Introduction
A diverse assemblage of nematodes inhabits the wood tissues of various tree species, and many are known to be phoretically and/or parasitically associated with specific groups of insects (Rühm, Reference Rühm1956; Massey, Reference Massey1974; Poinar, Reference Poinar1975). Despite their ecological importance, the biology, biodiversity, phylogenetic relationships and ecological roles of these nematodes in forest decline remain poorly understood, largely because of the complexity of their life cycles and the intricate interactions among nematodes, insect vectors and fungi in forest ecosystems (Giblin-Davis et al., Reference Giblin-Davis, Kanzaki and Davies2013). Recent studies have emphasised that these associations represent one of the most challenging systems to investigate in forest biodiversity research (Kanzaki et al., Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022; Mwamula et al., Reference Mwamula, Bae, Kim, Lee and Lee2026).
The taxonomy of many insect-associated nematodes remains problematic. Numerous species were described several decades ago using limited morphological and morphometric data, making comprehensive comparisons difficult. In addition, several species exhibit distinct morphotypes across different life-cycle stages, including fungal-feeding and parasitic phases, further complicating species delimitation and taxonomic placement (Mwamula et al., Reference Mwamula, Bae, Kim, Lee and Lee2026).
Species of the genus Sychnotylenchus Rühm, Reference Rühm1956 are commonly associated with xylophagous and mycetophagous insects and are generally regarded as commensals or fungal feeders (Siddiqi, Reference Siddiqi2000). The genus has traditionally been distinguished from the closely related genus Neoditylenchus Meyl, 1961 mainly by the structure of the cephalic framework, where the lateral lip sectors are conspicuously narrower than the submedian lips in Sychnotylenchus (Siddiqi, Reference Siddiqi2000). Furthermore, the position of the excretory pore has been considered an important diagnostic character, being situated opposite to or anterior to the median bulb in Sychnotylenchus and posterior to the median bulb in Neoditylenchus (Siddiqi, Reference Siddiqi2000; Ryss et al., Reference Ryss, Chalkin and Subbotin2024).
However, the taxonomic status of these two genera remains controversial. Fortuner and Maggenti (Reference Fortuner and Maggenti1987) regarded Neoditylenchus as a junior synonym of Sychnotylenchus, arguing that the proposed diagnostic characters were insufficient for generic separation. This taxonomic concept was recently supported by molecular phylogenetic analyses of rRNA gene sequences, which accepted Neoditylenchus as a synonym of Sychnotylenchus and recognised 33 nominal species within the genus (Ryss et al., Reference Ryss, Chalkin and Subbotin2024). In contrast, other authors have continued to recognise the two genera as distinct taxa based on morphological characters and traditional classification systems (Meyl, Reference Meyl1961; Goodey, Reference Goodey1963; Paramonov, Reference Paramonov1967, Reference Paramonov1970; Massey, Reference Massey1974; Siddiqi, Reference Siddiqi2000; Kanzaki et al., Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022).
Although species of Sychnotylenchus have been reported from various forest habitats and insect hosts, their diversity and phylogenetic relationships remain incompletely understood (Giblin-Davis et al., Reference Giblin-Davis, Kanzaki and Davies2013). Most species were described between 1936 and 1975, whereas some taxa were established even earlier, resulting in many species lacking detailed morphological and molecular characterisation (Ryss et al., Reference Ryss, Chalkin and Subbotin2024). More recently, integrative taxonomic approaches combining detailed morphology with molecular analyses based on ribosomal DNA and mitochondrial markers have substantially improved our understanding of species boundaries and phylogenetic relationships within the group (Kanzaki et al., Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022; Ryss et al., Reference Ryss, Chalkin and Subbotin2024). Nevertheless, additional studies are required to clarify the taxonomy of the genus and to reveal the diversity of species associated with insect vectors and fungi in declining forest ecosystems (Mwamula et al., Reference Mwamula, Bae, Kim, Lee and Lee2026).
The present study was undertaken to characterise a population of Sychnotylenchus collected from declining forests using an integrative taxonomic approach. Detailed morphological and morphometric observations, together with molecular phylogenetic analyses based on 18S ribosomal DNA sequences, were employed to determine its taxonomic status and infer its phylogenetic relationships with related taxa. In addition, the validity of currently recognised diagnostic characters and the taxonomic status of closely related genera are discussed in light of the molecular evidence.
Materials and methods
Sampling, nematode extraction, and morphological observations
Samples were collected from bark and wood materials containing galleries of wood-boring insects, from declining European hornbeam (Carpinus betulus) (Figure 1) and transported to the laboratory for nematode extraction. The collected materials were submerged in a small volume of distilled water and incubated at room temperature for 48 h to facilitate nematode emergence. Nematodes were subsequently recovered from the suspension and individually handpicked under an Olympus SZ16 stereomicroscope.
Carpinus betulus infected with bark beetle Curculionidae and nematode Sychnotylenchus golestanicus sp. n. A: decaying bark of a European hornbeam; B, C: Bark beetle (Curculionidae) in bark galleries of Carpinus betulus.
For morphological studies, specimens were heat-killed in hot 4% formalin and processed in anhydrous glycerin according to the method of De Grisse (Reference De Grisse1969). Permanent microscope slides were prepared and examined using an Olympus BH-2 compound microscope. Photomicrographs were obtained with a TrueChrome Pro digital camera for phase-contrast imaging and an Olympus DP72 digital camera for differential interference contrast (DIC), both mounted on an Olympus BX51 microscope. Morphometric measurements were recorded using the same microscope, and line illustrations were prepared with the aid of a camera lucida. Attempts were made to establish a culture of the Sychnotylenchus nematodes; however, the culture was not successfully established under the experimental conditions used.
DNA extraction, PCR amplification, and sequencing
Three live specimens of Sychnotylenchus golestanicus were selected for molecular analyses. Prior to DNA extraction, each individual was temporarily mounted on a glass slide for morphological confirmation and subsequently transferred to a drop of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA, pH 9.0; Qiagen) on a clean slide. Each specimen was mechanically disrupted under a coverslip, and the resulting lysate was recovered in 20 μL of TE buffer. DNA extracts were stored at –20 °C until further use.
The nearly full-length 18S rDNA gene was amplified as two overlapping fragments totalling approximately 1546 bp using universal and nematode-specific primers. The first fragment was amplified with primers 1096F (5′–GGTAATTCTGGAGCTAATAC–3′) and 1912R (5′–TTTACGGTCAGAACTAGGG–3′), whereas the second fragment was generated using primers 1813F (5′–CTGCGTGAGAGGTGAAAT–3′) and 2646R (5′–GCTACCTTGTTACGACTTTT–3′) (Holterman et al., Reference Holterman, van der Wurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006). The PCR products were purified and sequenced in both directions, and the newly generated sequences were deposited in GenBank under accession number PZ545606 (18S rDNA).
Alignment and phylogenetic inference
The newly obtained sequences together with relevant sequences retrieved from GenBank were aligned using the Q-INS-i algorithm implemented in MAFFT version 7 (http://mafft.cbrc.jp/alignment/server/). Ambiguously aligned and highly divergent regions were removed using Gblocks version 0.91b under relaxed settings. The most appropriate nucleotide substitution model was selected using MrModeltest version 2 (Nylander, Reference Nylander2004). The GTR+G+I model was identified as the best-fit model.
Bayesian phylogenetic analyses were performed using MrBayes version 3.1.2. Markov chain Monte Carlo (MCMC) simulations were run for three million generations, and trees were sampled at regular intervals. Following the exclusion of the burn-in phase, posterior probabilities were estimated from a 50% majority-rule consensus tree (Larget & Simon, Reference Larget and Simon1999).
Bursaphelenchus xylophilus (Steiner & Buhrer, Reference Steiner and Buhrer1934) Nickle, Reference Nickle1970 (AY508034), and Aphelenchoides fragariae (Ritzema Bos, Reference Ritzema Bos1891) Christie, 1942 (AY284645) were selected as outgroup taxa. The resulting phylogenetic trees were visualised in Dendroscope version 3.2.8 (Huson & Scornavacca, Reference Huson and Scornavacca2012) and finalised using CorelDRAW version 2024.
Results
Sychnotylenchus golestanicus sp. n.
(Figures 2–9, Measurements in Table 1)
Sychnotylenchus golestanicus sp. n. (drawings). Female. A: Anterior body (lip region, stylet); C–E, G: Pharyngeal region; I: Entire body; J–N: Posterior part of body (containing vulva, PUS and tail); R–T: Lateral lines. Male. B: Entire body; F, H: Pharyngeal region; O–Q: Posterior end.
Figure 2. Long description
The line drawing consists of 20 panels labeled A through T.
* Panel A at the top left shows a close-up of the anterior lip region and stylet.
* Panels B and I show the entire bodies of a male and female respectively, illustrating their elongated, curved forms.
* Panels C, D, E, F, G, and H provide detailed views of the pharyngeal region, showing the internal esophageal structures and glands.
* Panels J, K, L, M, and N focus on the posterior part of the female body, highlighting the vulva, P U S (post-uterine sac), and the shape of the tail.
* Panels O, P, and Q show the posterior end of the male, including the spicules and tail morphology.
* Panels R, S, and T at the bottom show the lateral lines and cuticle patterns.
Three scale bars are provided: 10 micrometers for panel A, 20 micrometers for panels B and I, and 10 micrometers for panels C through H and J through T.
Female of Sychnotylenchus golestanicus sp. n. (drawings). A: Part of reproductive system (spermatheca, crustaformeria); C, E–G: Part of reproductive system (spermatheca, crustaformeria) and posterior end (vulva, vagina, PUS, tail); B, D: Posterior part of reproductive system (spermatheca, crustaformeria, vulva).
Figure 3. Long description
The figure consists of seven anatomical line drawings labeled A through G. A 10 micrometer scale bar is located at the bottom left.
* Panel A shows a close-up of the spermatheca containing several rounded sperm cells, leading into a segmented crustaformeria.
* Panel B illustrates a longer section of the reproductive tract, starting with a large glandular cell at the top, followed by the spermatheca, the crustaformeria, and the vulva opening on the ventral side.
* Panel C displays a complete posterior section including the spermatheca with sperm, the crustaformeria, a large oval egg in the uterus, the vulva, and a long P U S extending into the tail region.
* Panel D provides a detailed view of the spermatheca and the multi-celled crustaformeria leading toward the vulva.
* Panel E shows the reproductive tract and the tapering tail, highlighting the spatial relationship between the spermatheca and the posterior body wall.
* Panel F depicts a curved posterior end, showing a row of sperm in the spermatheca, the crustaformeria, the vulva with thickened lips, and the elongated P U S within the tail.
* Panel G shows a similar view to F, emphasizing the granular texture of the crustaformeria and the length of the post-uterine sac relative to the tail tip.
Dauer juvenile of Sychnotylenchus golestanicus sp. n. (Drawings). A: Entire body of L4; B, C: Pharyngeal region; D: Entire body of L2; E, F: Posterior end of L2; G: Posterior end of L4.
Figure 4. Long description
A multi-panel line drawing containing seven anatomical diagrams labeled A through G.
Panel A shows the entire body of an L 4 juvenile, oriented vertically with a slight curve. It displays the anterior pharyngeal region, a central nerve ring, and a long digestive tract ending in a tapered tail.
Panels B and C provide magnified views of the pharyngeal region. At the anterior tip is a small stylet, followed by a narrow procorpus, a rounded median bulb with internal valves, and a basal pharyngeal bulb overlapping the intestine.
Panel D illustrates the entire body of an L 2 juvenile, which is thinner and more elongated than the L 4 stage, showing similar internal structures but with a more pronounced ventral curve at the posterior end.
Panels E and F show the posterior end of the L 2 juvenile, featuring a sharply pointed, elongated tail.
Panel G shows the posterior end of the L 4 juvenile, which has a shorter, more bluntly rounded tail compared to the L 2 stage.
Two scale bars are located at the bottom left. The top bar represents 10 micrometers for panels A and D. The bottom bar represents 10 micrometers for panels B, C, and E through G.
Female of Sychnotylenchus golestanicus sp. n. (LM). A–C: Pharyngeal region; D: Anterior region (lip region, stylet); E: Part of pharyngeal region (ventral view); F: Posterior part of body (containing uterus with egg, PUS arrowhead, tail, anus arrowhead); H: Posterior part of body (showing vulva region, PUS arrowhead, tail); G: Posterior part of reproductive system containing spermatheca, crustaformeria, vulva (ventral view); I–K: Metacorpus region showing excretory pore (arrowhead); L: Vulva and vagina. Abbreviations: an = anus; cr = crustaformeria; ex = excretory pore; sp = spermatheca; ut = uterus. All scale bars = 10 μm.
Figure 5. Long description
A multi-panel L M (light micrograph) display of a female nematode.
* Panels A, B, and C: Longitudinal views of the pharyngeal region showing the internal tubular structure.
* Panel D: Close-up of the anterior lip region and the needle-like stylet.
* Panel E: Ventral view of the pharyngeal region.
* Panel F: Posterior body section. A large oval egg is visible inside the uterus (u t). An arrow points to the P U S (post-uterine sac), and an arrowhead labeled ‘an’ points to the anus near the tapering tail.
* Panel G: Ventral view of the reproductive system. From top to bottom, it shows the spermatheca (s p), the crustaformeria (c r), and the uterus (u t).
* Panel H: Lateral view of the posterior body showing the vulva region, the P U S (indicated by an arrow), and the tail.
* Panels I, J, and K: Close-ups of the metacorpus region. In each, a white arrowhead labeled ‘ex’ points to the excretory pore.
* Panel L: High-magnification view of the vulva and vagina opening on the ventral side.
Scale bars in all panels represent 10 micrometers.
Female of Sychnotylenchus golestanicus sp. n. (LM). A–C: Part of reproductive system (containing spermatheca and crustaformeria); D: Spermatheca; E–H: Lateral lines. Abbreviations: cr = crustaformeria; sp = spermatheca. All scale bars = 10 μm.
Figure 6. Long description
A multi-panel light micrograph consisting of eight panels labeled A through H.
* Panels A, B, and C: Vertical views of the reproductive system. The label s p is positioned at the top, identifying the spermatheca. Below this, a white bracket labeled c r identifies the crustaformeria, which contains several rounded cells.
* Panel D: A close-up view of the spermatheca, labeled s p, showing a cluster of sperm cells within the nematode body.
* Panels E, F, G, and H: High-magnification views of the nematode’s cuticle. These panels show the lateral lines, which appear as parallel longitudinal ridges or striations running vertically.
Each panel includes a white vertical or horizontal scale bar in the bottom corner representing 10 micrometers.
Female of Sychnotylenchus golestanicus sp. n. (LM). A–F: Lateral view of posterior end: vulva, vagina, and tail. Abbreviations: an = anus; vu = vulva. All scale bars = 10 μm.
Figure 7. Long description
A series of six light micrographs, labeled A through F, showing the posterior body of female nematodes. Each panel includes a vertical white scale bar representing 10 micrometers.
* Panel A: Shows the vulva (v u) as a slight indentation on the right side of the body. Distal to the vulva, a white arrowhead points to the anus (a n) located near the ventral curvature of the tail.
* Panel B: A close-up of the tapering tail region without specific labels.
* Panel C: Shows the internal granular texture of the tail region.
* Panel D: The tail tapers toward a rounded terminus. A white arrowhead points to the anus (a n) on the right side.
* Panel E: Displays the vulva (v u) as a transverse slit and the anus (a n) further down the body, indicated by a white arrowhead.
* Panel F: Shows the vulva (v u) and the anus (a n) on a curved tail section, with the anus marked by a white arrowhead.
Across all panels, the body wall is smooth, and the internal structures appear as dense, granular tissue within the translucent cuticle.
Male of Sychnotylenchus golestanicus sp. n. (LM). A, C, E: Male tail, lateral view showing spicule, gubernaculum; B: Posterior end; D: Bursa. All scale bars = 10 μm.
Figure 8. Long description
A series of five light micrographs labeled A through E showing the posterior region of a male nematode.
* Panel A shows a lateral view of the tail with a curved spicule and a distinct gubernaculum. A vertical white scale bar representing 10 micrometers is positioned to the left of the tail tip.
* Panel B displays the posterior end with similar internal structures visible through the translucent body wall.
* Panel C provides a high-contrast view of the spicule and gubernaculum within the tail region. A 10 micrometer scale bar is located to the left.
* Panel D focuses on the bursa, showing the cuticular extension around the tail. A 10 micrometer scale bar is located to the right.
* Panel E shows another lateral view of the male tail highlighting the internal reproductive structures. A 10 micrometer scale bar is located to the right.
In all panels, the nematode body curves toward the left, and the tail tapers to a fine point distally.
Dauer juvenile of Sychnotylenchus golestanicus sp. n. (LM). A, B: Pharyngeal region; C, D: Anterior region (lip region and stylet); E–G: Posterior part of body. Abbreviations: an = anus; ex = excretory pore. All scale bars = 10 μm.
Figure 9. Long description
A multi-panel light micrograph (L M) displays the anatomy of a nematode.
* Panels A and B show the elongated pharyngeal region. In panel A, an arrow labeled e x points to the excretory pore on the right side of the body. In panel B, a similar arrow labeled e x points to the pore on the left side, showing the internal pharyngeal tube running centrally down the body length.
* Panels C and D provide high-magnification views of the anterior region, focusing on the blunt lip region and the internal stylet structure. Vertical scale bars are positioned to the right of the specimens.
* Panels E, F, and G show the posterior part of the body, which tapers to a pointed tail. In panels E and F, white arrows labeled a n point to the position of the anus on the ventral side of the body.
All panels include a horizontal white scale bar at the bottom representing 10 micrometers.
Measurements of Sychnotylenchus golestanicus sp. n. from Iran. All measurements are in μm, except for the ratios, and are given as mean ± SD (min-max)
Table 1. Long description
The table contains 37 morphological characters measured in micrometers or ratios.
Columns include:
1. Character name.
2. Female Holotype (n = 1).
3. Female Paratypes (n = 12).
4. Male Paratypes (n = 9).
5. Phoretic juvenile Paratypes (n = 5).
Key data points (mean plus or minus S D and range):
* Body length (L): Female Holotype is 621; Female Paratypes average 672; Male Paratypes average 603.8; Phoretic juveniles average 369.
* Stylet length: Female Holotype is 8.0; Female Paratypes average 7.9; Male Paratypes average 7.7; Phoretic juveniles average 6.8.
* V or T (position of vulva or testis): Female Holotype is 89; Female Paratypes average 89.7; Male Paratypes average 54.1.
* Spicule length: Only recorded for Male Paratypes with an average of 18.3.
* Tail length: Female Holotype is 14.0; Female Paratypes average 17.0; Male Paratypes average 18.9; Phoretic juveniles average 31.5.
* Post-vulval uterine sac (P V U S): Female Holotype is 32.5; Female Paratypes average 32.2.
Other characters include de Manian indices (a, b, c, c prime), lip region dimensions, median bulb measurements, and distances from the anterior end to the secretory-excretory pore, nerve ring, and pharyngeal base.
Demanian indices (de Man, 1880): a = body length/body diameter; b = body length/pharynx length; c = body length/tail length; c′ = tail length/anal body diameter; m = stylet conus/stylet length; MB = anterior end to centre of median bulb/body length (%); V = anterior end to vulva/body length (%).
Bayesian 50% majority rule consensus tree of Sychnotylenchus golestanicus sp. n. based on 18S rDNA sequences under GTR + I + G model. Bayesian posterior probability values >0.50 are given for appropriate clades. The new sequence is indicated in bold.
Figure 10. Long description
The phylogenetic tree begins at a root on the left with the outgroup A Y 5 0 8 0 3 4 Bursaphelenchus xylophilus and A Y 2 8 4 6 4 5 Aphelenchoides fragariae at the bottom. Moving right, the tree splits into several major clades.
At the top of the tree, a well-supported clade with a posterior probability of 1.00 contains the new species P Z 5 4 5 6 0 6 Sychnotylenchus golestanicus in bold, which is sister to M G 8 6 5 7 9 0 Sychnotylenchus species. This group is nested within other Sychnotylenchus species including S. hibisci, S. asiaticus, S. kulinichi, and S. xiphydriae.
Below this, a clade with a probability of 0.83 includes Neomisticius species and Ditylenchus angustus. Further down, a large cluster includes Ficotylus, various Ditylenchus species, Litylenchus, Subanguina, and Anguina.
The middle section of the tree features a dense clade supported by a 1.00 probability value containing Coslenchus species, Aglenchus species, Psilenchus species, and Atetylenchus species.
The bottom section includes additional Ditylenchus species such as D. gilanicus. Branch lengths are proportional to the number of substitutions per site, indicated by a scale bar of 0.01 at the bottom right. Posterior probability values ranging from 0.54 to 1.00 are positioned at the nodes to indicate branch support.
Description
Adults
Body length ranges from short to medium, measuring 473–783 μm for males and 595–831 μm for females. The body is cylindrical, slender in males and robust in females, with a posterior expansion (a = 37.8–52 for males and 27.7–39.6 for females, respectively). Cuticular annuli fine. Lateral field with 6–8 longitudinal incisures; e.g., 8 incisures anterior to vulval region, reducing to 6 posteriorly; sometimes, oblique, discontinuous middle incisures were observed (Figures 6E–H). Deirid not observed. Cephalic region low (height/width = 0.4), flattened, with rounded sides, and continuous with body contour. Stylet fine, very slender, with narrow lumen; conus occupying one third to slightly more of total stylet length; shaft ending in small but distinct basal knobs. Dorsal pharyngeal gland orifice immediately beneath the stylet knobs. Pharynx with a cylindrical procorpus followed by a heart-shape, weakly muscular median bulb that contains small valve at mid-bulb length or sometimes slightly shifted anteriorly; followed by a long secondary tube (isthmus) and large, broad secretory glands, of which only one nucleus (dorsal) is discernible. Nerve ring encircling posterior portion of the isthmus. Hemizonid distinct at mid-level of the glandular region. Excretory pore at or anterior to level of median bulb in most specimens; in some (Figures 5I–K), slightly posterior due to pressure of the gonad on the pharynx. Excretory duct well developed, directed posteriorly (more discernible in fresh samples). Anterior portion of the intestine penetrates the pharyngeal gland at the junction of the pharynx-intestine (cardia), resulting in a funnel-like structure. In certain specimens, dorsal or even ventral overlap is observed.
Male
Body vermiform, becoming somewhat ventrally arcuate after fixation. Reproductive system monorchic; spermatocytes arranged in a single row throughout; amoeboid sperm present distally in a single row. Vas deferens distinct, sometimes containing fully developed sperm. Distal vas deferens and rectum forming together a cloacal tube surrounding the anterior portion of the spicules. Spicules anguinid-type; ventral contour smoothly arcuate; capitulum (manubrium) quadrangular with rounded margins, without distinct condylus or rostrum; blade trumpet-like (flared) with smooth curvature, distal tip appearing sharply pointed in lateral view. Spicules separate, their distal tips converging to form a V when viewed ventrally. Gubernaculum present, simple crescentic to arcuate in lateral view, about one third the spicule length. Bursa narrow, peloderan, extending from level of spicule manubrium to tail terminus. Tail conical, tip sharply pointed in lateral view.
Female
Body cylindrical, vermiform to sub-swollen but not fully inflated; strongly ventrally arcuate after fixation. Reproductive system monodelphic, prodelphic; Genital tract composed of ovary, oviduct, spermatheca, crustaformeria (eggshell-forming zone), a small intervening connective tissue mass, uterus, vagina, vulva, and post-uterine sac. Oocytes arranged in a single row throughout the ovary. Oviduct short, formed by a compact group of rounded cells. Spermatheca roundish-shaped, not branched (part of gonad tube), composed of rounded cells, filled with sperm, posteriorly connected to crustaformeria. Crustaformeria comprises 4 rows, each containing 4 large rounded cells (16 cells), observable under various microscope focuses. Focusing on the visible spermatheca and crustaformeria reveals only four cells (Figures 6A–C). However, adjusting the focus to blur the spermatheca allows for the observation of the crustaformeria’s expansion in that area, revealing an additional four cells. Spermatheca is a component of the crustaformeria, posteriorly abutting a cluster of small cells interpreted as connective tissue. Uterus short, forming a thick-walled tube or sac, sometimes expanded and containing a single egg (Figures 5F, G). Vagina perpendicular to the body axis or slightly anteriorly inclined, with constrictor muscles at the junction of the uterus and vulval slit. Vulval muscles V-shaped in lateral view (X-shaped in ventral view) but indistinct after fixation. Vulva a transverse slit in ventral view. Post-uterine sac developed, rounded, thin-walled. Post-vulval body part narrowing gradually towards the terminus, without abrupt ventral constriction. Rectum and anus present but not very distinct; rectum length about equal to body diameter at anus. Tail short and broad, with a bluntly rounded to truncate terminus; in some specimens a shallow terminal depression is present (Figures 7A–F). Tail lacking a mucro or any terminal appendage.
Phoretic (dauer) juveniles
Body short and relatively slender, 349–412 μm long (a = 34.9–40.9). Cuticle finely annulated. Lip region distinct, but the constriction separating it from the body weak, giving a mostly smooth junction. Stylet slender; conus about 42% of total stylet length; shaft ending in small basal knobs. Position of dorsal pharyngeal gland orifice immediately posterior to the stylet knobs, approximately 1 μm behind them. Procorpus narrow. Median bulb distinct, developed; valve present but weakly developed. Excretory pore anterior to median bulb, indistinct; excretory canal well defined, directed posteriorly. Nerve ring situated at a distance of about twice the median bulb diameter posterior to the base of the bulb. Hemizonid visible but indistinct, at or slightly posterior to the level of nerve ring. Pharyngeal glands narrow, elongate; gland cell nuclei not discernible. Cardia surrounding the dorsal posterior extremity of the pharyngeal glands but not clearly delimited. Primordium of reproductive system ventral, at about two-thirds of body length from anterior end, composed of several cells with 4–5 nuclei discernible. Rectum and anus present but indistinct. Tail conoid with rounded terminus (Figures 9E–G).
Diagnosis
Sychnotylenchus golestanicus sp. n. is characterised by a body length of 595–831 μm; lip region continuous; stylet very slender, 7–10 μm long, with a narrow lumen and well-developed small knobs; lateral field with six to eight incisures; median bulb heart-shaped, muscular, with a refractive valve situated from the centre to slightly anterior to the middle of the bulb; secretory-excretory pore at the level of or anterior to the median bulb; basal pharyngeal bulb large and broad; crustaformeria composed of four rows of four cells, with the anterior part expanded and functioning as a spermatheca; vulva located at ca 90% of body length; post-vulval body region not sharply narrowing ventrally; posterior uterine sac (PUS) 1.7 times the vulval body diameter (VBD); vulva-anus (V–A) distance 46–64 μm, approximately three times the tail length; tail short and broad, with a truncate to slightly flattened terminus, usually showing a shallow terminal depression and lacking any terminal appendage (mucro); spicules smoothly curved, 16–21 μm long, equal to 0.8–1.1 times the tail length; gubernaculum simple, about one-third of the spicule length; and bursal alae wide, peloderan.
Relationships
Kanzaki et al. (Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022) described seven species within the genus Sychnotylenchus: S. abietis Rühm, Reference Rühm1955, S. hibisci Kanzaki, 2022, S. intricatus Rühm, Reference Rühm1956, S. mutici Massey, Reference Massey1974, S. phloeosini Massey, Reference Massey1969, S. scolyti Massey, Reference Massey1969 and S. ulmi Rühm, Reference Rühm1956. The new species is readily distinguished from the two North American species, S. mutici and S. scolyti, both of which possess 44 crustaformerial cells (Massey, Reference Massey1969, Reference Massey1974). In addition, it differs from S. mutici by its shorter body length (595–831 vs 940 μm), vulval position (V = 88.5–90.3 vs 93), and excretory pore situated closer to the anterior end and farther from the median bulb (vs farther from the anterior end and nearer the median bulb). It differs from S. scolyti by its longer stylet (7.0–10 vs 6.2 μm) and by the more posterior position of the excretory pore (i.e., much closer to the lip region in S. scolyti). It further differs from S. abietis and S. ulmi in tail terminus morphology: S. abietis bears a small terminal mucro, whereas S. ulmi exhibits variation in tail shape not observed in the new species (Rühm, Reference Rühm1955, Reference Rühm1956).
In addition, compared with S. abietis, the new species is characterised by a shorter body (595–831 vs 902–1188 μm), excretory pore nearer the anterior end and farther from the median bulb (vs farther from the anterior end and closer to the median bulb), shorter tail (13–23 vs 21–42 μm), and shorter posterior uterine sac (24–44 vs 56–80 μm). It differs from S. ulmi by its shorter body (595–831 vs 1020–1335 μm), smaller b value (5.2–7.3 vs 8.2–9.9), smaller c value (27.0–47.2 vs 42.5–63.7), vulval position (V = 88.5–90.3 vs 92.6), shorter stylet (7.0–10 vs 11–12 μm), and tail shape, being short and broad with a truncate to slightly flattened terminus (vs conical and tapering).
The new population also differs from S. hibisci, S. intricatus and S. phloeosini by its broad tail with a truncate to slightly flattened terminus, usually showing a shallow terminal depression, versus a rounded tail in those species. However, because tail shape shows some intraspecific variation and the crustaformeria has not been described for S. intricatus and S. phloeosini, comparisons with these two species cannot be considered complete. Compared with S. phloeosini, the new species differs by its shorter body (595–831 vs 960–1050 μm), smaller b ratio (5.2–7.3 vs 8.3–9.5), vulval position (V = 88.5–90.3 vs 92.6–93.6), excretory pore nearer the anterior end and farther from the median bulb (vs farther from the anterior end and closer to the median bulb), and posterior uterine sac length to body width at vulva ratio of 1.4–2.2 vs 1.0. It differs from S. intricatus by its larger a ratio (27.7–39.6 vs 23.6–24.8), vulval position (V = 88.5–90.3 vs 91.2–91.9), an excretory pore nearer the anterior end and farther from the median bulb (vs farther from the anterior end and closer to the median bulb), and a lateral field with 6–8 incisures (vs four incisures forming three bands). Due to the high similarity between the new species and S. hibisci, a detailed comparison is provided below.
Ryss et al. (Reference Ryss, Chalkin and Subbotin2024), based on molecular analyses, placed Neoditylenchus in synonymy with Sychnotylenchus, increasing the number of valid species in the genus to 33. According to the coded polytomous key to the species of the genus given by Ryss et al. (Reference Ryss, Chalkin and Subbotin2024), Sychnotylenchus golestanicus sp. n. can be identified by the following codes: C1-(2, 3), C2-1, C3-2, C4-1, C5-(1, 2), C6-1, C7-2, C8-3, C9-1, C10-3, C11-(1, 2), C12-1, C13-2, C14-2, C15-1, C16-1, C17-(3, 4), C18-1, C19-1, C20-(1, 2), C21-2, C22-2, C23-1, C24-1. Using the set of 24 morphological characters compiled by those authors, the present population shows the greatest similarity to S. asiaticus Mwamula, Bae, Kim, Lee, and Lee, Reference Mwamula, Bae, Kim, Lee and Lee2026, S. hibisci and S. kulinichi Ryss, Chalikin & Subbotin, 2024. The new species differs from S. hibisci by the shape of the tail terminus (truncate to slightly indented vs rounded), 16 crustaformerial cells (arranged as 4 cells × 4 rows) vs 24 cells (arranged as 6 cells × 4 rows), longer post-uterine sac, measuring 61 (50–81.9)% vs 52.7 (30.5–62.1)% of the vulva–anus distance or 1.7 (1.4–2.2) vs 1.0 (0.8–1.3) body diameters at the vulva, and the excretory pore being situated closer to the anterior end and farther from the median bulb (vs farther from the anterior end and nearer the median bulb).
The new species differs from S. asiaticus by the shape of the female tail, which is short and broad with a truncate to slightly flattened terminus, usually bearing a shallow terminal depression and lacking a mucro, whereas S. asiaticus has a mostly clubbed tail with a rounded or slightly truncated terminus, sometimes broadly rounded or rarely with 2 small appendages, the latter observed in only one specimen. Tail measures in the new species 13–23 μm, whereas in S. asiaticus 38.5–51.5 μm. In addition, the new species has a relatively longer post-vulval uterine sac (24–44 vs 19.5–29.0 μm), a slightly anterior vulva (V = 88.5–90.3 vs 90.4–92.5), and shorter spicules (16–21 vs 25–28 μm). In addition, the crustaformeria of S. asiaticus was described as consisting of four rows of 8–10 large, rounded cells, posteriorly connected to a short uterine sac (Mwamula et al., Reference Mwamula, Bae, Kim, Lee and Lee2026). This condition differs markedly from that observed in S. golestanicus sp. n., in which the crustaformeria is composed of 16 cells arranged in 4 longitudinal rows of 4 large, rounded cells each, with the anterior part expanded and functioning as a spermatheca. Therefore, the structure and arrangement of the crustaformeria provide an additional character distinguishing the new species from S. asiaticus.
Compared with S. kulinichi, the new species differs in the shape of the female tail, which is short and broad with a truncate to slightly flattened terminus, usually bearing a shallow terminal depression and lacking a mucro vs conical tail with narrowly rounded tip, position of excretory pore (at the level of or anterior to the median bulb vs 1.0–2.2 median bulb length posterior to the bulb), crustaformerial cells (arranged as 4 cells × 4 rows) vs (arranged as 9–10 cells × 4 rows), longer post-uterine sac, measuring 61 (50–81.9)% vs 42 (40–46)% of the vulva–anus distance or 1.7 (1.4–2.2) vs 1.0 (0.68–0.73) body diameters at the vulva and shorter spicules (16–21 vs 23–29 μm).
In addition, the new species, compared with S. xiphydriae, differs from it by the shape of the female tail, which is short and broad with a truncate to slightly flattened terminus, usually bearing a shallow terminal depression and lacking a mucro, whereas S. xiphydriae has a conical tail with a narrowly rounded terminus. Tail measures in the new species 13-23 μm, whereas in S. xiphydriae 25–32 μm. In addition, the new species has a shorter post-vulval uterine sac (24–44 vs 53–65 μm), a lateral field with 6–8 incisures (vs fewer incisures in S. xiphydriae, maximum 6 incisures in adult individuals), and shorter spicules (16–21 vs 21–30 μm).
Molecular phylogenetical status
The Bayesian phylogenetic tree inferred from the 18S rDNA dataset placed the new species, S. golestanicus sp. n., within the subfamily Sychnotylenchinae and firmly nested it within the genus Sychnotylenchus (Figure 10). The new species formed a highly supported subclade with an unidentified isolate, Sychnotylenchus sp. (MG865790) (posterior probability = 1.00), indicating a close phylogenetic relationship between these two species. This isolate was originally recovered from Israel and deposited as Ditylenchus sp. by Xue et al. (Reference Xue, Slonim, Bucki, Mendel, Protasov, Golan, Vieira and Braun Miyara2019), but was subsequently re-identified/transferred to Sychnotylenchus sp. (Ryss et al., Reference Ryss, Chalkin and Subbotin2024). This pair was recovered as sister to S. hibisci, also with strong support (PP = 0.98), forming a well-supported lineage within the genus. In the small-subunit ribosomal DNA phylogeny, it clusters in the same subclade as these two species.
The subclade containing S. golestanicus sp. n., Sychnotylenchus sp. and S. hibisci was clearly separated from S. asiaticus (PX578388, PX578389; PP = 0.91) and S. kulinichi KJ636374, PP574169; PP = 1.00), which formed a sister lineage with maximal support (PP = 1.00), while S. xiphydriae (LC631546) occupied a basal position within the genus. Other representatives of the subfamily, including species of Ficotylus, Neomisticius and Ditylenchus, were placed in more distant lineages. There is no evidence of non-monophyletic lineages in the genus using the current data. The phylogenetic position of S. golestanicus sp. n. is consistent with its morphology.
Type habitat and locality
Nematodes were isolated from decaying bark and wood samples containing galleries and debris of bark beetles (Curculionidae), which were collected from a declining European hornbeam(Carpinus betulus) in ‘Golestan National Park’, Golestan Province, northern Iran (GPS coordinates: 37°22′10.6″N, 55°55′24.8″E).
Type material
The holotype female, together with eight female and five male paratypes, is deposited in the Nematode Collection of the Plant Protection Department, College of Plant Production, Gorgan University, Iran. Additional paratypes, comprising two females and two males, are deposited in the Nematology Collection of the Microbiology Department, University of Limpopo, South Africa, and a further two females and two males are deposited in the WaNaCo Collection, Wageningen, The Netherlands (www.waneco.eu).
Etymology
The species epithet refers to Golestan Province, located in northern Iran, where the new species was discovered.
Discussion
The present population is distinguished by a unique combination of morphological characters, including a comparatively robust body in both males and females, a crustaformeria (eggshell-forming zone) composed of 16 cells arranged in 4 longitudinal rows of 4 large, rounded cells each, and a short, broad tail with a truncate to slightly flattened terminus. The tail terminus is somewhat variable, exhibiting a shallow terminal depression in most specimens.
According to Siddiqi (Reference Siddiqi2000), the subfamily Sychnotylenchinae comprises two genera, Sychnotylenchus and Neoditylenchus, which are distinguished primarily by three characters: (i) lip configuration, with Sychnotylenchus having two lateral sectors smaller than the four submedian (dorsosublateral and ventrosublateral) sectors, whereas Neoditylenchus possesses six subequal sectors; (ii) the position of the excretory pore, situated at or anterior to the level of the median bulb in Sychnotylenchus versus posterior to the nerve ring in Neoditylenchus; and (iii) the structure of the crustaformeria, consisting of four rows of eight or more cells in Sychnotylenchus and six or more cells in Neoditylenchus. However, details of the crustaformeria are lacking in some original species descriptions.
Comparison of these general features indicates that the present population departs in certain respects from both genera and exhibits affinities with members of the family Anguinidae. In lip structure and excretory pore position, it conforms to Sychnotylenchus, whereas the number of crustaformerial cells does not fit the diagnosis of either genus of the Sychnotylenchinae and instead resembles the condition observed in Anguina and Ditylenchus (Siddiqi, Reference Siddiqi2000). Nevertheless, such a taxonomic revision would require a more precise characterisation of the crustaformeria architecture and comprehensive molecular analyses of previously described species. Pending such evidence, we assign the present population to Sychnotylenchus.
Kanzaki et al. (Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022) also considered the number of crustaformerial cells to be an important diagnostic character and suggested that Sychnotylenchus hibisci might warrant placement in a new genus because it did not closely resemble any genus or species of the Sychnotylenchinae and instead showed affinities with Anguina and Ditylenchus. However, the crustaformerial region has not been characterised in several published species descriptions, and in some cases the reported cell counts may be unreliable. In the description of S. kulinichi, the crustaformeria was reported to be enlarged and to overlap the spermatheca; the same condition was observed in the present population. When the focal plane includes a clearly delimited spermatheca, four crustaformerial cells are visible. After changing the focal plane so that the spermatheca becomes indistinct, four additional morphologically similar cells can be observed surrounding the spermathecal region, giving a total of eight cells in a transverse row. This observation suggests that the number of crustaformerial cells may have been underestimated in some previous studies owing to the difficulty of observing this structure (Kanzaki et al. Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022).
Ryss et al. (Reference Ryss, Chalkin and Subbotin2024), in their polytomous key to the genus, employed 24 morphological characters to separate and identify species, emphasising in particular: (i) the position of the excretory/secretory pore relative to the median bulb; (ii) the spicule length to tail length ratio in males; and (iii) the ratio of the posterior uterine sac length to the vulva–anus distance. Notably, the crustaformeria was not included among these 24 characters, suggesting that the authors did not consider it to have high differential value. Kanzaki et al. (Reference Kanzaki, Kajimura, Masuya, Akiba, Ekino, Tsujimoto and Kosaka2022), based on characters such as the excretory pore position at or anterior to the median bulb and the presence of two lateral lips narrower than the remaining labial sectors, accepted Siddiqi’s (Reference Siddiqi2000) concept and placed the genus alongside Neoditylenchus, increasing the number of valid species in Sychnotylenchus to seven. Subsequently, Ryss et al. (Reference Ryss, Chalkin and Subbotin2024), using multilocus molecular data, demonstrated that species of Neoditylenchus are nested within Sychnotylenchus. They further noted that the excretory pore lies at or anterior to the median bulb in Neoditylenchus larvae and, following earlier views (Fortuner & Maggenti Reference Fortuner and Maggenti1987), concluded that the two genera are synonymous. Accordingly, they transferred species previously assigned to Ditylenchus and Neoditylenchus to Sychnotylenchus and recognised 33 valid species under an amended generic diagnosis.
The present phylogenetic analysis supports this expanded concept of Sychnotylenchus. The new species formed a highly supported clade with an unidentified Sychnotylenchus and S. hibisci, indicating a close phylogenetic relationship among these species. Nevertheless, S. golestanicus sp. n. can be readily distinguished from the mentioned above taxa by a combination of morphological characters, including the shape of the female tail, the number of lateral field incisures, the structure of the crustaformeria, the length of the post-vulval uterine sac, and the position of the excretory pore. The congruence between molecular and morphological evidence therefore supports the recognition of S. golestanicus sp. n. as a distinct species. In the pairwise nucleotide difference analysis conducted in MEGA 11 using pairwise deletion, the 18S rDNA sequence of S. golestanicus sp. n. differed from those of validly described congeneric species by 26–35 bp (2.47–3.26%) from S. kulinichi (MG865779, KJ636374), 34 bp (2.40%) from S. asiaticus (PX578388, PX578389), 37 bp (2.61%) from S. hibisci (LC631545), and 87 bp (6.13%) from S. xiphydriae (LC631546). The closest GenBank match was an unnamed isolate, Sychnotylenchus sp. (MG865790), which differed by only 2 bp (0.25%) across the overlapping region of approximately 920 bp. However, an unidentified Sychnotylenchus (MG865790) lacks an associated morphological description and voucher specimen, precluding its reliable assignment to a formally described species. In contrast, the sequence of S. golestanicus sp. n. exhibits 26–87 bp (2.40–6.13%) divergence from all validly described Sychnotylenchus species examined. Taken together with the morphological and other diagnostic characters presented herein, these molecular differences support the recognition of S. golestanicus sp. n. as a distinct species.
The present study has several limitations. First, the taxonomic significance of the crustaformeria remains uncertain because this structure has not been described in detail for several previously reported species, and the reported number of cells may have been underestimated due to difficulties in observing the overlapping spermathecal region using light microscopy alone. Therefore, the number and arrangement of crustaformeria cells should be regarded as a tentative and potentially informative character rather than a definitive diagnostic feature. Transmission electron microscopy (TEM) would be valuable for clarifying the fine structure and organisation of the crustaformeria, confirming the number and arrangement of its cells, and evaluating its potential taxonomic significance within the Sychnotylenchinae. Second, molecular data are currently unavailable for many species assigned to Sychnotylenchus and for the type species of some related genera, limiting a comprehensive assessment of phylogenetic relationships and generic boundaries. Third, the present phylogenetic analysis was based solely on the 18S rDNA marker. Although this marker supports the placement of S. golestanicus sp. n. within Sychnotylenchus and indicates a close relationship with S. hibisci, analyses using additional loci, such as 28S rDNA, ITS rDNA, and mitochondrial genes, would provide greater resolution and a more robust understanding of evolutionary relationships within the group. Future studies incorporating broader taxon sampling, additional molecular markers, TEM observations and re-examination of type and topotype materials will be important for clarifying species boundaries and for evaluating the taxonomic significance of the crustaformeria within the Sychnotylenchinae.
Acknowledgements
The authors gratefully acknowledge the financial support provided by Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran. They also thank Dr. Pedram and Dr. Atighi (Tarbiat Modares University, Tehran, Iran) for their assistance in capturing the microscopic images of the new species.
