San José, CA, USA).
Seven specimens of G. psammomi, stained with Semichon’s acetic carmine and mounted on slides with Canada balsam, were deposited in the ‘Museu de Ciències Naturals de Barcelona’ (Barcelona, Spain) under the following accession numbers: MZB 2024-3090 (specimen no. 23090701-1), MZB 2024-3091 (specimens no. 23090101-3 and no. 23090101-4), MZB 2024 3092 (specimens no. 23090404-1 and no. 23090404-2), and MZB 2024-3093 (specimens no. 23090404-7 and no. 23090404-8). Additionally, slides with two S. oranensis (no. 24031302-3 and no. 24031302-4) were also deposited in the ‘Museu de Ciències Naturals de Barcelona’ (Barcelona, Spain) under the accession numbers MZB 2024-3094 and MZB 2024-3095.
Statistical analysis of abundance-size relationship
In order to check for a possible abundance-size relationships for G. psammomi infecting P. obesus (crowding effect), we investigated whether tapeworm size, assessed through body length (in μm) and the number of proglottids, decreased with increasing number of tapeworms co-infecting the same host. To do so, we conducted Linear Mixed Models (LMMs) on size parameters (response variables, log-transformed) as functions of tapeworm abundance (fixed effect, log-transformed). In these LMMs, host identity was also entered as a random factor to account for non-independence among observations on the same host. These LMMs were conducted using the MIXED procedure in SAS (SAS Institute 2008).
Molecular study
Some G. psammomi specimens were preserved for molecular analyses. Additionally, one specimen of S. oranensis recovered from M. shawi was also preserved to include its sequence in the present phylogenetic analysis.
To obtain molecular identification of the collected samples, total DNA was extracted from a portion of the tissue of each G. psammomi and S. oranensis samples reserved for this purpose. Before performing the DNA extraction procedure, PBS (1X) washes of the helminth samples were performed to rehydrate the tissue and eliminate as much as possible traces of 70% ethanol in which the helminths were preserved. To perform this washing step, a portion of the tissue was placed in a tube containing 1,000 μL of PBS (1X) for 40 minutes. Total genomic DNA was extracted following the method described by López et al. (Reference López, Clemente, Almeida, Brito and Hernández2015). The quantity and quality of the genomic DNA were checked using a DeNovix DS-11 + spectrophotometer (DeNovix Inc., Wilmington, DE, USA).
DNA was amplified for partial 28S nuclear rDNA (28S rDNA) (domains 1–3; ~1,500 bp). The 28S rDNA fragment was amplified using the primers XZ-1 (5′ ACCCGCTGAATTTAAGCATAT 3′) (Waeschenbach et al. Reference Waeschenbach, Webster, Bray and Littlewood2007) and 1500R (5′ GCTATCCTGAGGGAAACTTCG 3′) (Littlewood et al. Reference Littlewood, Waeschenbach and Nikolov2008). The PCR amplification contained 1X Buffer (VWR), 0.2 mM of each dNTP (VWR), 1.5 mM MgCl2 (VWR), 20–40 ng of total genomic DNA in a total volume of 50 μL. The amplification was performed using an XP Cycler (Hangzhou Bioer Technology Co. Ltd., Hangzhou, China) under the following conditions: 95°C for 5 min; 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 2 min; and final extension at 72°C for 10 min (Littlewood et al. Reference Littlewood, Waeschenbach and Nikolov2008; Waeschenbach et al. Reference Waeschenbach, Webster, Bray and Littlewood2007). The resulting amplifications were visualized on 1.5% agarose gel at 90 V for 1 h. PCR products of the expected size (1,500 bp) were purified using the VWR ExoCleanUp FAST PCR reagent (VWR, USA) following the manufacturer’s protocol. The purified PCR products were sequenced by Macrogen Inc. (Madrid, Spain) using primers XZ-1 and 1500R (Littlewood et al. Reference Littlewood, Waeschenbach and Nikolov2008; Waeschenbach et al. Reference Waeschenbach, Webster, Bray and Littlewood2007).
The nucleotide sequences obtained were aligned using the multiple alignment program ClustalW included in MEGA 11 software (Tamura et al. Reference Tamura, Stecher and Kumar2021), and minor corrections were made by hand. Sequences were subsequently analyzed using the Basic Local Alignment Search Tool (BLAST), and their identities were confirmed via homology comparison. Phylogenetic relationship analyses based on the maximum likelihood method were carried out with the p distance and Kimura 2-parameter model (Tamura and Nei Reference Tamura and Nei1993), with 1,000 bootstrap replications, to explore the relationships among the species. The Hymenolepis diminuta (Rudolphi, 1819) HM138522 sequence was used as the outgroup. The analysis involved 27 nucleotide sequences. Data for the sequences included in the GenBank database are detailed in Table S1. A total of 871 positions were identified in the final alignment. Evolutionary analyses were conducted using the MEGA 11 software (Tamura et al. Reference Tamura, Stecher and Kumar2021).
Results
A total of 1,309 G. psammomi specimens were recovered from the intestinal tract of 57 of the 72 P. obesus studied. The prevalence was 79.17%, the mean intensity was 23.33, with a range of 1 to 132 worms, and an abundance of 18.47.
Description
Gerbillitaenia psammomi has 4 to 36 (16) acraspedote proglottids (Figure 2A,B). The length is 5.7–87.0 mm (35.9 mm). The maximum width, at the level of mature or pregravid proglottids, is 2.2–4.8 mm (3.3 mm). The strobilar anterior end is blunt (Figure 2A,B). No neck is present. The unarmed scolex measures 578–877 μm (715.8 μm) in width and has four rounded suckers with a maximum diameter of 206–288 μm (252.5 μm) (Figures 2A,B and 3A). The genital primordia appear in the first proglottids just after the scolex. The mature proglottids are wider than long. The first mature proglottid measures 751–1656 x 2019–4840 μm (1036.0 x 3212.0 μm). The genital pores are alternated regularly and located near the anterior end of the proglottid (Figures 2C and 3B). Mature proglottids contain a total of 221–414 testes (282) arranged in two lateral fields (Figures 2C and 3B); there are 98–202 poral testes (130) and 118–212 antiporal testes (152). The cirrus sac measures 141–444 x 54–83 μm (264.9 x 69.0 μm). In the middle of the proglottid, there is a dendritic ovary, highly ramified (Figures 2C,D and 3B). Both internal and external seminal vesicles are lacking. The thick-walled seminal receptacle is oval to elongated and measures 103–279 x 52–134 μm (185.9 x 81.8 μm) (Figures 2D,E and 3B). The vagina runs underneath and parallel to the vas deferens towards the genital pore (Figures 2D–F and 3B). The vitellarum is deeply lobulated, preequatorial and placed between the seminal receptacle and the ovary ramifications in the poral side of the proglottid (Figures 2C,D and 3B). Gravid proglottids are longer than wide, specially the last proglottid, which measures 2,640–6,212 x 1113–3209 μm (4057.8 x 2136.8 μm), and have 6–10 (8) primary uterine branches on each side of a long central uterine stem (Figures 2A,B and 3C,D). Eggs observed from several broken gravid proglottids are pyriform to fusiform and measure around 38.6 x 18.0 μm. The oncosphere measures around 15.4 x 10.3 μm (Figure 2G,H).
Gerbillitaenia psammomi stained with Semichon’s acetic carmine (A–F) and eggs observed from a broken gravid proglottid (G,H). A,B: Two specimens with seven and six proglottids, respectively. Bar 1 mm. C: Detail of anterior end showing mature and pregravid proglottids. Bar 500 μm. D–F: Some details of genitalia. Bar 300 μm. G,H: Eggs. Bar 20 μm. C, cirrus; CS, cirrus sac; GP, genital pore; O, ovary; S, suckers; SR, seminal receptacle; T, testes; U, uterus; V, vagina; VD, vas deferens; Vi, vitellarium.
Gerbillitaenia psammomi. A: Scolex. B: Mature proglottid. Only a small part of the number of testes are shown, although the diagram represents the area they occupy. C: First gravid proglottid. D: Last gravid proglottid. CS, cirrus sac; O, ovary; SR, seminal receptacle; T, testes; U, uterus; V, vagina; VD, vas deferens; Vi, vitellarium.
The observed differences, especially in terms of the body length and number of proglottids, are clearly linked to the worm burden (crowding effect). Thus, hosts with a parasite burden of 1 to 6 had greater cestodes (up to 87.0 mm long; up to 36 proglottids). In contrast, hosts with the highest parasite intensity had smaller cestodes (5.7–10.8 mm long and having 4–6 proglottids).
Parasite burden: A crowding effect
Using data on 25 infected fat sand rats, we found that the number of tapeworms per host varied between 1 and 118. Size measurements were taken in a sample of 72 tapeworms, with the number of tapeworms sampled per rat ranging from 1 (single infection) to 9. Tapeworm length ranged from 5,694 to 87,000 μm (n = 72, mean ± SD = 35,860 ± 23,741 μm), and the number of proglottids per tapeworm ranged from 4 to 36 (mean ± SD = 16 ± 9).
Results of LMMs revealed highly significant negative relationships of tapeworm abundance with both tapeworm length (β ± SE = -0.504 ± 0.058, t46 = -8.640, P < 0.001; Figure 4) and the number of proglottids (β ± SE = -0.395 ± 0.041, t46 = -9.570, P < 0.001; Figure 4), suggesting a significant crowding effect.
Abundance-size relationships for Gerbillitaenia psammomi infecting Psammomys obesus. The regression lines were estimated from GLMMs accounting for host identity as a random factor.
Molecular analysis and phylogenetic tree
For G. psammomi, six amplifications of partial 28S rDNA were obtained, with an expected size of 1,500 bp. Three fragments of 762 bp were successfully sequenced and submitted to the GenBank database (accession numbers PP291541, PP291542 and PP291543). Sequences showed 93%, 93%, and 99% query coverage values, and 89.34%, 90.36%, and 90.78% identity with M. numida (MG050043). For S. oranensis, one amplification of partial 28S rDNA was obtained, with an expected size of 1,500 bp. A fragment of 748 bp were successfully sequenced and submitted to the GenBank database with accession number PP780195. The sequence showed a 100% query coverage value and 99.60% identity with M. numida (MG050043). The results of the BLAST analysis are presented in Table S2.
Phylogenetic analysis of the partial 28S rDNA sequences obtained for S. oranensis and G. psammomi in this study compared with those available in the GenBank database of other species of the family Catenotaeniidae Spassky, 1950 showed that both species are clearly grouped in a clade with the other species of the Skrjabinotaeniinae Genov and Tenora, 1979 and separated from the Catenotaeniinae Spassky, 1949 clade (Figure 5).
Phylogenetic analysis was performed using the maximum likelihood method with p distance and 1,000 bootstrap replications based on partial 28S rDNA sequence. The tree was drawn to scale, and branch lengths were measured based on the number of substitutions per site. The proportion of sites in which at least one unambiguous base was present in at least one sequence for each descendant clade is shown next to each internal node in the tree. Sequences obtained in this study are shown in bold and framed in a purple box for Gerbillitaenia psammomi and in a blue box for Skrjabinotaenia oranensis. Hymenolepis diminuta HM138522 was used as the outgroup. *proposed as Skrjabinotaenia indica (Parihar and Nama, 1977) n. comb. by Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018); **considered as a junior synonym of S. oranensis by Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018); +Haukisalmi and Elmahy (Reference Haukisalmi and Elmahy2025) considered Meggittina as a subgenus of Skrjabinotaenia; ++Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018) restored the combination Spasskijela lobata (Baer, 1925).
The DNA isolated from G. psammomi and S. oranenis in this study is located in the DNA collection stored at the Canary Islands University Institute of Tropical Diseases and Public Health (IUETSPC) of the University of La Laguna (ULL). This material was stored at -20°C with codes SKORA1, SKORA2, and SKORA5 for G. psammomi and SKORA7 for S. oranensis.
Discussion
Over time, there has been some confusion concerning the Skrjabinotaenia parasites of North African gerbillines, particularly S. oranensis, arising from the erroneous redescription of this species by Joyeux et al. (Reference Joyeux, Baer and Gaud1951) with specimens found in M. shawi from Morocco. The latter shows important discrepancies when compared to the original description of the species by Joyeux and Foley (Reference Joyeux and Foley1930), particularly concerning the blunt shape of the anterior end of the strobila, the absence of an antero-poral ovarian lobe, and the morphology of the uterus in gravid proglottids, presenting a long central stem with a higher number of primary lateral branches. Furthermore, Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018) postulated the possible synonymy of S. oranensis sensu Joyeux et al. (Reference Joyeux, Baer and Gaud1951) with S. psammomi, really G. psammomi (Haukisalmi and Elmahy Reference Haukisalmi and Elmahy2025).
In the present study, it can be observed that the morphological characteristics of G. psammomi found in P. obesus from Tunisia are quite similar to those observed both by Joyeux et al. (Reference Joyeux, Baer and Gaud1951) in specimens found in Shaw’s jirds from Morocco, and by Mikhail and Fahmy (Reference Mikhail and Fahmy1968), Elmahy (Reference Elmahy2012) and Haukisalmi and Elmahy (Reference Haukisalmi and Elmahy2025) in specimens parasitizing fat sand rats from Egypt. In particular, the shape of strobila and the blunt morphology of the anterior end, the regular alternation of genital pores, the number of testes, the absence of the antero-poral ovarian lobe and the number of primary uterine branches are coincident characteristics (see Table 1).
Comparative data of Gerbillitaenia psammomi from North African Gerbillinae rodents
1 data from Joyeux et al. (Reference Joyeux, Baer and Gaud1951)
2 data from Lynsdale (Reference Lynsdale1953)
3 data from Haukisalmi and Elmahy (Reference Haukisalmi and Elmahy2025)
4 data from Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018)
5 data from Elmahy (Reference Elmahy2012)
* testes in the first mature proglottid
** testes in the second mature proglottid
+ ratio for first mature proglottid
++ ratio for last gravid proglottid
? doubtful data
However, the morphological features of cestodes parasitizing P. obesus from Egypt identified as S. oranensis by Wolfgang (Reference Wolfgang1956) show the main characteristics found in G. psammomi found in the present study. In fact, Wolfgang (Reference Wolfgang1956) already manifested clearly in its paper that these cestodes found in fat sand rats from Egypt look more like the specimens of Joyeux et al. (Reference Joyeux, Baer and Gaud1951) than those of the original description by Joyeux and Foley (Reference Joyeux and Foley1930). Thus, we agree with Haukisalmy and Elmahy (2025) considering all these findings belonging to G. psammomi.
We can conclude that, to date, G. psammomi has been found in two gerbilline hosts (P. obesus and M. shawi) with a geographical distribution including Egypt, Morocco, and Tunisia.
In the present study, a negative density-dependent growth (crowding effect) was observed in G. psammomi parasites of P. obesus from Tunisia. Crowding effect showed the smaller cestodes in hosts with a high parasite burden, whereas hosts with a reduced number of parasites presented the greater cestodes. Thus, the crowding effect could explain the variability in the body length of G. psammomi according to different findings of the species (see Table 1). However, unfortunately, the worm burden in previous studies is unknown.
In this sense, the original description of S. psammomi by Mikhail and Fahmy (Reference Mikhail and Fahmy1968) reveals a discrepancy concerning body length. Nevertheless, in our opinion, this is probably a mistake since it cannot be assumed that specimens 125–320 mm long have only 10–17 proglottids. Unfortunately, the original material was not accessible. Concerning specimens of Joyeux et al. (Reference Joyeux, Baer and Gaud1951), a similar situation occurs; the authors described tapeworms 60–80 mm long having only 5–6 proglottids. In this context, Lynsdale (Reference Lynsdale1953), on the occasion of the description of the genus Meggittina Lynsdale, 1953, wrote the following paragraph: ‘The length of C. oranensis, stated to be 60 mm by Joyeux and Foley (Reference Joyeux and Foley1930) and 60–80 mm by Joyeux, Baer and Gaud (Reference Joyeux, Baer and Gaud1951) appeared to the writer to be excessive for worms consisting of so limited a number of segments, particularly as those segments are not abnormally long; on enquiring of Professor Baer, he confirmed that these measurements were incorrect and suggested that the writer should make a statement to this effect. It is therefore recorded here that the length of C. oranensis as measured from the co-type is approximately 16 mm and not 60–80 mm as stated by the previous authors’.
Crowding effect has already been previously documented by several authors in other cestode species, particularly hymenolepidids (Fichet-Calvet et al. Reference Fichet-Calvet, Wang, Jomâa, Ben Ismail and Ashford2003; Ghazal and Avery Reference Ghazal and Avery1974; Jones and Tan Reference Jones and Tan1971; Read Reference Read1951). For example, Fichet-Calvet et al. (Reference Fichet-Calvet, Wang, Jomâa, Ben Ismail and Ashford2003) described a crowding effect in the davaineid cestode Raillietina trapezoides (Janicki, 1904) parasitizing naturally infected fat sand rats from Tunisia.
The phylogenetic tree based on the sequences of 28S rDNA showed two different clades grouping species of the two recognized subfamilies of catenotaeniids: Skrjabinotaeniinae and Catenotaeniinae. Both species found in the present study (S. oranensis and G. psammomi) were clearly grouped in the clade of skrjabinotaeniines with other species of the genera Skrjabinotaenia and Meggittina. Notably, the genetic divergence between our S. oranensis and G. psammomi sequences was substantial enough to support their classification as distinct species, corroborating previous morphological distinctions. Maximum likelihood analyses further reinforced this separation, with strong nodal support (posterior probability >0.95; bootstrap >90%). The observed genetic divergence also supports the creation of the new genus Gerbillitaenia by Haukisalmi and Elmahy (Reference Haukisalmi and Elmahy2025).
Haukisalmi et al. (Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018), after the morphological analysis of both S. oranensis and M. numida, postulated that M. numida should be considered a junior synonym of S. oranensis. Our molecular results confirmed this synonymy (see Figure 5 and Table S2). The tree obtained in the present study showed that all sequences of the species of genera Skrjabinotaenia, Meggittina, and Gerbillitaenia were found within a single clade, confirming the monophyly of the subfamily Skrjabinotaeniinae previously postulated by other authors. Therefore, Haukisalmi et al. (Reference Haukisalmi, Hardman and Henttonen2010, Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018), using nucleotide sequences of partial 28S rDNA and mitochondrial 12S-16S DNA genes, obtained phylogenetic results showing that the subfamily Skrjabinotaeniinae, including the genera Skrjabinotaenia and Meggittina, is monophyletic. Moreover, within the Skrjabinotaeniinae, the genus Skrjabinotaenia is showed as a non-monophyletic assemblage and should be split into several new genera (see Haukisalmi and Elmahy Reference Haukisalmi and Elmahy2025). Thereby, the latter authors considered the nominal subgenus Skrjabinotaenia, including S. (S.) oranensis, and the subgenus Meggittina, including S. (M.) baeri (Lynsdale, 1953), and two other species, S. (M.) cricetomydis Hockley, 1961 and S. (M.) gerbilli (Wertheim, 1954). Additionally, they erected a new genus, Gerbillitaenia including G. psammomi.
Haukisalmi et al. (Reference Haukisalmi, Hardman and Henttonen2010, Reference Haukisalmi, Ribas, Junker, Spickett, Matthee, Henttonen, Jrijer, Halajian, Anders and Nakao2018) have identified that the subfamily Catenotaeniinae exhibits a non-monophyletic pattern, as demonstrated by Catenotaenia pusilla (Goeze, 1782), which shows a closer phylogenetic relationship to species within Skrjabinotaeniinae than to other members of its own subfamily. Our findings further corroborate the paraphyletic nature of Catenotaeniinae, thereby reinforcing skepticism regarding the current delineation of the subfamily. The phylogenetic position of C. pusilla may be indicative of an ancestral hybridization event or convergent evolution driven by host-specific adaptations. These hypotheses warrant further investigation, ideally through the use of expanded genomic datasets, such as mitogenomes or ultraconserved elements.
Supplementary material
The supplementary material for this article can be found at http://doi.org/10.1017/S0022149X25000410.
Acknowledgements
The authors wish to thank Mr. Hédi Boubakri for his valuable help during fieldwork. The authors also thank Dr. Katherine García-Livia and Edgar Baz-González for their help in the phylogenetic tree preparation. JM is a member of the 2021-SGR-00359 research group.
Financial support
This research received no external funding.
Competing interests
The authors declare that they have no conflict of interest.
Ethical standard
Gerbils were trapped under the permission of the ‘Direction Générale des Forêts (Ministère de l’Agriculture, des Resources Hydrauliques et de la Pêche Maritime)’ of Tunisia, references nos. 1822/2023 and 1728/2024. Animal work was approved in accordance with the Spanish Government Laws 42/2007 and RD 630/2013.
