Introduction
Intrauterine growth retardation (IUGR) and low birth weight induced by maternal undernutrition are associated with an increased risk of developing metabolic disorders in adulthood. These observations led to the concept of ‘Developmental Origin of Health and Disease’ also called ‘fetal programming.’Reference Barker 1 , Reference Ravelli, van Der Meulen, Osmond, Barker and Bleker 2 To unravel the underlying mechanisms, we used a model of maternal 70% food restriction in pregnant female rats throughout gestation (called FR30). We showed that maternal FR30 induces IUGR and programs energy metabolism disturbances in adult male rat offspring. They displayed mild hypertension, hypercorticosteronemia and subtle food intake modifications.Reference Rivière, Michaud and Breton 3 , Reference Breton, Lukaszewski and Risold 4 Despite normoglycemia and normoinsulinemia, they exhibited mild glucose intolerance, with a defect in glucose-induced insulin secretion during a glucose tolerance test.Reference Breton, Lukaszewski and Risold 4 Although showing a lean phenotype, adult male rat offspring from FR30 dams were predisposed to adiposity exhibiting adipocyte hypertrophy and hyperleptinemia.Reference Lukaszewski, Mayeur and Fajardy 5 Maternal undernutrition programs adult male offspring white adipose tissue (WAT) gene expression profile. In particular, obesity-prone adult offspring from FR30 dams displayed higher expression of leptin messenger RNA (mRNA).Reference Lukaszewski, Mayeur and Fajardy 5 Lower expression of leptin receptor mRNA associated with reduced leptin-induced STAT3 phosphorylation suggested that leptin sensitivity was impaired in WAT of adult male offspring from FR30 dams. Post-weaning high-fat diet (HFD) exacerbated this profile.Reference Lukaszewski, Mayeur and Fajardy 5
Thus, WAT may represent a prime target of metabolic programming induced by maternal undernutrition. We hypothesized that other adipokines, such as apelin, might be a target of maternal undernutrition.Reference Breton 6 , Reference Lukaszewski, Eberlé, Vieau and Breton 7 Indeed, apelin is a relatively recent member of the adipokine family identified as an endogenous ligand of the apelin receptor APJ.Reference Tatemoto, Hosoya and Habata 8 Apelin and APJ are expressed in many mammalian tissues including WAT.Reference Hosoya, Kawamata and Fukusumi 9 The apelinergic system controls various aspects of energy metabolism and is dysregulated in metabolic syndrome. In humans and mice, plasma apelin levels are increased in obesity,Reference Heinonen, Purhonen and Miettinen 10 diabetesReference Soriguer, Garrido-Sanchez and Garcia-Serrano 11 and with insulin resistance.Reference Dray, Debard and Jager 12 Apelin expression is increased in adipocytes of obese patients.Reference Boucher, Masri and Daviaud 13 Apelin is also known for its anti-obesity and anti-diabetic properties.Reference Castan-Laurell, Dray, Knauf, Kunduzova and Valet 14 Apelin decreases WAT mass and triglyceride levels in obese mice, whereas apelin knock-out mice exhibit increased adiposity and serum-free fatty acid levels due to enhanced lipolysis.Reference Yue, Jin and Xu 15 , Reference Than, Cheng and Foh 16 In addition, apelin modulates adipogenesisReference Than, Cheng and Foh 16 , Reference Zhu, Cheng, Zhu and Guan 17 and promotes browning of WAT.Reference Than, He and Chua 18 Apelin also improves insulin secretionReference Chen, Zheng and Zhang 19 and insulin sensitivity by promoting glucose utilization in adipose and muscle tissues.Reference Dray, Knauf and Daviaud 20 In this context, we decided to investigate whether maternal FR30 would modify plasma apelin levels and apelin/APJ gene expression levels in WAT in adult male offspring. We also assessed whether post-weaning HFD would impact on these parameters.
Materials and methods
Animal use accreditation was granted by the French Ministry of Agriculture (no. 04860). Experiments were conducted in accordance with the principles of laboratory animal care (European Communities Council Directive of 1986, 86/609/EEC). Wistar rats were purchased from Charles River Laboratories (L’Arbresle, France). After mating, pregnant females were transferred into individual cages with free access to water and to standard chow diet (SAFE 04, 2900 cal/g, containing 16% protein, 3% fat, 60% carbohydrates; UAR, Augy, France). Control pregnant dams were fed ad libitum with a standard diet (NCD), whereas pregnant dams from the food-restricted group were fed 30% (FR30) of the daily intake of NCD pregnant dams, from day 1 (E1) of pregnancy until delivery (E21). At parturition, litter size was adjusted to eight pups per dam. To obviate any litter effects, animals used for further experiments were randomly chosen in different litters and only a limited number of animals (n=1–2) was used from each litter. Food-restricted pups were nursed by FR30 dams fed ad libitum during lactation. After weaning, male offspring from both groups (NCD and FR30) were housed individually. They were fed either a standard (NCD) or an HFD (SAFE, D12451, 4720 cal/g, containing 23% protein, 23% fat, 40% carbohydrates; UAR) composing four groups (NCD/NCD, NCD/HFD, FR30/NCD, FR30/HFD; n=16/group). Offspring’s body weight were measured weekly until adulthood. At 4 months of age, male rat offsprings were killed between 9 and 10 am after 16-h overnight fasting. Trunk blood samples were collected and plasma was stored at −20°C. Gonadal (GWAT) and perirenal (PWAT) WAT fat pads were rapidly removed, weighed, frozen in liquid nitrogen and stored at −80°C. A commercially available enzyme-linked immunosorbent assay kit was used to measure plasma apelin levels (Phoenix Pharmaceuticals, Burlingame, CA, USA) that assays all isoforms of apelin from apelin-12 to apelin-36. Methods for quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis have been previously described.Reference Lukaszewski, Mayeur and Fajardy 5 RT-qPCR was performed with a LightCycler480 SYBR Green I Master and a LightCycler480 (Roche). Primers for APLN (forward: GCATGAATCTGAGTTTCTGCGTGCA, reverse: GCTTTAGAAAGGCATGGGTCCCTTA), APLNR (forward: CCTTCATCATCATGCTGACCTGTT, reverse: TGCATCGGTTCTCCTCCCTTGCACA) genes were designed using the Primer Premier software (Premier Biosoft International). The level of gene expression was normalized to three reference genes (cyclophilin A, β2 microglobulin, lactate dehydrogenase A).Reference Lukaszewski, Mayeur and Fajardy 5 Methods for Western blot analysis have been previously described.Reference Lukaszewski, Mayeur and Fajardy 5 Frozen GWAT and PWAT were homogenized in lysis buffer: 250 mm sucrose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid-Tris, 1 mM ethylenediaminetetraacetic acid, 1% Triton X-100, protease inhibitor cocktail 4-(2-aminoethyl)benzenesulfonyl fluoride, pepstatin A, E-64, bestatin, leupeptin and aprotinin, and phosphatase inhibitor cocktail (10 mM sodium fluoride, 1 mM sodium orthovanadate, 20 mM sodium β-glycerophosphate and 10 mM benzamidine). Protein concentrations were determined using a protein assay kit (Bio-Rad, France). Proteins were subjected to 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis gels and transferred onto nitrocellulose membranes. Blots were blocked with 5% bovine serum albumin (Sigma, France) and then incubated in the presence of appropriate primary antibodies (rabbit anti-rat APJ; Santa Cruz Biotechnology, Heidelberg, Germany) and secondary antibodies. Mouse anti-rat actin antibody (Sigma-Aldrich, Saint-Quentin-Fallavier, France) was used as a loading control. Following nitrocellulose membrane washing, targeted proteins (50 kDa for APJ, 42 kDa for actin) were revealed using enhanced chemiluminescence reagents (Amersham Life Science, Les Ulis, France) according to the manufacturer’s recommendations. The intensity of bands was quantified by using Quantity One Bio-Rad and the APJ/actin ratios were calculated. All data are presented as means±s.e.m. Statistical analysis was performed by two-way analysis of variance [maternal diet (MD) and post-weaning diet (PWD) as co-factors] followed by Tukey’s post-hoc analysis. Mann–Whitney test was used for Western blot analysis. A P level<0.05 was considered as statistically significant.
Results
FR30/NCD rats had 1.6-fold higher plasma apelin levels compared with NCD/NCD animals. By contrast, no difference of plasma apelin levels was observed in FR30/HFD v. NCD/HFD rats (Fig. 1a). MD and PWD affected apelin gene expression in both fat depots of adult rat offspring. In GWAT (Fig. 1b) and PWAT (Fig. 1c), a tendency toward increased apelin mRNA levels was observed in FR30/NCD (1.9-fold and 1.8-fold, respectively) compared with NCD/NCD rats. This is consistent with increased levels of serum apelin in FR30/NCD animals (Fig. 1a). In GWAT and PWAT, apelin mRNA levels were increased to a similar extent in NCD/HFD v. NCD/NCD rats (4.6-fold and 4.5-fold, respectively) and FR30/HFD v. FR30/NCD rats (3.3-fold and 2.8-fold, respectively). MD and PWD affect APJ gene expression in GWAT (Fig. 2a), whereas only PWD affects APJ gene expression in PWAT (Fig. 2b) of adult rat offspring. In GWAT and PWAT, APJ mRNA levels were markedly increased in FR30/HFD v. FR30/NCD rats (1.7-fold and 2.2-fold, respectively). The increase of AJP protein expression in FR30/HFD v. FR30/NCD rats (1.9-fold) was confirmed by Western blot analysis in both fat depots (Fig. 2c and 2d).
Plasma apelin levels (a) and messenger RNA (mRNA) expression levels of apelin in gonadal white adipose tissue (GWAT) (b) and perirenal white adipose tissue (PWAT) (c) in adult NCD and FR30 rats under standard (NCD) and high-fat diet (HFD). Values are means±s.e.m. (n=10/group). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 v. NCD/NCD; # P<0.05, ## P<0.01 v. NCD/HFD; § P<0.05, §§ P<0.01 v. FR30/NCD. MD, maternal diet; PWD, post-weaning diet; FR30, 70% food restriction.
Messenger RNA (mRNA) expression levels of APJ in gonadal white adipose tissue (GWAT) (a) and perirenal white adipose tissue (PWAT) (b) in adult NCD and FR30 rats under standard (NCD) and high-fat diet (HFD). Values are means±s.e.m. (n=10/group). *P<0.05, **P<0.01, ***P<0.001 v. NCD/NCD; ## P<0.01 v. NCD/HFD; § P<0.05 v. FR30/NCD. Western blot analysis of APJ in GWAT (c) and PWAT (d) protein extracts from adult NCD and FR30 rats under NCD or HFD. Representative Western blot of three similar analyses are shown. Lung was used as a positive control. Values are means±s.e.m. (n=4/group). *P<0.05, NCD v. HFD in the same condition. MD, maternal diet; PWD, post-weaning diet; FR30, 70% food restriction.
Discussion
We have previously shown that maternal FR30 programs metabolic disorders in adult male rat offspring. In particular, they exhibited impaired glucose tolerance with a defect in glucose-induced insulin secretion.Reference Breton, Lukaszewski and Risold 4 Obesity-prone adult male rat offspring from FR30 dams displayed hyperleptinemia, adipocyte hypertrophy with changes in adipogenic gene expression levels (i.e. leptin/leptin receptor) in WAT, especially after post-weaning HFD.Reference Lukaszewski, Mayeur and Fajardy 5 Here, we demonstrate that offspring’s apelinergic system is also altered as a consequence of maternal undernutrition. Indeed, adult male rat offspring exhibited hyperapelinemia as well as a tendency toward increased apelin mRNA levels in two different fat pads. Post-weaning HFD resulted in additional gene expression increases of genes in the apelinergic system in WAT, regardless of MD. However, a marked difference in the level of AJP protein was only observable in rat offspring from FR30 dams under HFD. Elevated plasma apelin levels may result, at least in part, from elevated WAT apelin release as has been reported in obese patients.Reference Chen, Zheng and Zhang 19 However, elevated plasma apelin may also originate from other tissues.Reference Hosoya, Kawamata and Fukusumi 9 As observed in different HFD-fed rodent models of obesity and in type 2 diabetic and obese patients, the expression of apelin/APJ in WAT was positively correlated with fat mass and glucose intolerance.Reference Soriguer, Garrido-Sanchez and Garcia-Serrano 11 , Reference Dray, Debard and Jager 12 , Reference Castan-Laurell, Dray, Knauf, Kunduzova and Valet 14 , Reference Butruille, Drougard and Knauf 21 Increased plasma apelin levels may participate in impairing glucose-stimulated insulin secretion observed in adult male rat offspring from undernourished dams.Reference Breton, Lukaszewski and Risold 4 , Reference Sörhede Winzell, Magnusson and Ahrén 22 In line with our previous observations,Reference Lukaszewski, Mayeur and Fajardy 5 it is tempting to speculate that the up-regulation of AJP in WAT of rat offspring from FR30 dams under HFD might represent an adaptive mechanism for limiting the development of WAT and fat accumulation. Indeed, apelin inhibits adipogenesis,Reference Than, Cheng and Foh 16 , Reference Zhu, Cheng, Zhu and Guan 17 decreases lipid storage,Reference Higuchi, Masaki and Gotoh 23 promotes browning in WAT and activates energy expenditure.Reference Than, He and Chua 18 However, further experiments are needed to determine whether apelin sensitivity is modified in WAT of rat offspring from FR30 dams. Elevated leptin expression in adult mice from undernourished dams was shown to be correlated with hypomethylation of the leptin promoter in WAT.Reference Jousse, Parry and Lambert-Langlais 24 Although the underlying programming mechanisms remain elusive, the up-regulation of apelin in WAT of rat offspring from FR30 dams might also result from altered epigenetic control as described in pulmonary edema.Reference Mishra, Kohli and Dua 25 Together, our data show that, in addition to leptin, apelin is another adipokine target of fetal programming in WAT of adult rat offspring from undernourished dams.
Acknowledgments
The authors thank Anne Dickes-Coopman and Charlène Pourpe for their excellent technical assistance.
Financial Support
This study was supported by grant from the French Ministry of Education.
Conflicts of Interest
None.
Ethical Standards
The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national guids on the care and use of laboratory animals (European Communities Council Directive of 1986, 86/609/EEC) and has been approved by the institutional committee (French Ministry of Agriculture No. 04860).
