Hostname: page-component-74656f9884-c52kr Total loading time: 0 Render date: 2026-11-07T13:07:28.020Z Has data issue: false hasContentIssue false
  • English
  • Français

Mitochondrial D-loop DNA analyses of Norway lobster (Nephrops norvegicus) reveals genetic isolation between Atlantic and East Mediterranean populations

Published online by Cambridge University Press:  26 October 2018

Jeanne Gallagher ,
John A. Finarelli ,
Jónas P. Jonasson  and
Jens Carlsson
Jeanne Gallagher*
Affiliation:
Area52 Research Group, School of Biology and Environmental Science/Earth Institute, University College Dublin, Belfield, Dublin 4, Ireland
John A. Finarelli
Affiliation:
School of Biology and Environmental Science/Earth Institute, University College Dublin, Belfield, Dublin 4, Ireland
Jónas P. Jonasson
Affiliation:
Marine and Freshwater Research Institute, Skúlagata 4, 101 Reykjavík, Iceland
Jens Carlsson
Affiliation:
Area52 Research Group, School of Biology and Environmental Science/Earth Institute, University College Dublin, Belfield, Dublin 4, Ireland
*
Author for correspondence: Jeanne Gallagher, E-mail: jeanne.gallagher@ucdconnect.ie
Rights & Permissions [Opens in a new window]

Abstract

Nephrops norvegicus is a commercially valuable demersal fisheries species. Relatively little is understood about this species’ population dynamics across its distribution with previous mitochondrial and microsatellite studies failing to identify significant population-level differentiation. In this study, sequence variation in the mitochondrial (mtDNA) D-loop was analysed from samples across the distribution range, and compared with COI sequences for this species retrieved from GenBank. Analysis of a 375 bp fragment of the D-loop revealed significant genetic differentiation between samples from the North-east Atlantic and the east Mediterranean (FST = 0.107, P < 0.001). Tau (τ), theta (θ0 and θ1) and Fu's FS values suggest the species spread between 10,500 to 19,000 ybp and subsequently expanded rapidly across the Atlantic.

Keywords

Atlanticcontrol regiongenetic structureglacial refugiaMediterraneanmitochondrial DNAphylogenetics

Information

Type
Research Article
Information
Journal of the Marine Biological Association of the United Kingdom , Volume 99 , Issue 4 , June 2019 , pp. 933 - 940
Copyright
Copyright © Marine Biological Association of the United Kingdom 2018 

Introduction

Nephrops norvegicus (Linnaeus, 1758) is a benthic-dwelling, decapod crustacean that inhabits burrows in patches of soft, muddy sediment between ~4–800 m depth (Holthuis, Reference Holthuis1991; Johnson et al., Reference Johnson, Lordan and Power2013). The species’ distribution ranges from Iceland and northern Norway in the North Atlantic, to Morocco and the Mediterranean in the south (Maltagliati et al., Reference Maltagliati, Camilli, Biagi and Abbiati1998; Bell et al., Reference Bell, Redant, Tuck and Phillips2006; Johnson et al., Reference Johnson, Lordan and Power2013). Nephrops norvegicus is dioecious, with mating occurring following a brief courtship shortly after females moult (Powell & Eriksson, Reference Powell and Eriksson2013). Females produce 900–6000 eggs in a brood (Powell & Eriksson, Reference Powell and Eriksson2013), with dispersal occurring in the larval phase, which can last up to 50 days (Hill, Reference Hill1990; Dickey-Collas et al., Reference Dickey-Collas, Briggs, Armstrong and Milligan2000). Survival of the larvae depends on a combination of factors including suitable temperature, food availability and access to suitable substrate (Dickey-Collas et al., Reference Dickey-Collas, Briggs, Armstrong and Milligan2000; Aguzzi & Sardà, Reference Aguzzi and Sardà2008; Pochelon et al., Reference Pochelon, Calado, Dos Santos and Queiroga2009). Upon settling, juveniles occupy or create burrows to avoid predation (Powell & Eriksson, Reference Powell and Eriksson2013). Adult N. norvegicus do not migrate or leave their mud patch at any point (Aguzzi & Sardà, Reference Aguzzi and Sardà2008).

Commonly sold as Norway lobster, Dublin Bay prawn, scampi or langoustine, N. norvegicus is a commercially important fisheries species (Thorpe et al., Reference Thorpe, Sole-Cava and Watts2000), with the most recent global landing estimates at 54,000 tonnes in 2014 (FAO 2017; Thorpe et al., Reference Thorpe, Sole-Cava and Watts2000). Within the EU, 2017's N. norvegicus landings are estimated to be worth over €278 million (Marine Institute, 2017). For management purposes the species is currently divided into approximately 40 geographic groups, known as functional units (FUs) and geographical survey areas (GSAs), across its distribution (Relini et al., Reference Relini, Bertrand and Zamboni1999; Ungfors et al., Reference Ungfors, Bell, Johnson, Cowing, Dobson, Bublitz and Sandell2013).

Effective management relies on accurate and reliable information on how species are distributed over time and space. Current assessment of N. norvegicus is largely based on underwater video surveys (Johnson et al., Reference Johnson, Lordan and Power2013; Marine Institute, 2016). Although the species has a relatively long larval stage (50 days), the low mobility of adults may increase the vulnerability of stocks to local overfishing relative to other highly mobile commercial species. Commercial fishing has been suggested as the principal driver of population dynamics for the species (Thorpe et al., Reference Thorpe, Sole-Cava and Watts2000). Despite the substantial economic value of N. norvegicus fisheries, there is limited knowledge of the species’ genetic population structure and whether it aligns with existing functional, biological or management units (Stamatis et al., Reference Stamatis, Triantafyllidis, Moutou and Mamuris2006).

Population genetics has proven highly suited for identifying biological populations by quantifying the connectivity (gene flow/isolation) among them. Population genetics can also assess vital demographic parameters, such as effective population size, evolutionary history and recent demographic expansion (Beissinger & McCullough, Reference Beissinger and McCullough2002). Mitochondrial DNA (mtDNA) has several advantages in population genetic studies. For example, as a maternally inherited haploid marker there is a lack of genetic recombination which is ideal for studying deep-historical population dynamics (Held et al., Reference Held, Koenemann and Schubart2016). Zane et al. (Reference Zane, Ostellari, Maccatrozzo, Bargelloni, Cuzin-Roudy, Buchholz and Patarnello2000) used single strand conformation polymorphism analyses of mtDNA in populations of Northern krill, Meganyctiphanes norvegica (M. Sars, 1857) to reveal at least three distinct populations in the North-east Atlantic and an Atlantic–Mediterranean divide. Yuhara et al. (Reference Yuhara, Kawane and Furota2014) utilized mtDNA cytochrome c oxidase subunit I (COI) analyses to clarify the genetic diversity and connectivity among local coastal populations of the saltmarsh sesarmid crab, Clistocoeloma sinense (Shen, 1933) around the Japanese coastline.

With respect to N. norvegicus, allozyme analyses on 110 individuals from one Scottish and two Mediterranean localities (Aegean Sea and Adriatic Sea) failed to reveal genetic differentiation (Passamonti et al., Reference Passamonti, Mantovani, Scali and Froglia1997). Maltagliati et al. (Reference Maltagliati, Camilli, Biagi and Abbiati1998) performed allozyme analyses with 15 enzyme systems in N. norvegicus, examining one Atlantic and eight Mediterranean samples, with ~100 individuals from each site. While genetic variability was detected, there was no evident population structure. Stamatis et al. (Reference Stamatis, Triantafyllidis, Moutou and Mamuris2006) used 10 allozyme systems to investigate samples from the North Sea and the Aegean Sea, finding no significant genetic differentiation among 366 examined individuals. Streiff et al. (Reference Streiff, Guillemaud, Alberto, Magalhaes, Castro and Cancela2001) did not recover evidence for population structure among 40 individuals from two Portuguese locations for five microsatellite loci. Stamatis et al. (Reference Stamatis, Triantafyllidis, Moutou and Mamuris2004) performed a restriction fragment length polymorphism analysis on mitochondrial COI DNA segments in 370 individuals and reported significant but low levels of genetic differentiation. No structure between the Mediterranean Sea and the Atlantic was discovered. Recent population expansion after the Last Glacial Maximum (LGM) was proposed as an explanation. Similarly, no population genetic structure was found using 12 microsatellite loci on 549 individuals from a small geographic range around Iceland (Pampoulie et al., Reference Pampoulie, Skirnisdottir, Hauksdottir, Olafsson, Eiriksson, Chosson, Hreggvidsson, Gunnarsson and Hjorleifsdottir2011).

Previous studies have yet to recover population differentiation either across the geographic range of N. norvegicus, or at finer scales. The mtDNA D-loop has proven hypervariable in other crustacean species with high levels of polymorphism that can be used to discriminate amongst populations (McMillen-Jackson & Bert, Reference McMillen-Jackson and Bert2003, Reference McMillen-Jackson and Bert2004). The current study explores the efficacy of this region to determine the presence of population structure across a subsample of the species’ distribution.

Materials and methods

Sampling

Samples were collected from commercial fishing or research vessels from across the geographic distribution of N. norvegicus including Iceland, northern Norway, Skagerrak, North Sea, Irish Sea, Porcupine Bank, Bay of Biscay, Gulf of Cadiz and Ancona in the Adriatic Sea (Figure 1). Sex and length were recorded, and first and second pereiopods were removed from each individual before being stored in 80% EtOH. Whole samples that were collected were stored at −20 °C before tail tissue was removed and stored in 80% EtOH. Both males and females (~2:1) with carapace lengths encompassing an equal number (N = 15) of individuals of two length groups (6–35 & 35–70 mm) were selected to minimize the risk of only including a single cohort that could cause family effects and skew the genetic data (Haynes et al., Reference Haynes, Browne, Fullbrook, Graham, Hancox, Johnson, Lauria and Power2016).

Fig. 1.

Map of the geographic distribution and frequency of haplotype groups in nine sample sites of N. norvegicus. AD: Adriatic, BOB: Bay of Biscay, BRE: Breiðamerkurdjúp, GC: Gulf of Cadiz, IS: Irish Sea (west), NN: Northern Norway, NS: North Sea, POR: Porcupine, SKA: Skagerrak haplotypes.

DNA analysis

Total genomic DNA was extracted using a modified chloroform/isoamyl alcohol protocol (Petit et al., Reference Petit, Excoffier and Mayer1999). Primers (NN3DF 5′-ACA GCG TTA AGA YAC CAT AG-3′ and NnDR 5′-GCT CTC ATA AAC GGG GTA TGA-3′) were designed initially using Primer-3 as implemented in Geneious® 7 (https://www.geneious.com, Kearse et al., Reference Kearse, Moir, Wilson, Stones-Havas, Cheung, Sturrock, Buxton, Cooper, Markowitz, Duran, Thierer, Ashton, Meintjes and Drummond2012) and the D-loop N. norvegicus mitochondrial genome (GenBank accession: LN681403.1). The resulting amplicons were relatively larger (~880 bp) than had been designed for (~600 bp) and were sequenced to discover a ~280 bp fragment of the D-loop area missing from within the GenBank data (Appendix 1). Subsequently, new primers JG2 F 5′-CTA CAG ATT TCG TCT ATC AAC-3′ and NnD R 5′-GCT CTC ATA AAC GGG GTA TGA-3′ were designed on these returning sequences to incorporate the newly discovered ~280 bp for a ~680 bp amplicon. Primer sequences’ specificity was confirmed using BLAST (Basic Logical Alignment Search Tool; Zhang et al., Reference Zhang, Schwartz, Wagner and Miller2000). Optimal annealing temperature was determined using a gradient PCR.

PCR amplifications were performed in a Biometra T3000 thermocycler (Biolabo, SA) with lid temperature of 95 °C, using a thermal cycling profile of initial heating of 95 °C for 2 min, followed by 30 cycles of 95 °C for 30 s, 61.2 °C for 30 s, and 72 °C for 1 min, followed by a final extension step of 72 °C for 2 min. Completed reactions were held at 4 °C. PCR products were visualized on 1.5% agarose gels to verify amplifications, and purified using ExoSap-IT (Affymetrix Ltd, Santa Clara, CA) prior to Macrogen sequencing.

COI data

In total, 35 N. norvegicus COI sequences were downloaded from GenBank covering four different areas: the North Sea, Paris (unknown), Portugal and Turkey (Appendix 2).

Data and statistical analyses

Forward and reverse sequences were aligned and edited in Geneious® v 7.0, using the K80 substitution model (Kimura, Reference Kimura1980), as determined in JMODELTEST v 2.1.4. (Guindon & Gascuel, Reference Guindon and Gascuel2003; Darriba et al., Reference Darriba, Taboada, Doallo and Posada2012). Spatial analysis of molecular variance, SAMOVA v 2.0 (Dupanloup et al., Reference Dupanloup, Schneider and Excoffier2002) was used to define groups of populations that are geographically homogenous and maximally differentiated from each other. Analysis of molecular variance (AMOVA; Excoffier et al., Reference Excoffier, Smouse and Quattro1992) was performed in ARLEQUIN v 3.5 (Excoffier & Lischer, Reference Excoffier and Lischer2010) to generate F-statistics, ΦST, θ, and (τ), the K80 substitution model and 10,100 replicates. Fu's F S tests whether mutations are selectively neutral. Theta (θ) is defined as 2 Nμ for haploid mitochondrial DNA, where N is the effective population size and μ is mutation rate per sequence per generation (Fu, Reference Fu1997). Tau (τ) can measure relative time since a population expansion using T = τ/2u, where u is per-nucleotide rate of mutation multiplied by the number of nucleotides in the sequence (Gaggiotti & Excoffier, Reference Gaggiotti and Excoffier2000). Harpending's raggedness index (Harpending, Reference Harpending1994) and mismatch distributions (SSD) were both used to test whether the data deviated significantly from a population expansion model. DNASP v 6.10.01 (Rozas et al., Reference Rozas, Ferrer-Mata, Sánchez-DelBarrio, Guirao-Rico, Librado, Ramos-Onsins and Sánchez-Gracia2017) was used to calculate haplotype (h) and nucleotide diversity (π) and to estimate the nearest neighbour statistic S nn (Hudson, Reference Hudson2000) with 10,000 permutations. This statistic uses a symmetric island model on haplotype data to measure sequential ‘neighbours’ from the same geographic space. In all cases involving multiple comparisons significance levels were adjusted for multiple tests using the sequential Bonferroni correction technique (Rice, Reference Rice1989). A map of N. norvegicus haplotypes was constructed using POPART v 1.7 (Leigh & Bryant, Reference Leigh and Bryant2015). Unweighted Pair Group Method with Arithmetic Mean (UPGMA) dendrograms of ΦST pairwise distance values for both D-loop and GenBank retrieved COI sequences (Appendix 2) were created in PAST v 3.20 with 1000 bootstrap replicates (Hammer et al., Reference Hammer, Harper and Ryan2001). All software was used with default setting unless specified otherwise.

Results

DNA analysis

Sequence alignments for the D-loop region were trimmed for maximum length and quality using individual sequence chromatograms. Only regions of the D-loop for which both forward and reverse strands yielded unambiguous sequences were included for a fragment of 375 bp. Of the 270 sequenced samples, 13 were excluded due to poor quality sequence reads. A total of 15 haplotypes were resolved (GenBank accession nos. MG972769–MG972783) with nucleotide diversity (π) ranging from 0.008 in the Gulf of Cadiz to 0.019 in the Bay of Biscay, and haplotype diversity ranging from 0.508 in Breiðamerkurdjúp to 0.859 in the Bay of Biscay (Table 1). Frequency and location of the haplotypes were displayed on a haplotype map (Figure 1).

Table 1.

Mitochondrial sequence variability in the D-loop for N. norvegicus from the nine sample sites; number of individuals (N), number of haplotypes (Nh), haplotype diversity (h), nucleotide diversity (π), tau (τ), theta for times 0 and 1 (θ0 and θ1), Fu's FS, Harpending's Raggedness index (Hri), and sum of squared differences from mismatch analyses (SSD)

Values in bold are significant at P < 0.05, *P < 0.001.

Data and statistical analyses

Population differentiation

The SAMOVA analysis indicated that the best-supported F CT value (F CT = 0.109) was achieved when the samples were clustered into two groups. The first group contained only individuals derived from the east Mediterranean (Adriatic) while the second group comprised of individuals from all other sampled areas (Table 2).

Table 2.

SAMOVA results table for N. norvegicus. K corresponds to the number of populations. Optimal F CT and groupings (K = 2) are highlighted in bold

An AMOVA analysis, using the SAMOVA structure and the K80 distance model (Kimura, Reference Kimura1980) revealed significant heterogeneity among the nine samples (ΦST = 0.107, P < 0.001). Within-sample variation accounted for 88.86% of the variance (F CT = 0.100, P < 0.001; Table 3). Pairwise ΦST values revealed population structure between the eastern Mediterranean (Adriatic) sample and each of the eight other samples from the North Atlantic (Table 4). Significant pairwise ΦST values for the D-loop sequences ranged from 0.057 (Adriatic/Porcupine) to 0.152 (Adriatic/Breiðamerkurdjúp; Table 4). The nearest-neighbour statistic (S nn) indicated a significant association between sequence similarity and geographic location (S nn = 0.1250, P = 0.032). Significant pairwise ΦST values for COI data ranged from 0.968 (Portugal/Turkey) to 0.936 (North Sea/Turkey; Table 5). A UPGMA dendrogram was constructed using sample pairwise ΦST values to visualize genetic distances for both D-loop and COI data (Figures 2 and 3).

Fig. 2.

D-Loop UPGMA dendrogram based on ΦST pairwise distance values calculated from frequency data among N. norvegicus individuals sampled.

Fig. 3.

COI UPGMA dendrogram based on ΦST pairwise distance values calculated from frequency data of N. norvegicus individuals taken from GenBank.

Table 3.

AMOVA table of temporal and spatial genetic variation of N. norvegicus from sites sampled

Table 4.

Pairwise ΦST estimates (below diagonal) for D-loop mtDNA data among N. norvegicus samples. P-values (upper diagonal) in bold were significant after Sequential Bonferroni correction (initial α = 0.05/8 = 0.00625)

Table 5.

Pairwise ΦST estimates (below diagonal) for COI mtDNA data among GenBank N. norvegicus samples. P-values (upper diagonal) in bold were significant after Sequential Bonferroni correction (initial α = 0.05/8 = 0.016)

Population expansion

Demographic analyses in ARLEQUIN showed pronounced differences between θ0 and θ1 suggesting rapid population expansion in all samples, with less pronounced differences in the Adriatic sample (Table 1). All Fu's F S values were negative and deviated significantly from zero. Mismatch distributions differed significantly from the distributions expected under population expansion in four of the nine sample sites (Table 1). Harpending's raggedness index ranged from 0.040 to 0.138 from the Adriatic to the Irish Sea respectively and was significant for all except the Adriatic sample (Table 1).

Using the population expansion formula T = τ/2u with u = μk, where μ = per nucleotide substitution rate and k = sequence length, population expansion times were estimated between 10,500 to 19,000 ybp. Due to the uncertainty around the point estimate of τ in the ARLEQUIN analyses, 1000 bootstrap replicates were performed drawing random values for tau from between 2.5 and 97.5 percentiles returned by ARLEQUIN. Population expansion times were estimated using μ = 19%/My from the penaeid prawn and pink shrimp D-loop mutation rate (McMillen-Jackson & Bert, Reference McMillen-Jackson and Bert2003, Reference McMillen-Jackson and Bert2004). From the 1000 bootstrap iterations the mean estimate and upper and lower two standard deviation confidence intervals were calculated (Table 6).

Table 6.

Estimated expansion times for N. norvegicus with upper and lower two standard deviation confidence intervals

Discussion

This study recovered a previously undocumented 280 bp segment of the N. norvegicus mitochondrial genome (GenBank accession no. MG917720). In addition, genetic structure between the North Atlantic and eastern Mediterranean N. norvegicus samples was detected in both the mtDNA D-loop and COI region.

Eleven haplotypes are shared among multiple N. norvegicus samples, with four haplotypes unique to a single sample: two unique haplotypes are found in the Bay of Biscay, and one each are found in Breiðamerkurdjúp and the Adriatic. SAMOVA revealed distinct population genetic differences between the Atlantic samples and the eastern Mediterranean sample, and the nearest neighbour statistic (S nn) suggests a significant association between D-loop sequence similarity and geographic location. Average ΦST estimates are at least twice as large between the Adriatic and each Atlantic sample than ΦST estimates among all Atlantic samples. This suggests that the eastern Mediterranean sample is genetically differentiated from the Atlantic samples. A UPGMA cluster analysis on the D-loop ΦST distance matrix demonstrated that the largest genetic differentiation exists between the east Mediterranean and all other samples with 100 bootstrap support. The same result was also achieved using GenBank COI data where samples from Turkey in the eastern Mediterranean were genetically differentiated from Atlantic samples. While an Atlantic–Mediterranean divide has been recorded for many highly mobile species (Bargelloni et al., Reference Bargelloni, Alarcon, Alvarez, Penzo, Magoulas, Reis and Patarnello2003; Carlsson et al., Reference Carlsson, McDowell, Díaz-Jaimes, Carlsson, Boles, Gold and Graves2004; Farrell et al., Reference Farrell, Carlsson and Carlsson2016), it has not been previously reported for N. norvegicus. This could be due to small sample sizes leading to lack of statistical power. Alternatively, certain regions of mtDNA are more variable than others, with D-loop being a hypervariable region never-before explored for this species. The relatively recent expansion time of 10,500 to 19,000 ybp reported in this study could be another reason why differentiation has not been discovered previously in less variable mtDNA regions.

An Atlantic–Mediterranean divide has also been reported for European lobster Homarus gammarus (Linnaeus, 1758), which also inhabits a similar distribution range to N. norvegicus (Triantafyllidis et al., Reference Triantafyllidis, Apostolidis, Katsares, Kelly, Mercer, Hughes, Jørstad, Tsolou, Hynes and Triantaphyllidis2005). Along with this divide, significant substructuring was also found within the Mediterranean. Zane et al. (Reference Zane, Ostellari, Maccatrozzo, Bargelloni, Cuzin-Roudy, Buchholz and Patarnello2000) also reported this Atlantic–Mediterranean divide in decapod Northern krill and suggested the Oran-Almeria oceanic front as a barrier to gene flow. A sample of krill east of the straits of Gibraltar was found to be an intermediate genetically between the Atlantic and Ligurian Sea samples. Ladoukakis et al. (Reference Ladoukakis, Saavedra, Magoulas and Zouros2002) also discovered an Atlantic–Mediterranean differentiation in blue mussel, Mytilus galloprovincialis (Lamarck, 1819) and a further differentiation between Mediterranean and Black Sea populations. Marine invertebrate chaetognath Sagitta setosa (J. Müller, 1847) is also reported as having an Atlantic–Mediterranean divide, with a sharp division within the Mediterranean basin between the Adriatic sea and other areas (Peijnenburg et al., Reference Peijnenburg, Fauvelot, Breeuwer and Menken2006). Sanna et al. (Reference Sanna, Cossu, Dedola, Scarpa, Maltagliati, Castelli, Franzoi, Lai, Cristo, Curini-Galletti, Francalacci and Casu2013) also reported a genetic divergence across the Mediterranean in bivalve, Pinna nobilis (Linnaeus, 1758). Results revealed genetic divergence among three distinguishable areas: the western Mediterranean/Ionian Sea, the Adriatic Sea, and Aegean Sea/Tunisian coastal areas. Within the Mediterranean the Adriatic, as a semi-closed sea, appears to be genetically divergent from other areas (Patarnello et al., Reference Patarnello, Volckaert and Castilho2007). This is further supported by studies on vertebrates (Stefanni & Thorley, Reference Stefanni and Thorley2003; Rossi et al., Reference Rossi, Perrone and Sola2006; Gaspari et al., Reference Gaspari, Azzellino, Airoldi and Hoelzel2007; Matić-Skoko et al., Reference Matić-Skoko, Šegvić-Bubić, Mandić, Izquierdo-Gomez, Arneri, Carbonara, Grati, Ikica, Kolitari, Milone, Sartor, Scarcella, Tokaç and Tzanatos2018).

Negative Fu's F S values suggest recent demographic expansion (Fu, Reference Fu1997), and the large difference between θ0 and θ1 for all Atlantic sites suggests rapid population expansion. In contrast, the difference in theta values for the Mediterranean sample are two orders of magnitude smaller. When considered with the non-significant Raggedness index, this suggests a less-pronounced population expansion in the Mediterranean.

Estimates of time since expansion ranged from 10,500 to 19,000 ybp. Large confidence intervals around all of the point estimates for the expansion time overlap, indicating that expansion likely occurred within the same time frame for all sampled locations. These time estimates are consistent with those for European lobster, which is believed to have established around 15,000 ybp (Triantafyllidis et al., Reference Triantafyllidis, Apostolidis, Katsares, Kelly, Mercer, Hughes, Jørstad, Tsolou, Hynes and Triantaphyllidis2005). These time estimates are also in agreement with those for the LGM in Europe (16,000–31,000 ybp; Ashton et al., Reference Ashton, Lewis and Stringer2010), and likely represent population expansion into newly available habitat as the ice retreated.

Observed haplotype diversity was highest in the Bay of Biscay, suggesting this region represents a potential glacial refugium for the Atlantic distribution of the species. The area north of the Bay of Biscay has previously been hypothesized as a refugium for other marine species such as the common mussel Mytilus edulis (Linnaeus, 1758) (Śmietanka et al., Reference Śmietanka, Burzyński, Hummel and Wenne2014). These results also support species-distribution models for several other marine invertebrates, including the common starfish Asterias rubens (Johnston, 1836), amphipod crustacean Gammarus duebeni (Liljeborg, 1852), flat periwinkle Littorina obtusata (Linnaeus, 1758), dogwhelk Nucella lapillus (Linnaeus, 1758) and barnacle Semibalanus balanoid (Linnaeus, 1767) around the LGM (Waltari & Hickerson, Reference Waltari and Hickerson2013).

This study is the first to reveal a significant genetic differentiation between Atlantic and east Mediterranean samples of N. norvegicus, which supports a divide found in other marine species. Further divisions within the Mediterranean basin may be found, and future studies should include samples from these areas to examine this. These results support a post-glacial expansion, with Atlantic N. norvegicus continuing to expand rapidly. In terms of commercial fisheries management, these results do not support current management practices, as no significant genetic differentiation was found among Atlantic samples that cross several functional units. Utilizing genetic markers (e.g. microsatellites or SNPs) in future studies might provide fisheries management with more information on Atlantic N. norvegicus. These results may be important for management within the eastern Mediterranean, as populations experiencing isolation can be more vulnerable to commercial over-exploitation and recovery may be more difficult in the event of population collapse.

Acknowledgements

We would like to thank the scientists and researchers from the Irish Marine Institute, Ifremer, Marine Research Institute Iceland, Spanish Institute of Oceanography, ISMAR Institute of Marine Sciences, Havforskningsinstituttet Norwegian Institute of Marine Research, Marine Scotland and AFBI for the collection and donation of samples involved in this study. We would also like to thank E. Farrell for his assistance and comments on the manuscript.

Financial support

J.G. acknowledges funding from the Irish Research Council (IRC) (GOIPG/2015/2977). This project has received funding from the European Union's Horizon 2020 research and innovation programme under Grant agreement No. 678760 (ATLAS). This output reflects only the authors' view and the European Union cannot be held responsible for any use that may be made of the information contained therein.

Appendix 1

Nephrops norvegicus D-loop sequence (GenBank accession no. MG917720) with ~280 bp fragment (shown in bold) missing from within the GenBank data.

ATATACACAGATCAGTAAAAATATATTTTTAAGGCTAATCTAAAAAGTAAACTTATATAATTTCATTGAAATTCATTACARTCTGAAAGTCAATGATTTAATTTTATAAATCGACTAAATAAGATCTATAAATAAAATCTTACCCCTTCAAAAGGTCACTTTCTCCTGAGGGGAGCTCCCTTTTCCCAACGGGGTAAGATTTCTATTGGGAGAGCAGGATTATAATTATAGAGAGTTGGGTATAAGGCTTCATTGTTTACACATATATACTATTAAATTAATTATATACATTTATATGTATATATATATATATATATATACTATTTAAATAATATTTTCTTAACTTTWTATTTTGTTAACATWTAAATTATTAATAATGTTTTATAAATTTTATATATTAAAATAAAATACAGTAAAAAAGGTTTTTAGATAAATTTCTACGAATATTATACTATTATACACAATGGAATTCCACCAATTCTTTAAAGATCAAAACTTTTCGTGCCGTTTACACTAGTATACAAAAGAGAAGCTAATTCTAAGCTAATGG

Appendix 2

Footnotes

Table of N. norvegicus COI sequences and their locations accessed on GenBank.

References

Aguzzi, J and Sardà, F (2008) A history of recent advancements on Nephrops norvegicus behavioral and physiological rhythms. Reviews in Fish Biology and Fisheries 18, 235–248.Google Scholar
Ashton, N, Lewis, S and Stringer, C (2010) The Ancient Human Occupation of Britain. London: Elsevier.Google Scholar
Bargelloni, L, Alarcon, JA, Alvarez, MC, Penzo, E, Magoulas, A, Reis, C and Patarnello, T (2003) Discord in the family Sparidae (Teleostei): divergent phylogeographical patterns across the Atlantic–Mediterranean divide. Journal of Evolutionary Biology 16, 1149–1158.Google Scholar
Beissinger, SR and McCullough, DR (2002) Population Viability Analysis. Chicago, IL: University of Chicago Press.Google Scholar
Bell, M, Redant, F and Tuck, I (2006) Nephrops species. In Phillips, BF (ed.), Lobsters: Biology, Management, Aquaculture and Fisheries. Oxford: Blackwell, pp. 412–461.Google Scholar
Carlsson, J, McDowell, JR, Díaz-Jaimes, P, Carlsson, JEL, Boles, SB, Gold, JR and Graves, JE (2004) Microsatellite and mitochondrial DNA analyses of Atlantic bluefin tuna (Thunnus thynnus thynnus) population structure in the Mediterranean Sea: population genetics of Mediterranean bluefin tuna. Molecular Ecology 13, 3345–3356.Google Scholar
Darriba, D, Taboada, GL, Doallo, R and Posada, D (2012) Jmodeltest 2: more models, new heuristics and parallel computing. Nature Methods 9, 772.Google Scholar
Dickey-Collas, M, Briggs, RP, Armstrong, MJ and Milligan, SP (2000) Production of Nephrops norvegicus larvae in the Irish Sea. Marine Biology 137, 973–981.Google Scholar
Dupanloup, I, Schneider, S and Excoffier, L (2002) A simulated annealing approach to define the genetic structure of populations. Molecular Ecology 11, 2571–2581.Google Scholar
Excoffier, L and Lischer, HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10, 564–567.Google Scholar
Excoffier, L, Smouse, PE and Quattro, JM (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, 479–491.Google Scholar
FAO (2017) FishFinder. Rome: FAO Fisheries and Aquaculture Department. http://www.fao.org/fishery/.Google Scholar
Farrell, ED, Carlsson, JEL and Carlsson, J (2016) Next Gen Pop Gen: implementing a high-throughput approach to population genetics in boarfish (Capros aper) for fish stock identification. Proceedings of the Royal Society Open Science 3, 160651.Google Scholar
Fu, YX (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147, 915–925.Google Scholar
Gaggiotti, OE and Excoffier, L (2000) A simple method of removing the effect of a bottleneck and unequal population sizes on pairwise genetic distances. Proceedings of the Royal Society B: Biological Sciences 267, 81–87.Google Scholar
Gaspari, S, Azzellino, A, Airoldi, S and Hoelzel, AR (2007) Social kin associations and genetic structuring of striped dolphin populations (Stenella coeruleoalba) in the Mediterranean Sea. Molecular Ecology 16, 2922–2933.Google Scholar
Guindon, S and Gascuel, O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704.Google Scholar
Hammer, Ø, Harper, DAT and Ryan, PD (2001) PAST: paleontological statistics software package for education and data analysis. Palaeontologia Electronica 1, 1–9.Google Scholar
Harpending, HC (1994) Signature of ancient population growth in a low-resolution mitochondrial DNA mismatch distribution. Human Biology 66, 591–600.Google Scholar
Haynes, PS, Browne, P, Fullbrook, L, Graham, CT, Hancox, L, Johnson, MP, Lauria, V and Power, AM (2016) Growth in Nephrops norvegicus from a tag-recapture experiment. Scientific Reports 6, 35143.Google Scholar
Held, C, Koenemann, S and Schubart, CD (2016) Phylogeography and Population Genetics in Crustacea. Boca Raton, FL: CRC Press.Google Scholar
Hill, AE (1990) Pelagic dispersal of Norway lobster Nephrops norvegicus larvae examined using an advection-diffusion-mortality model. Marine Ecology Progress Series 64, 217–226.Google Scholar
Holthuis, LB (1991) FAO Species Catalogue, Vol. 13. Marine Lobsters of the World. An Annotated and Illustrated Catalogue of Marine Lobsters Known to Date. FAO Fisheries Synopsis No. 125. Rome: FAO, p. 292.Google Scholar
Hudson, RR (2000) A new statistic for detecting genetic differentiation. Genetics 155, 2011–2014.Google Scholar
Johnson, MP, Lordan, C and Power, AM (2013) Habitat and ecology of Nephrops norvegicus. Advances in Marine Biology 64, 27–63.Google Scholar
Kearse, M, Moir, R, Wilson, A, Stones-Havas, S, Cheung, M, Sturrock, S, Buxton, S, Cooper, A, Markowitz, S, Duran, C, Thierer, T, Ashton, B, Meintjes, P and Drummond, A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649.Google Scholar
Kimura, M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111–120.Google Scholar
Ladoukakis, E, Saavedra, C, Magoulas, A and Zouros, E (2002) Mitochondrial DNA variation in a species with two mitochondrial genomes: the case of Mytilus galloprovincialis from the Atlantic, the Mediterranean and the Black Sea. Molecular Ecology 11, 755–769.Google Scholar
Leigh, JW and Bryant, D (2015) Popart: full-feature software for haplotype network construction. Methods in Ecology and Evolution 6, 1110–1116.Google Scholar
Maltagliati, F, Camilli, L, Biagi, F and Abbiati, M (1998) Genetic structure of Norway lobster, Nephrops norvegicus (L.) (Crustacea: Nephropidae), from the Mediterranean Sea. Scientia Marina 62, 91–99.Google Scholar
Marine Institute (2016) The Stock Book 2016: Annual Review of Fish Stocks in 2016 with Management Advice for 2017. Galway: Marine Institute.Google Scholar
Marine Institute (2017) The Stock Book 2017: Annual Review of Fish Stocks in 2017 with Management Advice for 2018. Galway: Marine Institute.Google Scholar
Matić-Skoko, S, Šegvić-Bubić, T, Mandić, I, Izquierdo-Gomez, D, Arneri, E, Carbonara, P, Grati, F, Ikica, Z, Kolitari, J, Milone, N, Sartor, P, Scarcella, G, Tokaç, A and Tzanatos, E (2018) Evidence of subtle genetic structure in the sympatric species Mullus barbatus and Mullus surmuletus (Linnaeus, 1758) in the Mediterranean Sea. Scientific Reports 8, 676.Google Scholar
McMillen-Jackson, AL and Bert, TM (2003) Disparate patterns of population genetic structure and population history in two sympatric penaeid shrimp species (Farfantepenaeus aztecus and Litopenaeus setiferus) in the eastern United States: population genetics of two sympatric shrimp. Molecular Ecology 12, 2895–2905.Google Scholar
McMillen-Jackson, AL and Bert, TM (2004) Genetic diversity in the mtDNA control region and population structure in the pink shrimp Farfantepenaeus duorarum. Journal of Crustacean Biology 24, 101–109.Google Scholar
Pampoulie, C, Skirnisdottir, S, Hauksdottir, S, Olafsson, K, Eiriksson, H, Chosson, V, Hreggvidsson, GO, Gunnarsson, GH and Hjorleifsdottir, S (2011) A pilot genetic study reveals the absence of spatial genetic structure in Norway lobster (Nephrops norvegicus) on fishing grounds in Icelandic waters. ICES Journal of Marine Science 68, 20–25.Google Scholar
Passamonti, M, Mantovani, B, Scali, V and Froglia, C (1997) Allozymic characterization of Scottish and Aegean populations of Nephrops norvegicus. Journal of the Marine Biological Association of the United Kingdom 77, 727–735.Google Scholar
Patarnello, T, Volckaert, FAMJ and Castilho, R (2007) Pillars of Hercules: is the Atlantic-Mediterranean transition a phylogeographical break? Phylogeography of the Mediterranean-Atlantic Divide. Molecular Ecology 16, 4426–4444.Google Scholar
Peijnenburg, KTCA, Fauvelot, C, Breeuwer, JAJ and Menken, SBJ (2006) Spatial and temporal genetic structure of the planktonic Sagitta setosa (Chaetognatha) in European seas as revealed by mitochondrial and nuclear DNA markers. Molecular Ecology 15, 3319–3338.Google Scholar
Petit, E, Excoffier, L and Mayer, F (1999) No evidence of bottleneck in the postglacial recolonization of Europe by the noctule bat (Nyctalus noctula). Evolution 53, 1247–1258.Google Scholar
Pochelon, PN, Calado, R, Dos Santos, A and Queiroga, H (2009) Feeding ability of early zoeal stages of the Norway lobster Nephrops norvegicus (L.). Biological Bulletin 216, 335–343.Google Scholar
Powell, A and Eriksson, SP (2013) Reproduction: life cycle, larvae and larviculture. Advances in Marine Biology 64, 201–245.Google Scholar
Relini, G, Bertrand, J and Zamboni, A (1999) Sintesi delle conoscenze sulle risorse da pesca dei fondi del Mediterraneo centrale (Italia e Corsica). Synthesis of the knowledge on bottom fishery resources in Central Mediterranean (Italy and Corsica). Biologia Marina Mediterranea 6, 868.Google Scholar
Rice, WR (1989) Analyzing tables of statistical tests. Evolution 43, 223–225.Google Scholar
Rossi, AR, Perrone, E and Sola, L (2006) Genetic structure of gilthead seabream, Sparus aurata, in the Central Mediterranean Sea. Central European Journal of Biology 1, 636–647.Google Scholar
Rozas, J, Ferrer-Mata, A, Sánchez-DelBarrio, JC, Guirao-Rico, S, Librado, P, Ramos-Onsins, SE and Sánchez-Gracia, A (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution 34, 3299–3302.Google Scholar
Sanna, D, Cossu, P, Dedola, GL, Scarpa, F, Maltagliati, F, Castelli, A, Franzoi, P, Lai, T, Cristo, B, Curini-Galletti, M, Francalacci, P and Casu, M (2013) Mitochondrial DNA reveals genetic structuring of Pinna nobilis across the Mediterranean Sea. PLoS ONE 8, e67372.Google Scholar
Śmietanka, B, Burzyński, A, Hummel, H and Wenne, R (2014) Glacial history of the European marine mussels Mytilus, inferred from distribution of mitochondrial DNA lineages. Journal of Heredity 113, 250–258.Google Scholar
Stamatis, C, Triantafyllidis, A, Moutou, K and Mamuris, Z (2006) Allozymic variation in Northeast Atlantic and Mediterranean populations of Norway lobster, Nephrops norvegicus. ICES Journal of Marine Science 63, 875–882.Google Scholar
Stamatis, C, Triantafyllidis, A, Moutou, KA and Mamuris, Z (2004) Mitochondrial DNA variation in Northeast Atlantic and Mediterranean populations of Norway lobster, Nephrops norvegicus. Molecular Ecology 13, 1377–1390.Google Scholar
Stefanni, S and Thorley, JL (2003) Mitochondrial DNA phylogeography reveals the existence of an evolutionarily significant unit of the sand goby Pomatoschistus minutus in the Adriatic (Eastern Mediterranean). Molecular Phylogenetics and Evolution 28, 601–609.Google Scholar
Streiff, R, Guillemaud, T, Alberto, F, Magalhaes, J, Castro, M and Cancela, ML (2001) Isolation and characterization of microsatellite loci in the Norway lobster (Nephrops norvegicus). Molecular Ecology Notes 1, 71–72.Google Scholar
Thorpe, SJ, Sole-Cava, A and Watts, P (2000) Exploited marine invertebrates: genetics and fisheries. Hydrobiologia 420, 165–184.Google Scholar
Triantafyllidis, A, Apostolidis, AP, Katsares, V, Kelly, E, Mercer, J, Hughes, M, Jørstad, KE, Tsolou, A, Hynes, R and Triantaphyllidis, C (2005) Mitochondrial DNA variation in the European lobster (Homarus gammarus) throughout the range. Marine Biology 146, 223–235.Google Scholar
Ungfors, A, Bell, E, Johnson, ML, Cowing, D, Dobson, NC, Bublitz, R and Sandell, J (2013) Nephrops fisheries in European waters. Advances in Marine Biology 64, 247–314.Google Scholar
Waltari, E and Hickerson, MJ (2013) Late Pleistocene species distribution modelling of North Atlantic intertidal invertebrates. Journal of Biogeography 40, 249–260.Google Scholar
Yuhara, T, Kawane, M and Furota, T (2014) Genetic population structure of local populations of the endangered saltmarsh sesarmid crab Clistocoeloma sinense in Japan. PLoS ONE 9, e84720.Google Scholar
Zane, L, Ostellari, L, Maccatrozzo, L, Bargelloni, L, Cuzin-Roudy, J, Buchholz, F and Patarnello, T (2000) Genetic differentiation in a pelagic crustacean (Meganyctiphanes norvegica: Euphausiacea) from the North East Atlantic and the Mediterranean Sea. Marine Biology 136, 191–199.Google Scholar
Zhang, Z, Schwartz, S, Wagner, L and Miller, W (2000) A greedy algorithm for aligning DNA sequences. Journal of Computational Biology 7, 203–214.Google Scholar
Figure 0

Fig. 1. Map of the geographic distribution and frequency of haplotype groups in nine sample sites of N. norvegicus. AD: Adriatic, BOB: Bay of Biscay, BRE: Breiðamerkurdjúp, GC: Gulf of Cadiz, IS: Irish Sea (west), NN: Northern Norway, NS: North Sea, POR: Porcupine, SKA: Skagerrak haplotypes.

Figure 1

Table 1. Mitochondrial sequence variability in the D-loop for N. norvegicus from the nine sample sites; number of individuals (N), number of haplotypes (Nh), haplotype diversity (h), nucleotide diversity (π), tau (τ), theta for times 0 and 1 (θ0 and θ1), Fu's FS, Harpending's Raggedness index (Hri), and sum of squared differences from mismatch analyses (SSD)

Figure 2

Table 2. SAMOVA results table for N. norvegicus. K corresponds to the number of populations. Optimal FCT and groupings (K = 2) are highlighted in bold

Figure 3

Fig. 2. D-Loop UPGMA dendrogram based on ΦST pairwise distance values calculated from frequency data among N. norvegicus individuals sampled.

Figure 4

Fig. 3. COI UPGMA dendrogram based on ΦST pairwise distance values calculated from frequency data of N. norvegicus individuals taken from GenBank.

Figure 5

Table 3. AMOVA table of temporal and spatial genetic variation of N. norvegicus from sites sampled

Figure 6

Table 4. Pairwise ΦST estimates (below diagonal) for D-loop mtDNA data among N. norvegicus samples. P-values (upper diagonal) in bold were significant after Sequential Bonferroni correction (initial α = 0.05/8 = 0.00625)

Figure 7

Table 5. Pairwise ΦST estimates (below diagonal) for COI mtDNA data among GenBank N. norvegicus samples. P-values (upper diagonal) in bold were significant after Sequential Bonferroni correction (initial α = 0.05/8 = 0.016)

Figure 8

Table 6. Estimated expansion times for N. norvegicus with upper and lower two standard deviation confidence intervals