Implications
We discovered that age and feeding system were two factors affecting the expression of chemoreceptors for free fatty acids (FFAs) and lipid derivatives in the gastrointestinal tract (GIT) of kid goats. The expression of GPR41 and GPR43 in most segments, especially in the rumen, increased with increasing age. Meanwhile, supplemental feeding enhanced the expressions of GPR40, GPR41 and GPR43 in most segments of the GIT, whereas grazing enhanced GPR119 expression. The current results suggest that offering supplemental feeding (S) to young goat early enhanced FFAs chemoreceptors expression, which is beneficial for rumen development, and can be applied in actual production.
Introduction
Recent advances highlight that the GIT of mammals is capable of sensing various kinds of nutrients via G-protein coupled receptors (GPCRs) expressed by chemosensory cells scattered throughout the epithelial layer of the GIT (Rasoamanana et al., Reference Rasoamanana, Darcel, Fromentin and Tome2012; Mace and Marshall, Reference Mace and Marshall2013). The chemosensing of nutrients via GPCRs-mediated signal transduction pathway is commonly called ‘gut nutrient chemosensing’ (Steinert and Beglinger, Reference Steinert and Beglinger2011; Mace and Marshall, Reference Mace and Marshall2013). Till recently, various kinds of chemoreceptors for carbohydrates, amino acids and small peptides and FFAs have been identified (Nguyen et al., Reference Nguyen, Akiba and Kaunitz2012; Reimann et al., Reference Reimann, Tolhurst and Gribble2012; Tolhurst et al., Reference Tolhurst, Reimann and Gribble2012). As for FFAs, a number of GPCRs, including GPR40, GPR41, GPR43, GPR119 and GPR120, have been shown to be expressed in gut endocrine cells (Hirasawa et al., Reference Hirasawa, Tsumaya, Awaji, Katsuma, Adachi, Yamada, Sugimoto, Miyazaki and Tsujimoto2005; Covington et al., Reference Covington, Briscoe, Brown and Jayawickreme2006; Karaki et al., Reference Karaki, Tazoe, Hayashi, Kashiwabara, Tooyama, Suzuki and Kuwahara2008). It is now accepted that GPR40 and GPR120 respond to medium- to long-chain fatty acids (C>12) (Briscoe et al., Reference Briscoe, Tadayyon, Andrews, Benson, Chambers, Eilert, Ellis, Elshourbagy, Goetz, Minnick, Murdock, Sauls, Shabon, Spinage, Strum, Szekeres, Tan, Way, Ignar, Wilson and Muir2003; Hirasawa et al., Reference Hirasawa, Tsumaya, Awaji, Katsuma, Adachi, Yamada, Sugimoto, Miyazaki and Tsujimoto2005; Liou et al., Reference Liou, Lu, Sei, Zhao, Pechhold, Carrero, Raybould and Wank2011), GPR41 and GPR43 bind to short-chain fatty acids (SCFAs) (C<6) (Brown et al., Reference Brown, Goldsworthy, Barnes, Eilert, Tcheang, Daniels, Muir, Wigglesworth, Kinghorn, Fraser, Pike, Strum, Steplewski, Murdock, Holder, Marshall, Szekeres, Wilson, Ignar, Foord, Wise and Dowell2003; Nilsson et al., Reference Nilsson, Kotarsky, Owman and Olde2003), whereas GPR119 responds to lipid derivatives, such as oleoylethanolamide and lysophosphatidylcholine (Overton et al., Reference Overton, Babbs, Doel, Fyfe, Gardner, Griffin, Jackson, Procter, Rasamison, Tang-Christensen, Widdowson, Williams and Reynet2006; Hansen et al. Reference Hansen, Rosenkilde, Holst and Schwartz2012).
Generally, the rumen development process can be separated into three phases: non-rumination phase (0 to 3 week), transition phase (3 to 8 week) and rumination phase (from 8 weeks on) (Lane et al., Reference Lane, Baldwin and Jesse2002). Ruminants will undergo a change in nutrient supply from milk during the non-ruminant phase to forage- and cereal-based diets when the rumen is fully functional. Thus, the production of volatile fatty acids (VFA) in the rumen is distinct during different development phases. In our previous studies, we discovered that age and feeding system are two factors affecting the sweet taste receptor T1R2/T1R3 and the long-chain FFA receptor GPR120 expression during early development (Ran et al., Reference Ran, Li, Liu, Zhou, Tang, Han, Wang, He, Kang, Yan, Tan and Beauchemin2016a and Reference Ran, Li, Liu, Tang, Han, Wang, He, Kang, Yan, Tan and Zhou2016b). Therefore, we hypothesized that the expression of genes encoding chemoreceptors for SCFAs is also distinct during development under different feeding systems. Till recently, all the relevant FFAs or lipid derivatives chemoreceptors are mainly studied in cell lines and non-ruminants (such as mice, rat and human, etc.), and seldom reported in ruminants. Meanwhile, there is a paucity of knowledge on the developmental expression of these chemoreceptors in the GIT of ruminants and no studies have been reported in the peer-reviewed literature on differential expression of chemoreceptors under S and grazing (G) systems. Because of the importance of FFAs nutrition in ruminants, this study was conducted to study postnatal differential expression of chemoreceptors for FFAs along the GIT of kid goats under S v. G system during early development. The aim was to examine the effects of age and feeding system on the expression of chemoreceptors for FFAs and lipid derivatives in the newly born goats to extend the knowledge of FFAs metabolism in young ruminants.
Material and methods
Experimental animal management and sampling
In the current study, same experimental animal was used as described in our previous parallel studies (Jiao et al., Reference Jiao, Li, Beauchemin, Tan, Tang and Zhou2015; Li et al., Reference Li, Ran, He, Yan, Tang and Tan2016; Ran et al., Reference Ran, Li, Liu, Zhou, Tang, Han, Wang, He, Kang, Yan, Tan and Beauchemin2016a) to investigate the effects of age and feeding system (S v. G) on the expression of genes encoding chemoreceptors for FAs and lipid throughout the GIT. Detailed feeding management, ingredients of concentrate starter and forage (mainly Miscanthus) had been described by Jiao et al. (Reference Jiao, Li, Beauchemin, Tan, Tang and Zhou2015) and Li et al. (Reference Li, Ran, He, Yan, Tang and Tan2016). In brief, 44 newly born Xiangdong black kid goats (1.35±0.12 kg) were separated from the nanny after birth and trained to suckle milk from nipple pails. From birth to day 20, all the goats consumed ad libitum of goat milk. Four goats were randomly selected for sampling on days 0, 7 and 14. The remaining 32 goats were randomly divided into two treatments: S treatment, in which the goats were gradually weaned off goat milk during days 20 and 40, and offered a diet of forage and concentrate starter till day 70; G treatment, in which goats were weaned at the same time, and fed only forage. On days 28, 42, 56 and 70, four goats were randomly slaughtered for sampling in both S and G treatments.
During sampling, goats were anaesthetized using an intravenous injection of sodium pentobarbital (50 mg/kg BW) and exsanguinated via severing of the carotid artery and jugular vein. Gastrointestinal tract was separated and rinsed with pre-cooled saline, and mucosa epithelium samples of rumen, abomasum, duodenum, jejunum (proximal, middle and distal), ileum (proximal, middle and distal), cecum, colon (proximal and distal) and rectum were collected immediately. Collected samples were wrapped with sterilized tinfoil, snap-frozen in liquid nitrogen and stored at −80°C until later use.
RNA isolation and complementary DNA preparation
Total RNA was extracted from collected mucosal samples using TRIZOL (Invitrogen, CA, USA) according to the manufacturer’s instructions. The RNA isolation and reverse transcription processes were carried out as reported in our previous study (Ran et al., Reference Ran, Li, Liu, Zhou, Tang, Han, Wang, He, Kang, Yan, Tan and Beauchemin2016a and Reference Ran, Li, Liu, Tang, Han, Wang, He, Kang, Yan, Tan and Zhou2016b). The prepared complementary DNA samples were stored at −20°C until subsequent quantitative real-time PCR analysis.
Primer design and quantitative real-time PCR analysis
Primers of GPR41 (forward: GTTGCTCAACTTCCTCGTCTG; reverse: CTGAGGAGCAGCACGTAACTT) and GPR43 (forward: CTCCTTAATTTCCTGCTGTGCT; reverse: GCTA CCAAATACGACAGCTTCC) used for quantitative real-time PCR analysis were designed according to gene sequences of Capra hircus reported in GenBank. β-actin (forward: CTTCCAGCCTTCCTTCCTG; reverse: ACCGTGTTGGCGTAAAGGT) and 18S rRNA (forward: GGTAGTGACGAAAAATAACAATACAGGAC; reverse: ATACGCTATTGGAGCTGGAATTACC) were used as housekeeping genes. All primers used were proven specific and could be used for quantitative real-time PCR analysis. Quantitative real-time PCR was carried out on an ABI-7900HT qPCR system (Applied Biosystems, Foster City, CA, USA) according to the procedures described in our previous study (Ran et al., Reference Ran, Li, Liu, Zhou, Tang, Han, Wang, He, Kang, Yan, Tan and Beauchemin2016a and Reference Ran, Li, Liu, Tang, Han, Wang, He, Kang, Yan, Tan and Zhou2016b). The relative changes in mRNA expression were calculated according to the
$$2^{{{\minus}\Delta \Delta {\rm CT}}} $$
method (Livak and Schmittgen, Reference Livak and Schmittgen2001), where −ΔΔCT=− (ΔCTother tissue samples−ΔCTduodenum sample on day 0) and ΔCT=CTsamples−CTgeometric mean of housekeeping genes.
Protein isolation and western blot analysis
Protein isolation and western blot analysis were carried out as described previously (Yan et al., Reference Yan, Tang, Tan, Han, Zhou, Kang and Wang2015), which could be seen in Supplementary Material S1. The primary antibodies GPR40 (Sc-32905), GPR41 (Sc-98332), GPR43 (Sc-32906) and GPR119 (Sc-99103) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA), and the internal control antibody β-actin (600008-1) and HRP-labeled secondary antibody were supplied by Proteintech Treatment (Proteintech Treatment Inc., Chicago, IL, USA).
Statistical analysis
The effect of feeding system (S v. G) on the expression of FAs chemoreceptors was examined from days 28 to 70. The data were analyzed as a completely randomized design with the MIXED procedures of SAS (SAS Inst. Inc., Cary, NC, USA) using a model that included the fixed effect of feeding system, age and the feeding system×age interaction, with individual animal as the experiment unit as described in our previous study (Jiao et al., Reference Jiao, Li, Beauchemin, Tan, Tang and Zhou2015). Statistical significance was defined as P<0.05 and trends at 0.05≤P<0.10.
Results
Short-chain fatty acid chemoreceptors GPR41 and GPR43
The effects of feeding system (S v. G) and age on the expression of GPR41 were assayed at mRNA (Table 1) and protein (Table 2) levels. The mRNA expression of GPR41 was affected (P<0.05) by age in major segments of the GIT except cecum and distal colon. In abomasum, proximal jejunum, distal ileum and cecum, feeding system×age interactions (P<0.05) were observed. Feeding system affected (P<0.05) or tended (0.05⩽P<0.01) to affect expression in major segments except duodenum, distal jejunum, proximal ileum and cecum, with relatively greater expression in S compared with G in abomasum, whereas with relatively greater expression in G than that of S in the intestine (including proximal and middle jejunum, middle and distal ileum, colon and rectum). From days 0 to 70, the mRNA expression of GPR41 in almost all segments of the GIT increased linearly (P<0.05) or tended (0.05⩽P<0.01) to increase linearly with increasing age on feed in both S and G; furtherly, quadratical (P<0.05) changes were observed in several segments, such as the proximal jejunum of G, middle jejunum and middle ileum, distal colon of both treatments.
Expressions of GPR41 at mRNA level throughout the gastrointestinal tract of goats under supplemental feeding (S)and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value=P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
Expressions of GPR41 at protein level throughout the gastrointestinal tract of goats under supplemental feeding (S) and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value=P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
For protein expression of GPR41, there were no feeding system×age interactions (P>0.05) for most of the GIT segments except the ileum and colon (Table 2). Its expression in rumen, abomasum and cecum were relatively greater than that in small intestine and colon. Notably, from days 28 to 70, the protein expression of GPR41 in rumen and abomasum were greater in S treatment than that in G treatment, whereas the expression in cecum is almost same in both treatments. Feeding system only affected (P<0.05) expression in rumen and abomasum, with relatively greater expression in S treatment than in G treatment; meanwhile, age affected (P<0.05) the expression in rumen and small intestine. From days 0 to 70, the protein expression of GPR41 in the rumen and ileum linearly (P<0.01) increased with increasing age on feed, whereas its expression quadratically (P<0.05) changed in other segments.
The effects of feeding system (S v. G) and age on the expression of GPR43 were assayed at mRNA (Table 3) and protein (Table 4) levels. Age affected (P<0.05) or tended (0.05⩽P<0.10) to affect the mRNA expression of GPR43 in all GIT segments, except distal jejunum. Similarly, feeding system affected (P<0.05) the mRNA expression of GPR43 throughout the GIT (except duodenum), with relatively greater expression in abomasum of S treatment than that of G treatment, whereas with greater expression in the remainder segments in G treatment. From days 28 to 42, the expression of GPR43 in major segments of S treatment decreased when weaning were imposed, whereas its expression in G treatment remained stable or slightly increased, indicating a possible effect of weaning stress on the S treatment. There were feeding system × age interactions (P<0.05) or trends (0.05⩽P<0.1) for the intestine except distal jejunum. Notably, from days 0 to 70, abomasum showed the greatest expression among detected segments, with a linearly (P<0.01) increasing with age. The expression in the remainder segments either linearly (P<0.05) or quadratically (P<0.05) increased with increasing age.
Expressions of GPR43 at mRNA level throughout the gastrointestinal tract of goats under supplemental feeding (S) and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value =P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
Expressions of GPR43 at protein level throughout the gastrointestinal tract of goats under supplemental feeding (S) and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value=P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
For protein expression of GPR43, no feeding system×age interactions (P>0.05) in most of the GIT segments except ileum and colon were observed (Table 4). From days 28 to 70, its expression in rumen, abomasum and cecum were numerically greater than that in the remainder segments. Feeding system only affected (P<0.05) expression in duodenum, ileum and colon, with relatively greater expression for G treatment than for S treatment in duodenum; however, age affected (P<0.05) the expression in almost all segments except jejunum. From days 0 to 70, the protein expression of GPR43 in all segments either linearly (P<0.05) or quadratically (P<0.05) increased with increasing age on feed.
Long-chain fatty acid chemoreceptor GPR40
For the protein expression of GPR40, there were feeding system×age interactions (P<0.05) for most GIT segments except cecum and colon (Table 5). Feeding system only affected (P<0.05) the expression of GPR40 in jejunum, with relatively greater expression in S treatment than that of G treatment; meanwhile, age affected (P<0.05) the expression in almost all segments except cecum and colon. From days 0 to 70, the protein expression of GPR40 in most segments either linearly (P<0.05) or quadratically (P<0.05) fluctuated, with different trends in different segments. Taking rumen and duodenum as examples, the protein expression increased (either linearly (P<0.05) or quadratically (P<0.05)) from days 0 to 70 in rumen, whereas it decreased (either linearly (P<0.05) or quadratically (P<0.05)) in duodenum in both treatments during the same time.
Expressions of GPR40 at protein level throughout gastrointestinal tract of goats under supplemental feeding (S) and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value =P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
Lipid derivatives chemoreceptors GPR119
As shown in Table 6, there were feeding system×age interactions (P<0.01) for the protein expression of GPR119 throughout the GIT segments with exception in colon. Feeding system affected (P<0.05) expression in major segments (except the jejunum and ileum), with relatively greater expression for G treatment than for S treatment in rumen, abomasum and duodenum, while with relatively greater expression for S treatment than G treatment in cecum and colon; meanwhile, age affected (P<0.05) or tended (0.05⩽P<0.1) to affect GPR119 expression in almost all the segments except the colon. Independent from the effects of feeding system, the expression of GPR119 in almost all segments (except colon) were linearly (P<0.05) or quadratically (P<0.05) changed from days 0 to 70.
Expressions of GPR119 at protein level throughout the gastrointestinal tract of goats under supplemental feeding (S) and grazing (G) systems at different developing stages
L=linear effect of age; Q=quadratic effect of age.
1 SEM=SEM for system×age (from 28 to 70 days of age); P value=P value for both treatment groups from 28 to 70 days of age.
2 SEM=SEM for age (from 0 to 70 days of age); P value for age=P value for age from 0 to 70 days of age.
Discussion
The current results showed that feeding system and age greatly affected the expression of chemoreceptors for various fatty acids (GPR40, GPR41 and GPR43) or lipid derivatives (GPR119) at mRNA or protein level in major segments of the GIT of kid goats. In some instances, there were feeding system×age interactions, indicating that age and feeding system sometimes acted dependently.
In the current study, we found out that rumen expressed the greatest levels of SCFAs chemoreceptors GPR41 and GPR43, abomasum and cecum also expressed relatively greater levels of GPR41 and GPR43. This was due to the microbial fermentation in rumen and cecum that generated a great amount of SCFAs. Interestingly, our results showed that feeding system greatly affected the expression of GPR41 and GPR43 in rumen (except the GPR43 at protein level), whereas the expression of GPR41 and GPR43 in cecum was not affected by feeding system, suggesting that hindgut (i.e. cecum) was less likely to be affected by diets. We proposed that the concentrate starter offered to S treatment was fully digested, and the undigested forage residue was transferred to the cecum for further fermentation, which was similar to the contents reached cecum in G treatment. Thus, the expression of GPR41 and GPR43 in the cecum was not affected by feeding system. As for the rumen, the significant effect of feeding system on the expression of SCFAs chemoreceptors (GPR41 and GPR43) would be ascribed to higher concentration of SCFAs in the rumen of goats receiving S feeds in comparison with those under grazing condition. In a parallel work, Jiao et al. (Reference Jiao, Li, Beauchemin, Tan, Tang and Zhou2015) have reported higher concentration of SCFAs in the rumen of goats that received S, and the concentration of total VFA in the rumen of goats increased quadratically with increasing age (from days 0 to 70). Furthermore, the production of VFA is dependent upon dietary composition or structure, for example, total VFA concentration is higher for calves fed ground v. coarse grain starter (Coverdale et al., Reference Coverdale, Tyler, Quigley and Brumm2004). Our results indicated that S could increase the concentration of SCFAs and promoted the expression of GPR41 and GPR43.
Till recently, there were not many works concerning the effect of diet on the expression of GPR41 and GPR43; however, some in vitro works have proven that the concentration of SCFAs affects the expression of GPR41 and GPR43. It was reported that goats received a diet rich in non-fiber carbohydrate had greater ruminal concentrations of SCFAs and NH3-N, higher mRNA and protein levels of GPR41 in their rumen epithelium (Lu et al., Reference Lu, Gui, Yao, Yan, Martens, Aschenbach and Shen2015). Zeng (Reference Zeng2009) found out that adding 10 mM sodium butyrate to the in vitro culture medium greatly improved the expression of GPR43 in rumen epithelium cells. Generally, the potency orders of each SCFA for GPR41 is propionate>butyrate>acetate, whereas GPR43 is equally sensitive to each SCFA (Tazoe et al., Reference Tazoe, Otomo, Kaji, Tanaka, Karaki and Kuwahara2008). Notably, acetate is more selective for GPR43 than for GPR41 and propionate is the most potent and efficacious ligand for GPR41 (Tazoe et al., Reference Tazoe, Otomo, Kaji, Tanaka, Karaki and Kuwahara2008). Results from Jiao et al. (Reference Jiao, Li, Beauchemin, Tan, Tang and Zhou2015) and the current study were in accordance with previous findings. In the current study, feeding system greatly affected rumen fermentation, goats received S have greater ruminal propionate concentration than grazing goats, therefore, lead to greater expression GPR41 at protein level in goats of S treatment. However, the mechanism of SCFAs to improve the expression of chemoreceptor GPR41 and GPR43, or chemoreceptor to chemosensing SCFAs needed to be further studied.
To our knowledge, this is the first study to investigate the effects of age and feeding system on the expression of GPR40 and GPR119 in ruminants. In the current study, there were feeding system × age interactions on the expression of GPR40 and GPR119 in major segments of GIT; and age had great effects on the expression of GPR40 and GPR119; however, feeding system did not affect the expression of GPR40 in almost all segments of GIT, while affected the expression of GPR119 in major GIT segments. It is reported that GPR40 is specifically expressed in pancreatic islets across species and may play a role in the ability of chemosensing medium- to long-chain fatty acids to stimulate insulin secretion (Itoh et al., Reference Itoh, Kawamata, Harada, Kobayashi, Fujii, Fukusumi, Ogi, Hosoya, Tanaka, Uejima, Tanaka, Maruyama, Satoh, Okubo, Kizawa, Komatsu, Matsumura, Noguchi, Shinohara, Hinuma, Fujisawa and Fujino2003). However, it is unclear that the role of GPR40 plays in other tissues (including the GIT). Edfalk et al. (Reference Edfalk, Steneberg and Edlund2008) reported that GPR40 is expressed in endocrine cells of the GIT, including cells expressing the incretin hormones GLP-1 and GIP, and GPR40 can regulate glucose and overall energy homeostasis via mediating FFA-stimulated incretin secretion. Thus, GPR40 has become an attractive therapeutic target for type 2 diabetes (Feng et al., Reference Feng, Leng, Xie, Li, Zhao and Tang2012). We predicted that GPR40 might play an important role in mediating FFA-stimulated incretin secretion as mentioned before. Therefore, it seemed reasonable that the expression of GPR40 in the jejunum, the main segment to absorb glucose (Ran et al., Reference Ran, Li, Liu, Tang, Han, Wang, He, Kang, Yan, Tan and Zhou2016b), was affected by feeding system, with greater expression in the goats that received supplemental concentrate. The GPR119 receptor is predominantly expressed in pancreatic beta cells and enteroendocrine cells, and also plays an important role in stimulating both insulin and GLP-1 release (Hansen et al., Reference Hansen, Rosenkilde, Holst and Schwartz2012). However, in the current study, goats under grazing condition had relatively greater expression of GPR119 in segments including rumen, abomasum and duodenum than that of goats received supplemental concentrate. Recently, it is reported that GPR119 acts in synergy with GPR40 to mediate triglycerides induced secretion of incretins (Ekberg et al., Reference Ekberg, Hauge, Kristensen, Madsen, Engelstoft, Husted, Sichlau, Egerod, Timshel, Kowalski, Gribble, Reiman, Hansen, Howard, Holst and Schwartz2016). Thus, we predicted that GPR40 might play a more important role in stimulating incretin secretion when goats were supplemental fed, whereas GPR119 might play a more critical role to goats under grazing condition. Nowadays, most published studies concerning GPR40 and GPR119 have been focused on the treatment of metabolic diseases, especially diabetes and obesity (Ichimura et al., Reference Ichimura, Hasegawa, Kasubuchi and Kimura2014). The exact role of GPR40 and GPR119 playing in the GIT of ruminants needed to be studied in depth.
In summary, the expressions of chemoreceptors for FAs along the GIT of kid goats during early development were regulated by age and feeding system (S v. G). The effects of age on expression were variable depending upon the GIT segments and chemoreceptor, and age effects were often confounded by feeding system. Increased nutrient supply due to S of goats enhanced expression of GPR40, GPR41 and GPR43 in most segments of the GIT, whereas G enhanced expression of GPR119. Meanwhile, the expression of GPR41 and GPR43 were tissue related, with relatively greater expression of GPR41 and GRP43 in the rumen, abomasum and cecum than other tissue. These outcomes suggest that supplemental feeding is more effective in promoting the expression of FAs chemoreceptors than grazing, which is one of the beneficial of offering supplemental feeding early to young ruminants.
Acknowledgments
This work was jointly supported by the National Natural Science Foundation of China (grant no. 31320103917, 31372342), ‘Strategic Priority Research Program – Climate Change: Carbon Budget and Relevant Issues’ (grant no. XDA05020700), ‘CAS Visiting Professorship for Senior International Scientists’ (grant no. 2010T2S13, 2012T1S0009) and Hunan Provincial Creation Development Project (grant no. 2013TF3006).
Declaration of interest
The authors declare no competing financial or other interests.
Ethics statement
All procedures for animal experiments were carried out in accordance with the approval of the Animal Care and Use Guidelines of the Animal Care Committee, Institute of Sub-tropical Agriculture and The Chinese Academy of Sciences, Changsha, China.
Software and data repository resources
All data and SAS models used for data analysis were deposited in Institute of Subtropical Agriculture, the Chinese Academy of Sciences, Changsha, Hunan 410125, China. Anybody who is interested in this can apply for access rights from Institute of Subtropical Agriculture.
Supplementary material
To view supplementary material for this article, please visit https://doi.org/10.1017/S1751731118001581
