Hostname: page-component-74656f9884-skzmx Total loading time: 0 Render date: 2026-11-04T15:17:28.926Z Has data issue: false hasContentIssue false
  • English
  • Français

Characterization of the fragmented mitogenome of the European badger louse Trichodectes melis reveals conserved organization in non-coding regions

Published online by Cambridge University Press:  28 September 2026

Marco V. Ponce ,
José M. Rico-Porras ,
Ilies Real-Fuzeta ,
Pablo Mora ,
Barbara Moroni ,
Ettore Napoli Open the ORCID record for Ettore Napoli [Opens in a new window] ,
Giovanni Sgroi ,
Carlos Martínez-Carrasco Pleite Open the ORCID record for Carlos Martínez-Carrasco Pleite [Opens in a new window]  and
Antonio Sánchez Baca Open the ORCID record for Antonio Sánchez Baca [Opens in a new window]
Marco V. Ponce
Affiliation:
Departamento de Biología Experimental, Universidad de Jaén, Jaén, Spain
José M. Rico-Porras
Affiliation:
Departamento de Biología Experimental, Universidad de Jaén, Jaén, Spain
Ilies Real-Fuzeta
Affiliation:
Departamento de Biología Experimental, Universidad de Jaén, Jaén, Spain
Pablo Mora
Affiliation:
Departamento de Biología Experimental, Universidad de Jaén, Jaén, Spain
Barbara Moroni
Affiliation:
Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, Turin, Italy
Ettore Napoli
Affiliation:
Dipartimento di Scienze Veterinarie, Università Degli Studi di Messina , Messina, Italy
Giovanni Sgroi
Affiliation:
Istituto Zooprofilattico Sperimentale del Mezzogiorno, Portici, (Napoli) Italy Department of Sciences and Technologies, University of Sannio, Benevento, Italy
Carlos Martínez-Carrasco Pleite
Affiliation:
Departamento de Sanidad Animal, Campus de Excelencia Internacional Regional “Campus Mare Nostrum”, Universidad de Murcia , Murcia, Spain
Antonio Sánchez Baca*
Affiliation:
Departamento de Biología Experimental, Universidad de Jaén, Jaén, Spain
*
Corresponding author: Antonio Sánchez Baca; Email: abaca@ujaen.es
Rights & Permissions [Opens in a new window]

Abstract

Content of image described in text.

Mitochondrial genome fragmentation is widespread in lice but remains poorly understood, with molecular data still scarce for many ectoparasitic species, particularly those associated with wild hosts. Here, we characterize the complete mitochondrial genome of Trichodectes melis, a chewing louse parasitizing the European badger (Meles meles). By combining Illumina® sequencing with PCR amplification, followed by cloning and Sanger sequencing, we assembled and annotated the fragmented mitogenome of T. melis, which comprises 13 circular minichromosomes. Together, these molecules encode the canonical set of 37 mitochondrial genes (13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs). Gene content and organization are highly conserved relative to Trichodectes canis, although differences were observed among other Trichodectidae species. The high A + T content observed in both coding and non-coding regions is consistent with that of related species, except in the genus Bovicola, which exhibits comparatively lower values. Notably, the non-coding regions of the minichromosomes displayed substantial intra-individual heteroplasmy in both length and nucleotide composition. Despite this variability, these regions exhibited a conserved structural architecture comprising 3 conserved sequence blocks, microsatellite motifs and tandem repeats, suggesting an important functional role in mitochondrial replication and transcription. Phylogenetic analyses based on concatenated protein-coding genes and cox1 sequences recovered T. melis as the sister species of T. canis and supported the monophyly of the genus Trichodectes. These findings provide the first mitogenomic characterization of T. melis and contribute to a better understanding of mitochondrial genome evolution in insects with fragmented mitogenomes.

Keywords

mitochondrial genomemitogenomenon-coding regionTichodectes melisTrichodectidae

Information

Type
Research Article
Information
Parasitology , First View , pp. 1 - 11
Check for updates
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© The Author(s), 2026. Published by Cambridge University Press.

Introduction

In eukaryotic organisms, the mitochondrial genome (mitogenome) is usually a single circular chromosome, with considerable size variation, a highly conserved gene content containing 37 genes (13 protein-coding genes (PCGs), 22 tRNAs, 2 rRNAs) and a non-coding region (Cameron, Reference Cameron2014). However, exceptions occur with species presenting linear mitogenomes (Kayal and Lavrov, Reference Kayal and Lavrov2025) and fragmented mitogenomes (Najer et al., Reference Najer, Doña, Buček, Sweet, Sychra and Johnson2024). Linear mitogenomes have been described across a wide range of organisms, including cnidarians (Medusozoa) (Stampar et al., Reference Stampar, Broe, Macrander, Reitzel, Brugler and Daly2019), protists (Alveolata) (Gagat et al., Reference Gagat, Mackiewicz and Mackiewicz2017) and plants (Li and Sheng, Reference Li and Sheng2025). Fragmented mitogenomes have been reported for a variety of organisms, in plants (Yu et al., Reference Yu, Sun, Zhong, Liu, Sanchez-puerta, Mower and Zhou2022) and in animals, including cnidarians (Yahalomi et al., Reference Yahalomi, Haddas-sasson, Rubinstein, Feldstein, Diamant and Huchon2017), nematodes (Gibson et al., Reference Gibson, Blok and Dowton2007), thrips (Dickey et al., Reference Dickey, Kumar, Morgan, Jara-cavieres, Rg, McKenzie and Osborne2015) and lice (Najer et al., Reference Najer, Doña, Buček, Sweet, Sychra and Johnson2024).

Parasitic lice, traditionally classified in the order Phthiraptera, are now included within the order Psocodea (specifically in the suborder Troctomorpha) as an infraorder (De Moya et al., Reference De Moya, Yoshizawa, Walden, Sweet, Dietrich and Kevin2021; Gustafsson et al., Reference Gustafsson, Allen, Bell, Bush, Durden, Johnson, Light and Weckstein2025). Species of this infraorder are obligate ectoparasites living on both birds and mammals (Durden and Musser, Reference Durden and Musser1994; Clayton et al., Reference Clayton, Hellenthal, Johnson, Palma and Price2003; De Moya et al., Reference De Moya, Yoshizawa, Walden, Sweet, Dietrich and Kevin2021). Lice are classified either as chewing lice, which are included in 4 parvorders (Amblycera, Ischnocera, Rhynchophthirina and Trichodectera), or sucking lice included in the parvorder Anoplura (De Moya et al., Reference De Moya, Yoshizawa, Walden, Sweet, Dietrich and Kevin2021). Many species of Phthiraptera have mitogenomes fragmented into multiple circular chromosomes, and the number of minicircles varies among species, ranging from 2 to 20 (Shao et al., Reference Shao, Li, Barker and Song2017; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021). Fragmented mitochondrial genomes have been found in several Anoplura species and in species from all parvorders of chewing lice (Dong et al., Reference Dong, Jelocnik, Gillett, Valenza, Conroy, Potvin and Shao2023; Najer et al., Reference Najer, Doña, Buček, Sweet, Sychra and Johnson2024). In lice, mitochondrial fragmentation is highly phylogenetically conserved, whereas in other groups mitogenome structure varies dramatically, with some species having a single mitochondrial chromosome while others have highly fragmented mitogenomes (Najer et al., Reference Najer, Doña, Buček, Sweet, Sychra and Johnson2024). In addition, multiple independent origins of mitogenome fragmentation have been demonstrated in some lice groups (Sweet et al., Reference Sweet, Johnson and Cameron2022; Dong et al., Reference Dong, Jelocnik, Gillett, Valenza, Conroy, Potvin and Shao2023; Najer et al., Reference Najer, Doña, Buček, Sweet, Sychra and Johnson2024).

The family Trichodectidae (infraorder: Phthiraptera) includes 382 lice species that parasitize mammals (Clayton et al., Reference Clayton, Hellenthal, Johnson, Palma and Price2003). The genus Trichodectes includes 3 subgenera (Paratrichodectes, Stachiella and Trichodectes) and 24 species (Lyal, Reference Lyal1985; Johnson K.P., Smith V.S. (2013) Psocodea species file online. Version 5.0, https://bugguide.net/node/view/370488). The subgenus Trichodectes includes 8 species (Lyal, Reference Lyal1985), one of which is Trichodectes melis (Fabricius, 1805), a species of chewing louse commonly associated with the mesocarnivore European badger (Meles meles). The geographical range of this mustelid covers the whole of Europe, apart from Northern Scandinavia and a large part of Asia. Despite this, the presence and prevalence of T. melis are not fully understood, with records in Spain (Pérez-jiménez et al., Reference Pérez-jiménez, Soler-cruz, Benítez-rodríguez, Ruiz-martínez, Díaz-lópez, Palomares-fernández and Delibes-de Castro1990; Dominguez-Panafiel et al., Reference Dominguez-Panafiel, Gimenez-Pardo, Gegundez and Lledo2011), the UK (Cox et al., Reference Cox, Steward and MacDonald1999), Hungary (Rekasi, Reference Rekasi1994), Poland (Kozina et al., Reference Kozina, Gólcz and Izdebska2014) and Turkey (Taşçı et al., Reference Taşçı, Erkılıç, Aydın N and Uzlu2017).

To date, complete or nearly complete mitochondrial genome data have been deposited in public databases for around 80 species of Phthiraptera (GenBank, 21 July 2026), an order that encompasses roughly 5000 species (Kim, Reference Kim1988; Price et al., Reference Price, Hellenthal, Palma, Price, Hellenthal, Palma, Johnson and Clayton2003; Gong et al., Reference Gong, Xu, Xu, Liang, Tian, Cai, Li and Song2022). In the same way, despite Trichodectidae encompassing more than 380 species across approximately 20 genera, only 5 complete mitogenomes have been reported for this family to date. These correspond to the complete mitochondrial genomes of Trichodectes canis, Geomydoecus aurei and 3 species of the genus Bovicola (B. bovis, B. caprae and B. ovis) have been sequenced. All of these species possess fragmented mitogenomes that exhibit variations in the number of minichromosomes, as well as differences in minichromosome length, A + T content and gene composition. Regarding the genus Trichodectes, limited molecular data are available in GenBank, most of which are partial mitogenome sequences. In the case of T. canis, 13 of the records correspond to the minichromosomes of the complete fragmented mitogenome (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019) and represent the only mitogenome available from this genus. Concerning T. melis, no molecular data are currently available in GenBank. In this context, each newly published complete mitochondrial genome, whether within Trichodectidae or across Phthiraptera as a whole, is of great value, as it could provide key insights into how and why mitochondrial genomes were fragmented. Therefore, the main objective of this study is to characterize the complete mitochondrial genome of T. melis and compare it with those of the 5 Trichodectidae species sequenced to date, to confirm whether its mitogenome is fragmented, as observed in all other trichodectids described so far. Additionally, evaluate the utility of the mitogenome data for resolving phylogenetic relationships among genera within Trichodectidae (such as Geomydoecus and Bovicola), as well as its evolutionary placement within the broader context of Phthiraptera.

Materials and methods

Specimens of Trichodectidae lice were collected from European badger carcasses originating from southeastern Spain (Murcia). All recovered lice were morphologically identified as T. melis according to the dichotomous keys by Pérez-Jiménez et al. (Reference Pérez-jiménez, Soler-cruz, Benítez-rodríguez, Ruiz-martínez, Díaz-lópez, Palomares-fernández and Delibes-de Castro1990) and Kozina et al. (Reference Kozina, Gólcz and Izdebska2014). The lice were preserved in absolute ethanol and stored at −20 °C.

The total genomic DNA of a small fragment from one T. melis specimen was amplified with the GenomePlex® Single Cell Whole Genome Amplification Kit (WGA4) and sequenced using Illumina® technology.

Approximately 5 Gb of paired-end reads were obtained using the Illumina® NovaSeq platform. Raw reads were quality-trimmed with Trimmomatic v.0.36 (Bolger et al., Reference Bolger, Lohse and Usadel2014); sequencing and genome amplification adapters were also removed using the same software. A subset of 1.8 million clean reads was used for mitogenome assembly with NOVOplasty v.4.3.5 (Dierckxsens et al., Reference Dierckxsens, Mardulyn and Smits2017), using the 13 minichromosomes of the T. canis mitogenome (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019) as a reference. The NOVOplasty assembly did not permit a clear determination of the non-coding regions of the minichromosomes. To obtain the non-coding region of each assembled minichromosome, specific PCR primers were designed from conserved flanking coding regions from assembled minichromosomes of T. melis and minichromosomes of T. canis (Table 1). PCR amplicons were resolved in ethidium bromide-stained 1% agarose gels; then, the appropriate bands were isolated using the QIAquick Gel Extraction Kit (Qiagen) and cloned into Escherichia coli JM109 competent cells using the pGEM-T Easy vector (Promega). Two positive clones were sequenced in both directions. Sequences were analysed using the BioEdit software (version 7.0.9.0) (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).

Table 1.

Primers for the specific PCR amplification of non-coding regions of the 13 minichromosomes of the T. melis mitogenome

Primer sequences used for PCR amplification of the non-coding regions of the 13 Trichodectes melis mitochondrial minichromosomes. Forward and reverse primer names and nucleotide sequences are provided. See long description.
Table 1 Long description

Four columns list primer names and primer sequences for forward and reverse primers. Each row gives one minichromosome primer pair, from Mini1 through Mini13, with a forward primer name, a reverse primer name, a forward primer sequence, and a reverse primer sequence. Mini1-atp6-F pairs with Mini1-Leu-R, with sequences ATATCACTATATTGAAAAGAAT and CAAGGCACTAATCTGCCATCT. Mini2-Ser-F pairs with Mini2-Glu-R, with sequences TGATTAGTGGCACTTACACCCT and TCTATCCCACGAAAAAGGATTGT. Mini3-cox1-F pairs with Mini3-Ile-R, with sequences CCTGCTAACCATTCTAATTATT and GCATCTCTATTACATCAAAATA. Mini4-nad4L-F pairs with Mini4-cox2-R, with sequences AATCTGAATCAGTTAACTCTAT and CATGTTTAAAGAGTTTCAATTA. Mini5-cox3-F pairs with Mini5-Leu-R, with sequences TGACACTTTGTTGATGTGGTGTG and TCAAGGCACTAATCTGCCATCT. Mini6-Gln-F pairs with Mini6-Trp-R, with sequences GTGATTCACATCGTATTTTGAT and GTAATTTTACCTTTGAACGGTA. Mini7-Cys-F pairs with Mini7-Asn-R, with sequences ATTCGATATTCTAACATATGAT and TCTACCATTAACAGTGGATTGT. Mini8-Ser-F pairs with Mini8-Lys-R, with sequences AACCCAGGTCTTAAATGACCGA and TCAAGGCACTAATCTGCCATC. Mini9-nad5-F pairs with Mini9-Asp-R, with sequences CATCATTTAAACTATTAATTCT and ATTACCTCAGAATTCAAAGAAT. Mini10-nad6-F pairs with Mini10-Met-R, with sequences ACATTCTCGGCATCGAGTGG and TGGCTGTAACATAGCCTCTGA. Mini11 12S-F pairs with Mini11 12S-R, with sequences CTGGTAAGTCGTAACAAAGTTA and TTCTCACTATCAACTAGAATAT. Mini12-Val-F pairs with Mini12-His-R, with sequences CTAGTTTACACCTAGAAAATCT and TGCACCACAAGCAAACATTCT. Mini13-Pro-F pairs with Mini13-Tyr-R, with sequences AAACAATAGCTTTGGGAGCTG and TACAGCACAGTGTTTAAACTTA.

Both NOVOplasty assemblies and PCR sequencing data enabled the recovery of the complete sequences of the 13 minichromosomes composing the T. melis mitogenome. The resulting minichromosomes were annotated using MITOS (http://mitos.bioinf.uni-leipzig.de) (Bernt et al., Reference Bernt, Donath, Jühling, Externbrink, Florentz, Fritzsch, Pütz, Middendorf and Stadler2013) and tRNAscan-SE (http://lowelab.ucsc.edu/tRNAscan-SE) (Lowe and Eddy, Reference Lowe and Eddy1997) followed by manual curation through comparison with the minichromosomes of T. canis, using the Geneious® v11.1.5 software (Kearse et al., Reference Kearse, Moir, Wilson, Stones-havas, Cheung, Sturrock, Buxton, Cooper, Markowitz, Duran, Thierer, Ashton, Meintjes and Drummond2012). Circular representations of each minichromosome were plotted using the OrganellarGenomeDRAW tool (https://chlorobox.mpimp-golm.mpg.de/OGDraw.html) (Greiner et al., Reference Greiner, Lehwark and Bock2019).

For the phylogenetic analysis, 2 datasets were used: the concatenated sequences of the 13 PCGs and the cox1 gene. The selected species for the phylogenetic analysis using concatenated sequences of the 13 PCGs was constrained by the availability of complete mitochondrial genomes in GenBank. For this analysis, we used data of T. melis, 5 Trichodectera species (all the available mitogenomes of this family) and 13 species of representative taxa from the principal families of Anoplura (in most cases, all the available of the families) (Supplementary Table S1). In the phylogenetic analysis with cox1, we expanded the number of species included and used data of T. melis and 30 mammalian lice species from the parvorders Trichodectera (7, all available), Anoplura (22, representatives of 8 families) and Rhynchophthirina (1, the only available) (Supplementary Table S2). As an outgroup, 2 avian lice species, Columbicola passerinae and Falcolipeurus suturalis, were used. Sequences were aligned using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) (Sievers and Higgins, Reference Sievers, Higgins and Katoh2021); subsequently, poorly aligned positions and divergent regions were removed using Gblocks v.0.91.1 (https://ngphylogeny.fr/tools/tool/276/form) (Talavera and Castresana, Reference Talavera and Castresana2007). Phylogenetic trees were inferred via Maximum Likelihood using MEGA v.12.1 (Kumar et al., Reference Kumar, Stecher, Suleski, Sanderford, Sharma and Tamura2024). Node support was assessed with 1000 bootstrap replicates. The best-fit nucleotide substitution model was selected based on the lowest Bayesian Information Criterion value using MEGA v.12.1.

Results

General mitogenome minichromosomes features

The sequences assembled via NOVOplasty, along with the non-coding regions amplified by PCR and sequenced, enabled the complete reconstruction of the 13 minichromosomes constituting the fragmented mitogenome of T. melis (Table 2; Figure 1) (GenBank accession numbers: PZ051291–PZ051316). The total size of this mitogenome ranges from 20 025 to 20 071 bp, with individual minichromosome sizes varying from 809 to 812 bp for minichromosome 13 (trn-Tyr-trn-Pro) to 2076–2077 bp for minichromosome 9 (trn-Asp-nad5). The A + T content of the T. melis minichromosomes was high on average (70.3%), varying between 67.2% in minichromosome 3 (trn-Ile-cox1) and 72.7% in minichromosome 13 (trn-Tyr-trn-Pro).

Table 2.

General data of the 13 minichromosomes of the T. melis mitogenome

General characteristics of the 13 Trichodectes melis mitochondrial minichromosomes, including minichromosome size, encoded genes, gene and protein lengths, strand, anticodons, and start and stop codons. See long description.
Table 2 Long description

Minichromosomes are listed with their total size in base pairs, followed by each gene or sequence name, size in base pairs, size in amino acids when given, strand, anticodon for transfer RNAs, and start and stop codons for protein coding genes. Minichromosome 1 is 1,357 bp and includes trn Leu1, atp8, atp6, and a non coding region of 362 bp; atp8 is 240 bp and 79 aa with start codon ATG and stop codon TAA, and atp6 is 684 bp and 227 aa with start codon ATA and stop codon TAA. Minichromosome 2 is 1,650 to 1,652 bp and includes trn Glu, cob, trn Ser1, and a non coding region of 423 to 425 bp; cob is 1,097 bp and 365 aa with start codon ATG and stop codon TA. Minichromosome 3 is 1,989 to 1,995 bp and includes trn Ile, cox1, and a non coding region of 389 to 395 bp; cox1 is 1,530 bp and 509 aa with start codon ATT and stop codon TAG. Minichromosome 4 is 1,518 to 1,521 bp and includes cox2, trn Arg, nad4L, and a non coding region of 482 to 485 bp; cox2 is 678 bp and 225 aa with start codon GTG and stop codon TAG, and nad4L is 288 bp and 95 aa with start codon ATT and stop codon TAA. Minichromosome 5 is 1,290 to 1,298 bp and includes trn Leu2, cox3, and a non coding region of 426 to 434 bp; cox3 is 798 bp and 265 aa with start codon ATT and stop codon TAA. Minichromosome 6 is 1,428 to 1,432 bp and includes trn Trp, nad1, trn Gln, and a non coding region of 413 to 419 bp; nad1 is 883 bp and 294 aa with start codon ATT and stop codon T. Minichromosome 7 is 1,595 bp and includes trn Asn, nad2, trn Cys, and a non coding region of 418 bp; nad2 is 1,023 bp and 340 aa with start codon TTG and stop codon TAG. Minichromosome 8 is 1,910 to 1,912 bp and includes trn Lys, nad4, trn Ala, trn Ser2, and a non coding region of 389 to 391 bp; nad4 is 1,317 bp and 438 aa with start codon ATT and stop codon TAA. Minichromosome 9 is 2,076 to 2,077 bp and includes trn Asp, nad5, and a non coding region of 418 to 419 bp; nad5 is 1,590 bp and 529 aa with start codon ATT and stop codon TAA. Minichromosome 10 is 1,559 to 1,563 bp and includes trn Met, trn Gly, nad3, trn Phe, nad6, trn Thr, and a non coding region of 427 to 431 bp; nad3 is 345 bp and 114 aa with start codon TTG and stop codon TAG, nad6 is 490 bp and 163 aa with start codon ATC and stop codon T, and trn Thr is on the L strand while the other listed strands in this minichromosome are H. Minichromosome 11 is 1,246 to 1,248 bp and includes rrnS of 786 bp and a non coding region of 460 to 462 bp. Minichromosome 12 is 1,598 to 1,609 bp and includes trn His, rrnL of 1,094 bp, trn Val, and a non coding region of 371 to 382 bp. Minichromosome 13 is 809 to 812 bp and includes trn Tyr, trn Pro, and a non coding region of 664 to 667 bp.

Figure 1.

Graphical map of the 13 minichromosomes of the Trichodectes melis mitogenome. Genes encoded on the heavy strand (H) are shown outside the circles, while those encoded on the light strand (L) are shown inside the circles.

Graphical map of 13 minichromosomes of a mitogenome with gene labels and color-coded regions. See long description.
Figure 1 Long description

Graphical representation of the 13 circular minichromosomes comprising the Trichodectes melis mitogenome. Each minichromosome shows its encoded genes and non-coding region. Genes encoded on the heavy strand are shown outside the circles and genes encoded on the light strand are shown inside. Together, the 13 minichromosomes contain the complete set of 37 mitochondrial genes.

Together, the 13 minichromosomes contain the 13 PCGs, the 22 tRNA genes and 2 rRNA genes that make up most vertebrate and invertebrate fragmented and non-fragmented mitogenomes (Lavrov and Pett, Reference Lavrov and Pett2016). Each minichromosome comprises a coding region and a non-coding region. Within the coding regions, 10 minichromosomes (1–10) include 1 or 2 PCGs and 1–4 tRNA genes; 2 (11 and 12) contain 1 rRNA gene and 0 or 2 tRNA genes; and minichromosome 13 includes only 2 tRNA genes (Table 2; Figure 1).

PCGs, rRNA and tRNA genes

The set of the 13 PCGs is encoded by 10 minichromosomes, varying from 1 to 2 genes per minichromosome, and the length varied between 240 bp for atp6 and 1590 bp for nad5 (Table 2). The average A + T content of the PCGs is 69.9%, ranging from 66.4% in cox1 to 73.5% in the nad6 gene.

Regarding start and stop codons, the PCGs of T. melis exhibit high variability in their start codons, using 6 different codons (ATG, ATA, ATT, GTG, TTG and ATC). The most frequent start codon is ATT, used in 6 genes (cox1, cox3, nad1, nad4, nad4L and nad5). The use of the canonical start codon ATG is restricted to atp8 and cob; the TTG codon is used in 2 genes (nad2 and nad3), while ATA, GTG and ATC are each used in a single gene (atp6, cox2 and nad6, respectively).

Regarding stop codons, T. melis uses 4 types: TAA, TAG and the incomplete codons TA- and T-. The use of TAA predominates, occurring in 6 genes (cox3, atp6, atp8, nad4, nad4L and nad5). TAG is used in 4 genes (cox1, cox2, nad2 and nad3), while the incomplete codon TA- is used in only 1 gene (cob), and T- is used in 2 (nad1 and nad6).

The 2 ribosomal RNA genes are located in 2 minichromosomes; rrnS is the only gene in minichromosome 11 with 786 bp and 69.8% A + T content, and rrnL is located between trn-His and trn-Val genes in minichromosome 12, with 1094 bp and 67.8% A + T content (Table 2, Figure 1).

All 22 canonical tRNA genes were identified in the mitogenome of T. melis, ranging from 63 to 70 bp in size (Table 2, Figure 1), with A + T content varying from 56.9 to 80.0%.

Non-coding regions

All minichromosomes of T. melis contained a non-coding region and exhibited a high A + T content (average 72.0%). Sequencing of 2 clones per minichromosome revealed intra-chromosomal variation in both size and nucleotide sequence (Table 2). The non-coding region ranged in size from 362 bp (minichromosome 1) to 667 bp (minichromosome 13), representing 19.6–82.1% of the total minichromosome length (average: 31.4%). Differences between clones reached up to 11 bp due to substitutions, insertions and deletions, frequently occurring at microsatellite sequences. Sequence identity between the 2 non-coding regions of each minichromosome varied from 85.3% (minichromosome 12) to 99.3% (minichromosome 7).

The mean sequence identity between all T. melis minichromosomes non-coding regions is 75.66% (range: 58.61–95.82%). Despite this variation, all non-coding regions share a conserved organization comprising 3 conserved sequence blocks (CSBs): CSB-1 (54 bp), CSB-2 (83 bp) and CSB-3 (64 bp); a sequence containing 2 microsatellite motifs; and a tandem repeat region with a 46 bp monomer (Figure 2A and B; Supplementary Figure S1). Table 3 summarizes the structural data of non-coding regions in T. melis. The number of monomer units in the tandem repeat region varied among minichromosomes: 1 in minichromosome 13; 2 in minichromosomes 1, 6–8 and 10–12; and 3 repeats in minichromosomes 2–5 and 9. The 3′-end of CSB-3 contains a poly-T tract (average: 16 Ts), which varies between 12 and 21 nucleotides depending on the minichromosome.

Figure 2.

(A) Organization of the sequences in the non-coding regions of the minichromosomes of the Trichodectes melis mitogenome. The 3 CSB-1–3 blocks, the microsatellite motifs and the tandem repeat are represented (3 monomer repetitions are represented); (B) consensus sequences of the 3 CSB-1–3 blocks and the tandem repeat.

The organization of non-coding regions in minichromosomes with sequence details. See long description.
Figure 2 Long description

Graphical representation of the organization of the non-coding regions of the 13 Trichodectes melis mitochondrial minichromosomes. The regions contain three conserved sequence blocks (CSB-1, CSB-2 and CSB-3), two microsatellite motifs and a tandem-repeat region. The consensus sequences of these conserved elements are shown in the second panel.

Table 3.

Domain characteristics of the non-coding regions of the mitochondrial minichromosomes of T. melis

Tandem repeat length varies most, from 46 to 1381 base pairs, while CSB domains show narrower length ranges and identities mostly above 75 percent. See long description.
Table 3 Long description

Domain characteristics of the non-coding regions of the mitochondrial minichromosomes of T. melis, including consensus length (bp), length variation, consensus A+T %, % identity average, and variation % identity of the non-coding region domains the three conserved sequence blocks (CSB-1, CSB-2 and CSB-3), two microsatellite motifs and a tandem-repeat region.

a Change in length that varies depending on the number of tandem repetitions present, from 1 to 3.

b There is no consensus sequence; this data is the mean percentage of A + T in this fragment of the non-coding regions of the minichromosomes. It should be noted that the average percentage of G is 26.36; since there is no C, only one is included in the total of fragments compared.

Phylogenetic analysis

The phylogenetic analysis of concatenated PCGs yielded a consensus tree topology revealing several well-supported groups (Figure 3). T. melis was identified as the sister species to T. canis, and the genus Trichodectes forms a monophyletic clade that is closely related to G. aurei. The clade comprising Trichodectes and Geomydoecus is linked to the genus Bovicola (B. bovis, B. caprae and B. ovis), all belonging to the family Trichodectidae.

Figure 3.

Phylogenetic tree inferred with the Maximum Likelihood method using concatenated PCG gene sequences of the mitogenome of Trichodectes melis and 20 other louse species. The data at the nodes correspond to Bootstrap supports from 1000 replicates and represent the statistical support. The tree was performed using the nucleotide substitution model GTR + G + I.

A phylogenetic tree showing relationships among various louse species. See long description.
Figure 3 Long description

Maximum-likelihood phylogenetic tree based on complete mitogenomes and concatenated protein-coding genes from the mitochondrial genomes of Trichodectes melis and other lice species. T. melis is recovered as the sister species of T. canis and Trichodectes forms a monophyletic group. Bootstrap support values are indicated at the nodes.

This Trichodectidae cluster forms a distinct major lineage, clearly separated from Anoplura lice (including the human lice Pediculus and Pthirus) and other rodent and ungulate lice. Within the Anoplura clade, a robust monophyletic group was recovered for lice infesting primates (families Pedicinidae, Pthiridae and Pediculidae). Pediculus humanus capitis and P. humanus corporis share a sister relationship, closely related to P. schaeffi, species of the genus Pthirus (P. gorillae and P. pubis) and Pedicinus obtusus.

Similarly, rodent lice of the genus Polyplax, including P. asiatica, P. reclinata and P. spinulosa (family Polyplacidae), form a distinct clade. The 3 Haematopinus species (ungulate lice; family Haematopinidae) constitute a well-supported cluster, while Microthoracius praelongiceps (family Microthoraciidae) forms a distinct clade within Anoplura.

The cox1 gene tree recovered the same clades described in the PCGs tree along with additional ones, as it included a broader range of lice species (Supplementary Figure S3). The Trichodectidae clade included the species Damalinia meyeri, associated with the genus Bovicola. The species Haematomyzus elephantis (family Haematomyzidae) is associated with this clade with relatively low support. Two additional clades corresponded to the family Echinophthiriidae (genera Antarctophthirus, Proechinophthirus and Lepidophthirus) and the family Hoplopleuridae (genus Hoplopleura). However, this tree does not resolve the relationship between most families, with the exception of the primate lice families.

In both trees, the 2 Philopteridae avian lice used as outgroup clustered together with maximum support, regardless of their mitogenome organization: a single circular molecule in F. suturalis (Nie et al., Reference Nie, Fu, Zhang, Deng, Wang, Tu and Liu2021) and 17 minichromosomes in C. passerinae (Sweet et al., Reference Sweet, Johnson and Cameron2020).

Discussion

By combining Illumina and Sanger sequencing, we have demonstrated for the first time that the mitogenome of the species T. melis consists of 13 minichromosomes, each with a specific genetic content, varying in size and A + T content.

In Trichodectidae species, including T. canis, G. aurei and 3 Bovicola species, the minichromosome set presents a similar variation in size. The minichromosome length ranges from 800 bp in T. canis to 2413 bp in B. ovis (Shao et al., Reference Shao, Kirkness and Barker2009; Song et al., Reference Song, Barker and Shao2014; Herd et al., Reference Herd, Barker and Shao2015).

Similarly, the average A + T content of T. melis minichromosomes is comparable to that of T. canis and G. aurei (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021; Sweet et al., Reference Sweet, Johnson, Cao, De Moya, Skinner, Tan, Virrueta Herrera and Cameron2021), and is consistent with that observed in most fragmented and non-fragmented insect mitogenomes (Sweet et al., Reference Sweet, Johnson, Cao, De Moya, Skinner, Tan, Virrueta Herrera and Cameron2021). In contrast, minichromosomes of the genus Bovicola exhibit a lower A + T content (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019).

Comparison between T. melis and T. canis reveals that both species possess an identical number of minichromosomes with the same gene content (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019). The non-coding region is less conserved between minichromosomes of both species.

A comparison of the 13 minichromosomes of T. melis and T. canis with other Trichodectidae species demonstrated that, among the 12 minichromosomes of G. aurei, 8 have the same gene content and order. One shares gene content but differs in gene order, while 3 others differ in tRNA gene content, though PCGs and rRNA genes remain consistent (Spradling et al., Reference Spradling, Place, Campbell and Demastes2021). Regarding Bovicola species, B. bovis and B. ovis share 6 minichromosomes with identical gene content and order to those of T. melis and T. canis, while B. caprae shares 7. The remaining minichromosomes differ in gene content and order, primarily regarding tRNA and nad3 genes (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019). Notably, in T. melis, T. canis and G. aurei, the nad3 and nad6 genes are located on the same minichromosome, whereas in Bovicola species, they are on separate minichromosomes (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021).

Furthermore, a minichromosome containing only 2 tRNA genes and the non-coding region, present in T. melis and T. canis, has not been described in G. aurei or Bovicola species (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021). However, it has been reported in more distantly related lice mitogenomes, such as those of Haematopinus asini, P. humanus, P. schaeffi and 4 Columbicola species (Shao et al., Reference Shao, Kirkness and Barker2009; Song et al., Reference Song, Barker and Shao2014; Herd et al., Reference Herd, Barker and Shao2015; Sweet et al., Reference Sweet, Johnson and Cameron2020). These data indicate that, while some minichromosomes are conserved within Trichodectidae, significant interspecific, intergeneric and interfamilial variation exists in both minichromosome number and gene content arrangement. Similar variation has been previously described among closely related lice species (Song et al., Reference Song, Barker and Shao2014; Dong et al., Reference Dong, Song, Guo, Jin, Yang, Barker and Shao2014a, Reference Dong, Song, Jin, Guo and Shao2014b, Reference Dong, Dong, Guo and Shao2021, Reference Dong, Jelocnik, Gillett, Valenza, Conroy, Potvin and Shao2023).

Protein-coding genes (PCGs)

Most PCGs have similar lengths in T. melis and T. canis, except for atp8 (240 vs 180 bp). Similar conservation is observed in G. aurei and the 3 Bovicola species, although atp8 also shows substantial length variation in Bovicola (Supplementary Table S3) (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021).

T. melis PCGs are A + T-rich, with T. canis showing slightly higher values, whereas the average A + T content is substantially lower in G. aurei and Bovicola species (Supplementary Table S4) (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021).

Regarding start and stop codons, while 6 start codons are used in T. melis, only 3 are used in T. canis, with ATT codon being the most frequent (9 out of the 13 PCGs), followed by ATA and TTG in 2 genes each (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019). Conversely, G. aurei uses 4 start codons (ATG, TTG, ATA and ATT), with ATA being the most frequent (5 genes), followed by ATT (4 genes) (Spradling et al., Reference Spradling, Place, Campbell and Demastes2021). In Bovicola species, 5 (B. caprae) or 6 (B. bovis and B. ovis) start codons are used (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019).

The T. melis and T. canis mitogenomes use the same 4 stop codons, being TAA used in more genes (10 PCGs), while the remaining 3 genes use TAG, TA- and the incomplete T- (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019). In G. aurei and the 3 Bovicola species, only 3 stop codons are used (TAA, TAG and T-), with the frequency of each codon varying among the 4 species (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021).

Non-coding regions

The size variation of non-coding regions of the minichromosomes of T. melis, align with ranges reported for other lice, such as T. canis (331–656 bp), G. aurei (316–490 bp) and B. bovis (337–592 bp), while size variation is notably higher in B. caprae (286–993 bp) and B. ovis (436–1014 bp) (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019; Spradling et al., Reference Spradling, Place, Campbell and Demastes2021).

In addition, we demonstrated size and sequence variations between the 2 analysed non-coding regions of the same minichromosome. These data indicate significant intra-individual heteroplasmy within the non-coding regions of T. melis mitochondrial minichromosomes. Similar heteroplasmy, manifesting as divergence between homologous genes or multiple chromosomal arrangements, has been documented in other lice mitogenomes (Cameron et al., Reference Cameron, Yoshizawa, Mizukoshi, Whiting and Johnson2011; Sweet et al., Reference Sweet, Johnson and Cameron2022). Some studies suggest that heteroplasmy is particularly prevalent in lice species with fragmented mitogenomes, likely driven by recombination between minichromosomes rather than point mutations or indels (Herd et al., Reference Herd, Barker and Shao2012; Pietan et al., Reference Pietan, Spradling and Demastes2016). However, the direct correlation between genome fragmentation and heteroplasmy levels remains a subject of debate (Xiong et al., Reference Xiong, Barker, Burger, Raoult and Shao2013).

Alignment of the non-coding regions of the 13 minichromosomes of T. melis revealed a conserved organization with 3 CSBs, microsatellite motifs and a tandem repeat sequence. We also analysed the non-coding regions of all minichromosomes of T. canis and identified a shared conserved structure, similar to T. melis, which contained the same elements, with CSB-1 (81 bp), CSB-2 (99 bp), CSB-3 (52 bp), the microsatellite motifs and a tandem repeat sequence with a 54 bp monomer unit, with variation between 1 and 2 monomer units per minichromosome (Supplementary Figure S2). The tandem repeat of the conserved structure of both species is different, as it varies in size and in nucleotide sequence. However, although the CSBs of T. melis and T. canis varied in size and sequence, they aligned over a significant portion, with identity percentages of 80.0%, 71.9% and 62.2% for CSB-1, CSB-2 and CSB-3, respectively, within the shared region.

In lice, conserved sequences identified in the non-coding regions vary widely in size and are not conserved across distant species (Shao et al., Reference Shao, Kirkness and Barker2009; Cameron et al., Reference Cameron, Yoshizawa, Mizukoshi, Whiting and Johnson2011; Dong et al., Reference Dong, Song, Guo, Jin, Yang, Barker and Shao2014a, Reference Dong, Song, Jin, Guo and Shao2014b). Tandem repeats of variable length and composition have also been reported in some lice species (Shao et al., Reference Shao, Kirkness and Barker2009; Cameron et al., Reference Cameron, Yoshizawa, Mizukoshi, Whiting and Johnson2011). Additionally, A-T-rich and G-C-rich regions at the 3′ and 5′ ends, respectively, have been described in several species (Shao et al., Reference Shao, Zhu, Barker and Herd2012, Reference Shao, Li, Barker and Song2017; Jiang et al., Reference Jiang, Barker and Shao2013; Song et al., Reference Song, Barker and Shao2014). These sequences are generally associated with the regulation of mitogenome replication (Saito et al., Reference Saito, Tamura and Aotsuka2005). These CSBs may form secondary structures, such as loops, that serve as initiation sites for replication and transcription (Shao et al., Reference Shao, Kirkness and Barker2009, Reference Shao, Zhu, Barker and Herd2012). Hence, the conservation of non-coding region organization suggests that these regions are under functional constraints related to mitochondrial replication and transcription.

Phylogenetic analysis

The associations of clades recovered in the phylogenetic analyses strongly agree with prior molecular frameworks. Specifically, the close affinity of the Trichodectes, Geomydoecus and Bovicola assemblage within the family Trichodectidae aligns consistently with previous phylogenetic studies (Song et al., Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019). Furthermore, the robust monophyly observed within the primate-infesting lice clade (Pedicinidae, Pthiridae and Pediculidae) reinforces well-established evolutionary hypotheses regarding host-parasite codivergence in primates (Light and Reed, Reference Light and Reed2009; Light et al., Reference Light, Smith, Allen, Durden and Reed2010).

While the broader macro-evolutionary groupings (i.e. primate, rodent and ungulate lice assemblages) were consistently recovered across both datasets, critical topological disparities emerge regarding deeper branching within the Anoplura. Notably, M. praelongiceps resolved as a highly distinct, independent lineage within the Anoplura clade. In contrast, prior results of Shao et al. (Reference Shao, Li, Barker and Song2017) and Song et al. (Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019) placed M. praelongiceps nested within the genus Haematopinus, although with marginal statistical support. This suggests that standard phylogenetic trees based on a single gene or a limited consensus may struggle to resolve divergences within the Microthoraciidae family, highlighting the need for broader genomic sampling to clarify these evolutionary relationships.

The single-locus cox1 analysis provided extended the taxonomic scope but introduced significant systematic limitations. The placement of H. elephantis with the Trichodectidae, with low bootstrap support, is consistent with the single-gene phylogenies previously described by Song et al. (Reference Song, Li, Liu, Wang, James, Colwell, Tran, Gong, Cai and Shao2019), demonstrating that the cox1 marker alone does not provide sufficient resolution to distinguish deeper divisions between families. This is further evidenced by the failure of the cox1 tree to resolve fundamental inter-familial relationships outside of the primate lice clade. Conversely, the strict monophyly and maximal support achieved for the Philopteridae outgroup (F. suturalis and C. passerinae) underscores that structural mitochondrial architecture, specifically, whether arranged as a single circular chromosome (Nie et al., Reference Nie, Fu, Zhang, Deng, Wang, Tu and Liu2021) or fragmented into 17 distinct minichromosomes (Sweet et al., Reference Sweet, Johnson and Cameron2020), does not necessarily interfere with phylogenetic signal extraction at the outgroup boundary, validating their use as reliable anchors for long-branch rooting.

In conclusion, this study provides the first complete mitogenomic characterization of T. melis, providing baseline data for future phylogenetic studies of chewing lice across different host species. The study demonstrated that mitochondrial fragmentation within Trichodectidae is evolutionarily conserved at the generic level but remains sufficiently dynamic to generate lineage-specific rearrangements, particularly involving tRNA genes and non-coding regions. It also expands knowledge of lice parasitizing wild mesocarnivores and establishes a foundation for future research on these understudied ectoparasites in European badger populations and other mustelids.

Supplementary material

The supplementary material for this article can be found at https://doi.org/10.1017/S0031182026102807.

Data availability statement

Vouchers of Trichodectes melis are deposited in the Department of Experimental Biology at the University of Jaén (Spain). Sequence data were deposited in GenBank under the following accession numbers: PZ051291–PZ051316.

Acknowledgements

The activities of the researchers were partially supported by the Andalusian Plan for Scientific Research (PAI) (research group BIO-220). This study complies with Andalusian and Spanish laws regarding animal experimentation and welfare.

Author contributions

M.V.P.: Formal analysis, Investigation, Methodology, Writing – review & editing. J.M.R.-P.: Formal analysis, Investigation, Writing – review & editing. I.R.F.: Investigation, Methodology, Writing – review & editing. P.M.: Formal analysis, Investigation, Writing – review & editing. B.M.: Resources, Writing – review & editing. E.N.: Resources, Writing – review & editing. G.S.: Resources, Writing – review & editing. C.M.-C.: Conceptualization, Investigation, Resources, Writing – review & editing. A.S.: Conceptualization, Funding acquisition, Project administration, Supervision, Writing – original draft, Writing – review & editing. M.V.P. and J.M.R.-P. contributed equally to this work.

Financial support

This research received no specific grant from any funding agency, commercial or not-for-profit sectors.

Competing interests

The authors declare that there are no conflicts of interest.

Ethical standards

Not applicable.

Footnotes

*

Marco V. Ponce and José M. Rico-Porras contributed equally to this work.

References

Bernt, M, Donath, A, Jühling, F, Externbrink, F, Florentz, C, Fritzsch, G, Pütz, J, Middendorf, M and Stadler, PF (2013) MITOS: Improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69, 313–319. https://doi.org/10.1016/j.ympev.2012.08.023CrossRefGoogle ScholarPubMed
Bolger, AM, Lohse, M and Usadel, B (2014) Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. https://doi.org/10.1093/bioinformatics/btu170CrossRefGoogle ScholarPubMed
Cameron, SL (2014) Insect mitochondrial genomics: Implications for evolution and phylogeny. Annual Review of Entomology 59, 95–117. https://doi.org/10.1146/annurev-ento-011613-162007CrossRefGoogle ScholarPubMed
Cameron, SL, Yoshizawa, K, Mizukoshi, A, Whiting, MF and Johnson, KP (2011) Mitochondrial genome deletions and minicircles are common in lice (Insecta: Phthiraptera). BMC Genomics 12, 394. https://doi.org/10.1186/1471-2164-12-394CrossRefGoogle ScholarPubMed
Clayton, DH, Hellenthal, RA, Johnson, KP, Palma, RL and Price, RD (2003) The chewing lice: World checklist and biological overview. Illinois Natural History Survey https://doi.org/10.5962/bhl.title.154191.Google Scholar
Cox, R, Steward, PD and MacDonald, DW (1999) The ectoparasites of the European badger, Meles meles, and the behavior of the host-specific flea, Paraceras melis. Journal of Insect Behavior 12, 245–265. https://doi.org/10.1023/A:1020923001987CrossRefGoogle Scholar
De Moya, RS, Yoshizawa, K, Walden, KK, Sweet, AD, Dietrich, CH and Kevin, PJ (2021) Phylogenomics of parasitic and nonparasitic lice (Insecta: Psocodea): Combining sequence data and exploring compositional bias solutions in next generation data sets. Systematic Biology 70, 719–738. https://doi.org/10.1093/sysbio/syaa075CrossRefGoogle ScholarPubMed
Dickey, AM, Kumar, V, Morgan, JK, Jara-cavieres, A, Rg, S Jr, McKenzie, CL and Osborne, LS (2015) A novel mitochondrial genome architecture in thrips (Insecta: Thysanoptera): Extreme size asymmetry among chromosomes and possible recent control region duplication. BMC Genomics 16, 439. https://doi.org/10.1186/s12864-015-1672-4CrossRefGoogle ScholarPubMed
Dierckxsens, N, Mardulyn, P and Smits, G (2017) NOVOPlasty: De novo assembly of organelle genomes from whole genome data. Nucleic Acids Research 45, e18. https://doi.org/10.1093/nar/gkw955Google ScholarPubMed
Dominguez-Panafiel, G, Gimenez-Pardo, C, Gegundez, MI and Lledo, L (2011) Prevalence of ectoparasitic arthropods on wild animals and cattle in the Las Merindades area (Burgos, Spain). Parasite 18, 251–260. https://doi.org/10.1051/parasite/2011183251CrossRefGoogle Scholar
Dong, WG, Dong, Y, Guo, XG and Shao, R (2021) Frequent tRNA gene translocation towards the boundaries with control regions contributes to the highly dynamic mitochondrial genome organization of the parasitic lice of mammals. BMC Genomics 22, 598. https://doi.org/10.1186/s12864-021-07859-wCrossRefGoogle Scholar
Dong, WG, Song, S, Guo, XG, Jin, DC, Yang, Q, Barker, SC and Shao, R (2014a) Fragmented mitochondrial genomes are present in both major clades of the blood-sucking lice (suborder Anoplura): Evidence from two Hoplopleura rodent lice (family Hoplopleuridae). BMC Genomics 15, 751. https://doi.org/10.1186/1471-2164-15-751CrossRefGoogle Scholar
Dong, WG, Song, S, Jin, DC, Guo, XG and Shao, R (2014b) Fragmented mitochondrial genomes of the rat lice, Polyplax asiatica and Polyplax spinulosa: Intra-genus variation in fragmentation pattern and a possible link between the extent of fragmentation and the length of life cycle. BMC Genomics 15, 44. https://doi.org/10.1186/1471-2164-15-44CrossRefGoogle Scholar
Dong, Y, Jelocnik, M, Gillett, A, Valenza, L, Conroy, G, Potvin, D and Shao, R (2023) Mitochondrial genome fragmentation occurred multiple times independently in bird lice of the families Menoponidae and Laemobothriidae. Animals 13, 2046. https://doi.org/10.3390/ani13122046CrossRefGoogle Scholar
Durden, LA and Musser, GG (1994) The sucking lice (Insecta, Anoplura) of the world: A taxonomic checklist with records of mammalian hosts and geographical distributions. Bulletin of the American Museum of Natural History 218, 1–90.Google Scholar
Gagat, P, Mackiewicz, D and Mackiewicz, P (2017) Peculiarities within peculiarities - dinoflagellates and their mitochondrial genomes. Mitochondrial DNA Particles B: Resources 2, 191–195. https://doi.org/10.1080/23802359.2017.1307699CrossRefGoogle ScholarPubMed
Gibson, T, Blok, VC and Dowton, M (2007) Sequence and characterization of six mitochondrial subgenomes from Globodera rostochiensis: Multipartite structure is conserved among close nematode relatives. Journal of Molecular Evolution 65, 308–315. https://doi.org/10.1007/s00239-007-9007-yCrossRefGoogle ScholarPubMed
Gong, S, Xu, Y, Xu, S, Liang, Y, Tian, L, Cai, W, Li, H and Song, F (2022) The complete mitochondrial genome of the chicken body louse, Menacanthus cornutus, and evolutionary patterns of extensive gene rearrangements in the mitochondrial genomes of Amblycera (Psocodea: Phthiraptera). Genes 13, 522. https://doi.org/10.3390/genes13030522CrossRefGoogle ScholarPubMed
Greiner, S, Lehwark, P and Bock, R (2019) OrganellarGenomeDRAW (OGDRAW) version 1.3.1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Research 47(W1), W59–W64. https://doi.org/10.1093/nar/gkz238CrossRefGoogle ScholarPubMed
Gustafsson, DR, Allen, JM, Bell, KC, Bush, SE, Durden, LA, Johnson, KP, Light, JE and Weckstein, JD (2025) Phthiraptera systematics: Past, present, and future. Insect Systematics and Diversity 9, ixaf034. https://doi.org/10.1093/isd/ixaf034CrossRefGoogle Scholar
Herd, K, Barker, SC and Shao, R (2012) Letter: High-level of heteroplasmy in the mitochondrial -minichromosome of the human body louse, and the human head louse. The Open Genomics Journal 5, 14–17. https://doi.org/10.2174/1875693X01205010014CrossRefGoogle Scholar
Herd, KE, Barker, SC and Shao, R (2015) The mitochondrial genome of the chimpanzee louse, Pediculus schaeffi: Insights into the process of mitochondrial genome fragmentation in the blood-sucking lice of great apes. BMC Genomics 16, 661. https://doi.org/10.1186/s12864-015-1843-3CrossRefGoogle ScholarPubMed
Jiang, H, Barker, SC and Shao, R (2013) Substantial variation in the extent of mitochondrial genome fragmentation among blood-sucking lice of mammals. Genome Biology and Evolution 5, 1298–1308. https://doi.org/10.1093/gbe/evt094CrossRefGoogle ScholarPubMed
Kayal, E and Lavrov, DV (2025) One Ring does not rule them all: Linear mtDNA in Metazoa. Gene 933, 148999. https://doi.org/10.1016/j.gene.2024.148999CrossRefGoogle Scholar
Kearse, M, Moir, R, Wilson, A, Stones-havas, S, Cheung, M, Sturrock, S, Buxton, S, Cooper, A, Markowitz, S, Duran, C, Thierer, T, Ashton, B, Meintjes, P and Drummond, A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649. https://doi.org/10.1093/bioinformatics/bts199CrossRefGoogle ScholarPubMed
Kim, KC (1988) Evolutionary Parallelism in Anoplura and Eutherian Mammals. Oxford, UK: Oxford University Press.Google Scholar
Kozina, P, Gólcz, A and Izdebska, JN (2014) New data on the prevalence of Trichodectes melis (Phthiraptera, Trichodectidae) on the European badger Meles meles (Carnivora, Mustelidae). Annals of Parasitology 60, 273–276.Google ScholarPubMed
Kumar, S, Stecher, G, Suleski, M, Sanderford, M, Sharma, S and Tamura, K (2024) MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Molecular Biology and Evolution 41, msae263. https://doi.org/10.1093/molbev/msae263CrossRefGoogle ScholarPubMed
Lavrov, DV and Pett, W (2016) Animal mitochondrial DNA as we do not know it: Mt-genome organization and evolution in nonbilaterian lineages. Genome Biology and Evolution 8, 2896–2913. https://doi.org/10.1093/gbe/evw195CrossRefGoogle Scholar
Li, Q and Sheng, W (2025) The complex DNA molecular combination with a linear and circular structure in Magnolia kwangsiensis mitochondrial genome. Frontiers in Plant Science 16, 1590173. https://doi.org/10.3389/fpls.2025.1590173CrossRefGoogle ScholarPubMed
Light, JE and Reed, DL (2009) Multigene analysis of phylogenetic relationships and divergence times of primate sucking lice (Phthiraptera: Anoplura). Molecular Phylogenetics and Evolution 50, 376–390. https://doi.org/10.1016/j.ympev.2008.10.023CrossRefGoogle ScholarPubMed
Light, JE, Smith, VS, Allen, JM, Durden, LA and Reed, DL (2010) Evolutionary history of mammalian sucking lice (Phthiraptera: Anoplura). BMC Evolutionary Biology 10, 292. https://doi.org/10.1186/1471-2148-10-292CrossRefGoogle ScholarPubMed
Lowe, TM and Eddy, SR (1997) tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25, 955–964. https://doi.org/10.1093/nar/25.5.955CrossRefGoogle ScholarPubMed
Lyal, CHC (1985) A cladistic analysis and classification of trichodectid mammal lice (Phthiraptera: Ischnocera). Bulletin of the British Museum (Natural History) Entomology 51, 187–346. https://www.biodiversitylibrary.org/part/14891Google Scholar
Najer, T, Doña, J, Buček, A, Sweet, AD, Sychra, O and Johnson, KP (2024) Mitochondrial genome fragmentation is correlated with increased rates of molecular evolution. PLoS Genetics 20, e1011266. https://doi.org/10.1371/journal.pgen.1011266CrossRefGoogle ScholarPubMed
Nie, Y, Fu, YT, Zhang, Y, Deng, YP, Wang, W, Tu, Y and Liu, GH (2021) Highly rearranged mitochondrial genome in Falcolipeurus lice (Phthiraptera: Philopteridae) from endangered eagles. Parasites and Vectors 14, 269. https://doi.org/10.1186/s13071-021-04776-5CrossRefGoogle ScholarPubMed
Pérez-jiménez, JM, Soler-cruz, MD, Benítez-rodríguez, R, Ruiz-martínez, I, Díaz-lópez, M, Palomares-fernández, F and Delibes-de Castro, M (1990) Phthiraptera from some wild carnivores in Spain. Systematic Parasitology 15, 107–117. https://doi.org/10.1007/BF00009987CrossRefGoogle Scholar
Pietan, LL, Spradling, TA and Demastes, JW (2016) The mitochondrial cytochrome oxidase subunit I gene occurs on a minichromosome with extensive heteroplasmy in two species of chewing lice, Geomydoecus aurei and Thomomydoecus minor. PLoS One 11, e0162248. https://doi.org/10.1371/journal.pone.0162248CrossRefGoogle ScholarPubMed
Price, RD, Hellenthal, RA and Palma, RL (2003) World checklist of chewing lice with host associations and keys to families and genera. In Price, RD, Hellenthal, RA, Palma, RL, Johnson, KP and Clayton, DH (eds.), The Chewing Lice: world Checklist and Biological Overview. Champaign, IL, USA: Illinois Natural History Survey Special Publications 24, Illinois Natural History Survey.Google Scholar
Rekasi, J (1994) Chewing lice parasitizing mammals in Central Europe, with notes on louse taxonomy and biogeography. Parasitologia Hungarica 27, 57–67.Google Scholar
Saito, S, Tamura, K and Aotsuka, T (2005) Replication origin of mitochondrial DNA in insects. Genetics 171, 1695–1705. https://doi.org/10.1534/genetics.105.046243CrossRefGoogle ScholarPubMed
Shao, R, Kirkness, EF and Barker, SC (2009) The single mitochondrial chromosome typical of animals has evolved into 18 minichromosomes in the human body louse, Pediculus humanus. Genome Research 19, 904–912. https://doi.org/10.1101/gr.083188.108CrossRefGoogle ScholarPubMed
Shao, R, Li, H, Barker, SC and Song, S (2017) The mitochondrial genome of the guanaco louse, Microthoracius praelongiceps: Insights into the ancestral mitochondrial karyotype of sucking lice (Anoplura, Insecta). Genome Biology and Evolution 9, 431–445. https://doi.org/10.1093/gbe/evx007CrossRefGoogle ScholarPubMed
Shao, R, Zhu, XQ, Barker, SC and Herd, K (2012) Evolution of extensively fragmented mitochondrial genomes in the lice of humans. Genome Biology and Evolution 4, 1088–1101. https://doi.org/10.1093/gbe/evs088CrossRefGoogle ScholarPubMed
Sievers, F and Higgins, DG (2021) The clustal omega multiple alignment package. In Katoh, K (ed.), Multiple Sequence Alignment. Methods in Molecular Biology, Humana. New York, NY: Humana Press: 3–16. https://doi.org/10.1007/978-1-0716-1036-7_1CrossRefGoogle Scholar
Song, F, Li, H, Liu, GH, Wang, W, James, P, Colwell, DD, Tran, A, Gong, S, Cai, W and Shao, R (2019) Mitochondrial genome fragmentation unites the parasitic lice of eutherian mammals. Systematic Biology 68, 430–440. https://doi.org/10.1093/sysbio/syy062CrossRefGoogle ScholarPubMed
Song, SD, Barker, SC and Shao, R (2014) Variation in mitochondrial minichromosome composition between blood-sucking lice of the genus Haematopinus that infest horses and pigs. Parasites and Vectors 7, 144. https://doi.org/10.1186/1756-3305-7-144CrossRefGoogle ScholarPubMed
Spradling, TA, Place, AC, Campbell, AL and Demastes, JW (2021) Mitochondrial genome of Geomydoecus aurei, a pocket-gopher louse. PLoS One 16, e0254138. https://doi.org/10.1371/journal.pone.0254138CrossRefGoogle ScholarPubMed
Stampar, SN, Broe, MB, Macrander, J, Reitzel, AM, Brugler, MR and Daly, M (2019) Linear mitochondrial genome in Anthozoa (Cnidaria): A case study in Ceriantharia. Scientific Reports 9, 6094. https://doi.org/10.1038/s41598-019-42621-zCrossRefGoogle ScholarPubMed
Sweet, AD, Johnson, KP and Cameron, SL (2020) Mitochondrial genomes of Columbicola feather lice are highly fragmented, indicating repeated evolution of minicircle-type genomes in parasitic lice. PeerJ 8, e8759. https://doi.org/10.7717/peerj.8759CrossRefGoogle ScholarPubMed
Sweet, AD, Johnson, KP and Cameron, SL (2022) Independent evolution of highly variable, fragmented mitogenomes of parasitic lice. Communications Biology 5, 677. https://doi.org/10.1038/s42003-022-03625-0CrossRefGoogle ScholarPubMed
Sweet, AD, Johnson, KP, Cao, Y, De Moya, RS, Skinner, RK, Tan, M, Virrueta Herrera, S and Cameron, SL (2021) Structure, gene order, and nucleotide composition of mitochondrial genomes in parasitic lice from Amblycera. Gene 768, 145312. https://doi.org/10.1016/j.gene.2020.145312CrossRefGoogle ScholarPubMed
Talavera, G and Castresana, J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56, 564–577. https://doi.org/10.1080/10635150701472164CrossRefGoogle ScholarPubMed
Taşçı, GT, Erkılıç, EE, Aydın N, P and Uzlu, E (2017) First report of Trichodectes melis (Phthiraptera, Trichodectidae) from the Eurasian Badger Meles canescens (Carnivora, Mustelidae) in Turkey. Kafkas Üniversitesi Veteriner Fakültesi Dergisi 23, 1015–1017. https://doi.org/10.9775/kvfd.2017.18130Google Scholar
Xiong, H, Barker, SC, Burger, TD, Raoult, D and Shao, R (2013) Heteroplasmy in the mitochondrial genomes of human lice and ticks revealed by high throughput sequencing. PLoS One 8, e73329. doi:https://doi.org/10.1371/journal.pone.0073329. Erratum in: PLoS One 2015 10, e0123492. https://doi.org/10.1371/journal.pone.0123492CrossRefGoogle ScholarPubMed
Yahalomi, D, Haddas-sasson, M, Rubinstein, ND, Feldstein, T, Diamant, A and Huchon, D (2017) The Multipartite mitochondrial genome of Enteromyxum leei (Myxozoa): Eight fast-evolving megacircles. Molecular Biology and Evolution 34, 1551–1556. https://doi.org/10.1093/molbev/msx072CrossRefGoogle ScholarPubMed
Yu, R, Sun, C, Zhong, Y, Liu, Y, Sanchez-puerta, MV, Mower, JP and Zhou, R (2022) The minicircular and extremely heteroplasmic mitogenome of the holoparasitic plant Rhopalocnemis phalloides. Current Biology 32, 470–479.e5. https://doi.org/10.1016/j.cub.2021.11.053CrossRefGoogle ScholarPubMed
Figure 0

Table 1. Primers for the specific PCR amplification of non-coding regions of the 13 minichromosomes of the T. melis mitogenomeTable 1 long description.

Figure 1

Table 2. General data of the 13 minichromosomes of the T. melis mitogenomeTable 2 long description.

Figure 2

Figure 1. Graphical map of the 13 minichromosomes of the Trichodectes melis mitogenome. Genes encoded on the heavy strand (H) are shown outside the circles, while those encoded on the light strand (L) are shown inside the circles.Figure 1 long description.

Figure 3

Figure 2. (A) Organization of the sequences in the non-coding regions of the minichromosomes of the Trichodectes melis mitogenome. The 3 CSB-1–3 blocks, the microsatellite motifs and the tandem repeat are represented (3 monomer repetitions are represented); (B) consensus sequences of the 3 CSB-1–3 blocks and the tandem repeat.Figure 2 long description.

Figure 4

Table 3. Domain characteristics of the non-coding regions of the mitochondrial minichromosomes of T. melisTable 3 long description.

Figure 5

Figure 3. Phylogenetic tree inferred with the Maximum Likelihood method using concatenated PCG gene sequences of the mitogenome of Trichodectes melis and 20 other louse species. The data at the nodes correspond to Bootstrap supports from 1000 replicates and represent the statistical support. The tree was performed using the nucleotide substitution model GTR + G + I.Figure 3 long description.

Supplementary material: File

Ponce et al. supplementary material

Ponce et al. supplementary material
Download Ponce et al. supplementary material(File)
File 4.6 MB