INTRODUCTION
Trypanosomes are flagellated blood parasites transmitted primarily by haematophagous arthropods and able to infect all classes of vertebrates. There are limited data on trypanosomes in Australian mammals, with only 6 species named and a number of novel trypanosome genotypes, most with limited genetic data with the exception of isolates from a wallaby and a kangaroo. The 6 trypanosome species identified in Australian mammals are T. thylacis from the short-nosed bandicoot (Isoodon macrourus) (Mackerras, Reference Mackerras1959), T. pteropi from the black flying fox (Pteropus gouldii) (Mackerras, Reference Mackerras1959), T. hipposideri from the dusky horse-shoe bat (Hipposideros bicolor albanensis) (Mackerras, Reference Mackerras1959), T. binneyi from the platypus (Ornithorhynchus anatinus) (McMillan and Bancroft, Reference McMillan and Bancroft1974), T. copemani from the Gilbert's potoroo (Potorous gilbertii), the quokka (Setonix brachyurus) and common wombat (Vombatus ursinus) (Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999; Austen et al. Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009) and T. irwini from the koala (Phascolarctos cinereus) (McInnes et al. Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009). In addition to these named species there are also good genetic data for 2 novel trypanosome genotypes reported from a wallaby (ABF) (Hamilton et al. Reference Hamilton, Stevens, Gaunt, Gidley and Gibson2004) and a kangaroo (H25) (Stevens et al. Reference Stevens, Noyes and Gibson1998; Hamilton et al. Reference Hamilton, Stevens, Gaunt, Gidley and Gibson2004) as well as some limited genetic data from a range of other native Australian mammals.
The koala has a fragmented distribution in the eastern states of Australia ranging from north-east Queensland (Qld) to the Eyre Peninsula in South Australia (S.A.). European settlement had a dramatic effect on the range and population numbers of koalas. Factors which have affected koala abundance include land clearance for agriculture and urban development, hunting for the fur industry (historical event), spread of infectious diseases (notably chlamydiosis), increased incidents of motor vehicle strike and dog attacks in combination with natural phenomena such as wildfires and drought. As a result, the regional conservation status of the koala varies from secure in some areas to vulnerable or extinct in others. The koala is currently classified as vulnerable to extinction in New South Wales (N.S.W.) under the N.S.W. Threatened Species Conservation Act 1995 No. 101, as Schedule 2 ‘Vulnerable species’ and in parts of Qld under the Qld Nature Conservation (Wildlife) Regulation 2006 as Schedule 3 ‘Vulnerable wildlife’.
The present study describes the genetic characterization of a novel trypanosome in koalas as well as the host range extension of T. copemani to include the koala. We consider the new trypanosome described in koalas to be a novel trypanosome species and propose the name Trypanosoma gilletti sp. n.
MATERIALS AND METHODS
Sources of isolates and sample collection
A total of 139 blood samples (99 from Qld and 40 from N.S.W. koalas) were collected as part of routine procedures from koalas that were presented to the Australian Wildlife Hospital at Beerwah, Qld during 2006–2009. More than 600 koalas per annum are presented to the hospital from south-east Qld and northern N.S.W. In addition to the blood samples, 29 spleen tissue samples were collected from koalas presented to the Moggil Koala Hospital, operated by the Queensland National Parks and Wildlife during 2006–2007. Koalas were either dead at the time of presentation or euthanased on humane grounds. These koalas came from south-east Qld with most originating from the greater Brisbane area. Details of the geographical origin (state and shire; local government defined area) of each of the koalas as well as sex, age and reason for admission were recorded.
For clinical examination and blood collection, koalas were anaesthetized with an intramuscular administration of alfaxalone (Alfaxan® CD RTU, Jurox Australia) at an approximate dose rate of 3 mg/kg. Anaesthesia was maintained with a combination of oxygen and isoflurane delivered by either mask or endotracheal intubation. Blood samples of approximately 0·5–1 ml were collected by venepuncture of the cephalic vein. The blood was mixed with EDTA in a Vacutainer® tube (Becton-Dickinson, NJ, USA) and stored at −20°C. All veterinary procedures were performed by registered wildlife veterinarians in accordance with standard veterinary practice.
Morphological measurements
Thin-blood smears were stained with Wright-Giemsa stain (Hematek® Stain Pak) using a Hema-Tek Slide Stainer (Ames Company Division, Miles Laboratories Pty Ltd, Springvale Victoria, Australia). The slides were then air-dried and a cover-slip mounted using DePeX mounting medium Gurr (Merck Pty. Limited, Kilsyth, Victoria, Australia).
Digital light micrograph images of any trypomastigotes observed in blood films were taken at ×1000 magnification. Morphological measurements (total length, breadth, kinetoplast to anterior (KA), kinetoplast to nucleus (KN), posterior to kinetoplast (PK) and free flagellum (FF)) of the trypomastigotes were made using Image-Pro Express software (Media Cybernetics, Inc., Bethesda, MD, USA) and the means and standard errors calculated. Morphological features were measured and compared to the published T. copemani from the quokka and Gilbert's potoroo (Austen et al. Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009) and T. irwini from the koala (McInnes et al. Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009). The statistical significance of any differences was tested using a one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference test at a 95% confidence limit using the software Statistics Package for Social Sciences (SPSS Inc, Chicago, IL, USA). The appropriateness of using the ANOVA was assessed by applying Levene's test for the homogeneity of variances. Measurements which demonstrated differences in variances were analysed with Tamhane's P2 test and Dunnett's T3 test in SPSS.
In vitro culturing
Attempts were made to isolate trypanosomes from whole blood samples of 17 koalas into in vitro cultures. Twenty microlitres of blood were placed into 2 ml Cryo.s™ cryopreservation vials (Greiner Bio-One GmbH, Solingen, Germany) containing 1 ml of Modified Sloppy Evans Medium (MSEM) (Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999). Inoculated vials were maintained in the dark at room temperature for 10–14 days. Microscopic examination of wet-smear preparations from the medium was performed for the detection of motile trypanosomes at 200× and 400× magnification once a week, for 3 weeks, after the first 10–14 day incubation.
DNA extraction
Whole genomic DNA was extracted from koala blood using a MasterPure™ DNA Purification Kit (EPICENTRE® Biotechnologies, Madison, WI, USA). DNA was eluted in 50 μl of water and stored at −20°C until use. A DNA extraction blank (with no blood added) was included with each batch of DNA extractions. DNA from spleen tissue was extracted using a QIAGEN DNeasy Blood & Tissue Kit (QIAGEN Pty Ltd, Doncaster Victoria, Australia) and stored at −20°C until use.
18S rDNA amplification and sequencing
DNA was screened for the presence of trypanosomatid 18S rDNA as previously described by McInnes et al. (Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009) with the correction of primer S823 (cgaacaactgccctatcagc) sourced from Maslov et al. (1996) rather than S825 being used in conjunction with primer S662 as incorrectly stated. The approximate 1500 bp fragment of 18S rDNA generated includes variable regions V3, V4, V6 and the V7–V8 variable region used by Da Silva et al. (Reference Da Silva, Noyes, Campaner, Junqueira, Coura, Anez, Shaw, Stevens and Teixeira2004) to distinguish trypanosomes. All controls (negative and positive PCR controls and DNA extraction blanks) produced appropriate PCR results. All positive PCR products were purified using a MO BIO UltraClean™ 15 DNA Purification Kit (MO BIO Laboratories Inc. West Carlsbad, CA, USA) and sequenced using an ABI Prism™ Terminator Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) on an Applied Biosystem 3730 DNA Analyzer. All sequences that produced mixed chromatograms indicating mixed DNA sequence templates were cloned using a pGEM®-T Easy Vector System II (Promega Corporation, Madison, WI, USA) and at least 10 clones picked and DNA sequenced.
gGAPDH amplification and sequencing
DNA samples positive by 18S rDNA PCR were screened with glycosomal glyceraldehyde phosphate dehydrogenase (gGAPDH) primers as previously described in McInnes et al. (Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009). Trypanosome phylogenetic analysis now routinely incorporates analysis of the gGAPDH gene, a tool pioneered by Hamilton et al. (Reference Hamilton, Stevens, Gaunt, Gidley and Gibson2004), as the utility of 18S rDNA for deep level phylogeny has been questioned (Hamilton et al. Reference Hamilton, Stevens, Gaunt, Gidley and Gibson2004). All negative and positive PCR controls produced appropriate PCR results. DNA sequencing was conducted as described above.
Phylogenetic analysis
Nucleotide sequences generated for the 18S rDNA (1582 bp) and gGAPDH (810 bp) loci of 1 T. gilletti and 4 T. copemani (koala) isolates were aligned with sequences from a number of related trypanosomatids from GenBank and their phylogeny inferred using Maximum Likelihood analysis by the program PhyML (Dereeper et al. Reference Dereeper, Guignon, Blanc, Audic, Buffet, Chevenet, Dufayard, Guindon, Lefort, Lescot, Claverie and Gascuel2008) using the GTR (+I+G) model of evolution (Lanave et al. Reference Lanave, Preparata, Saccone and Serio1984). The reliability of the inferred trees was assessed by the approximate likelihood ratio test (aLRT) (Anisimova and Gascuel, Reference Anisimova and Gascuel2006), a statistical test of branch support and an alternative to non-parametric bootstrap branch support estimation. The appropriate model of nucleotide substitution (GTR+I+G) for ML analysis was chosen using the Akaike information criterion (Akaike, Reference Akaike1974) in the software program jModeltest 0.1.1 (Posada, Reference Posada2008).
Parsimony analysis and measurement of genetic distance using the Jukes-Cantor model (±standard error) (Jukes and Cantor, Reference Jukes, Cantor, Manro, , Allison and 1969) were conducted using Mega version 4 (Mega4: Molecular Evolutionary Genetics Analysis software, Arizona State University, Tempe, AR, USA) (Tamura et al. Reference Tamura, Dudley, Nei and Kumar2007). All codon positions were included and all positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). Bootstrap analysis was conducted using 1000 replicates to assess the reliability of inferred tree topologies. The Jukes-Cantor model was chosen following the guidelines of Nei and Kumar (Reference Nei and Kumar2000).
The relationship between T. gilletti and the 4 T. copemani (koala) isolates, a chuditch (Dasyurus geoffroii) (CHA1) and a number of woylie (Bettongia penicillata) derived trypanosome isolates (T. sp. TRY1, TRY2, WYA1 and WYA2) (Smith et al. Reference Smith, Clark, Averis, Lymbery, Wayne, Morris and Thompson2008; Averis et al. Reference Averis, Thompson, Lymbery, Wayne, Morris and Smith2009) were also analysed. The analysis was only based on a short region (∼480 bp) of 18S rDNA sequence because only small 18S rDNA fragments are presently available from GenBank for the chuditch and woylie derived trypanosome isolates. An analysis with a 1019 bp sequence of 18S rDNA was also performed to investigate the relationship of the T. copemani (koala) isolates and T. copemani genotypes A and B from the quokka and Gilbert's potoroo (Austen et al. Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009) because longer (1550 bp) sequences were not available for the T. copemani genotypes A and B.
The GenBank nucleotide sequences used in the 18S rDNA and gGAPDH phylogenetic analysis are presented in Table 1.
The GenBank Accession numbers of the sequences used in the phylogenetic analysis
RESULTS
Trypanosoma 18S rDNA PCR screen
Screening for the presence of trypanosome DNA using an 18S rDNA PCR detected the presence of a trypanosomatid in 78/139 (56·1%) blood samples and 2/29 (6·9%) koala spleen samples tested (Table 2). Single trypanosome infections were determined in 76/139 blood samples; 71/139 (51·1%) were T. irwini, 2/139 (1·4%) were T. gilletti (Lanie and Timbo) and 3/139 (2·2%) were T. copemani (Harrison, Cameron and Mika). Dual infections were determined in 2/139 (1·4%) blood samples; one was a mixed infection of T. irwini/T. copemani (Charlton) and another was T. irwini/T. gilletti (Barbie). The 2 positive spleen DNA samples (K27 and K28) were determined to be single infections of T. gilletti. There were no koalas exhibiting co-infection of T. copemani and T. gilletti.
Details of the koalas from which spleen or blood samples tested positive by 18S rDNA PCR and DNA sequencing for Trypanosoma copemani and/or Trypanosoma gilletti
18S rDNA sequencing
ClustalW alignment (http://align.genome.jp/) of the partial 18S rDNA sequences revealed the 5 isolates of T. gilletti (K27, K28, Timbo, Lanie and Barbie) to be genetically distinct from other known trypanosome species and 100% identical to each other. A DNA sequence for the 18S rDNA locus of T. gilletti (Lanie) (1595 bp) was deposited in the GenBank database under Accession number GU966589.
A single 18S rDNA sequence for the 4 T. copemani (koala) isolates was deposited under Accession number GU966588 (isolate Charlton) as the sequences generated for the 4 isolates (Cameron, Charlton, Harrison and Mika) were 100% identical.
gGAPDH gene sequencing
Partial fragments of the gGAPDH gene were amplified from 2 of the T. gilletti-infected koalas, Lanie (895 bp) and Timbo (683 bp). The overlapping region (683 bp) of the gGAPDH sequences generated from the two koalas was 100% identical and therefore a single sequence from Lanie (895 bp) was submitted to GenBank under Accession number GU966587. Three T. copemani gGAPDH genotypes were successfully amplified from 4 koalas (Cameron, Charlton, Harrison and Mika). DNA sequences for the gGAPDH locus from koalas Mika and Charlton and the identical genotype determined from Harrison and Cameron were submitted to GenBank under Accession numbers GU966585, GU966584 and GU966586 respectively.
Phylogenetic analysis
A concatenated ML tree of 18S rDNA (1582 bp) and gGAPDH (810 bp) sequences revealed that T. gilletti was genetically distinct and grouped with the T. copemani clade which consisted of T. copemani isolates from quokkas and potoroos, T. pestanai isolated from badgers and an isolate (KG1) from a tick (Fig. 1). Maximum likelihood and parsimony analysis produced similar tree topology to the ML analysis and bootstrap values for these analyses were added to ML tree (Fig. 1). Analysis of 18S rDNA and gGAPDH loci individually revealed the same clade associations as the concatenated tree and these trees are therefore not included.
Phylogenetic analysis of the relationships of Trypanosoma spp. and novel trypanosomatid Trypanosoma gilletti isolates from the koala based on composite gGAPDH and 18S rDNA partial sequences (∼810 bp and ∼1582 bp respectively) using Maximum Likelihood analysis performed by PhyML 3.0. Branch support/bootstrap values for PhyML, Maximum Parsimony and Distance analyses respectively are indicated at the left of each node. (a) Phylogenetic position of T. copemani isolates (Q10, Q3, P94 and P63), T. sp. TRY1, TRY2, WYA1, WYA2 and CHA1 (∼480 bp 18S rDNA only). Scale bars represent substitutions/site.
At the 18S rDNA locus, T. gilletti had a 2·7±0·5% (2·9±0·8% over V7–V8 region) and 4·0±0·6% (3·3±0·8% over V7–V8 region) genetic distance±standard error (s.e.) from T. copemani (wombat AAP, H26) and T. pestanai respectively. At the gGAPDH gene the percentage genetic distance (±s.e.) between T. gilletti and T. copemani (wombat AAP) and between T. gilletti and T. pestanai was 8·6±1·1% and 18·4±1·6% respectively. The 18S rDNA genetic distance matrix for T. gilletti, T. copemani isolates and related trypanosomes are presented in Table 3A and B, depending on length of sequence available for analysis.
Matrix of Jukes-Cantor percentage genetic distances (±standard error) of partial 18S rRNA gene sequence of various Trypanosoma spp. most closely related to the novel trypanosome Trypanosoma gilletti
The phylogenetic relationship of T. gilletti and some Australian marsupial trypanosome isolates for which only short (∼480 bp) 18S rDNA sequences were available is presented in Fig. 1a. The genetic distance (±s.e.) between T. gilletti and trypanosomes identified in the woylie (T. sp. TRY1, TRY2, WYA1 and WYA2) and chuditch (CHA1) over a shorter 18S rDNA sequence (∼480 bp) was 3–4·6±1·3% (Table 3B).
Novel species description
Trypanosoma gilletti sp. n.
Diagnosis: Phylogenetic analysis of partial fragments of the 18S rDNA and gGAPDH gene of the trypanosome.
Taxonomic summary
Vertebrate host: Koala (Phascolarctos cinereus)
Invertebrate host: Unknown
Type location: Redland Shire, Qld, Australia
Additional locations: Gold Coast, Qld, Australia
Site of infection: Blood and spleen tissue.
Pre-patent and patent periods: Unknown
Etymology: This species is named Trypanosoma gilletti after wildlife veterinarian Dr Amber Gillett who has contributed significantly to our knowledge of trypanosome infections in koalas.
(a and b) Trypomastigotes observed in thin blood smears from a koala (Barbie) stained with Wright-Giemsa. The trypomastigote nucleus stained pink (n) and the dark stained sphere at the distal end, the kinetoplast (k) are labelled in both figures. Scale bar represents 10 μm.
Trypomastigote morphology
No trypomastigotes were observed in the blood smears of the koalas infected solely with T. gilletti. A koala (Barbie), determined using molecular analysis to have a mixed infection of T. irwini and the novel trypanosome T. gilletti, appeared to have 2 distinct trypomastigote morpho-types; one of which corresponded to T. irwini (Fig. 2b) and one which was unique (Fig. 2a). Trypomastigotes of T. copemani were noted in blood smears from 2 koalas (Harrison and Cameron). Measurements of morphological parameters (length, breadth, PK, NK, NA and FF) of 13 trypomastigotes from the koala Barbie and 25 trypomastigotes observed from a young male T. copemani-positive koala (Harrison) are listed in Table 4. Images of a selection of these measured trypomastigotes are presented in Fig. 3a and b. Morphological measurements of T. copemani trypomastigotes from koalas were significantly different (P<0·05) to all the morphological features measured from T. copemani trypomastigotes from the Gilbert's potoroo and to PK and FF measurements from the quokka (Table 4). The morphological measurements of 12 trypomastigotes with similar morphology from the koala Barbie, when compared with T. irwini from the koala, were not significantly different (P<0·05) in length, breadth, KN, NA or FF measurements. The morphological measurements of the unique trypomastigote from Barbie were outside of the 99% confidence intervals of morphological measurements from T. copemani from quokka, Gilbert's potoroo and koalas and T. irwini with the exception of measured FF (Table 4).
(a and b) Trypomastigotes of Trypanosoma copemani in thin blood smears from a koala (Harrison) stained with Wright-Giemsa. The trypomastigote nucleus stained pink (n) and the dark stained sphere at the distal end, the kinetoplast (k) are labelled in (a).
Mean measurements, range and standard error (s.e.) of morphological features of trypomastigotes observed in the blood of 2 koalas (Phascolarctos cinereus) (koala isolates Harrison and Barbie)
(Total length: length of body measured along the mid-line including free flagellum (total length). Breadth: maximum breadth measured at the level of the nucleus (including undulating membrane). PK: distance between the posterior end and the kinetoplast. KN: distance between the kinetoplast and posterior edge of the nucleus. NA: distance between the anterior edge of the nucleus and the anterior end of the body. FF: length of the free flagellum.)
In vitro culturing attempts
Of the 17 koalas selected for in vitro culturing attempts, 7 were determined to be trypanosome negative, 8 were infected with T. irwini, 1 with T. gilletti (koala isolate Timbo) and none were infected with T. copemani. Examination of wet smears and stained smears did not detect any trypanosomes in any of the inoculated media.
DISCUSSION
The present study provides the description of a second novel Trypanosoma sp. in koalas and the extension of the host range of another Australian marsupial trypanosome T. copemani to include koalas. The study shows that T. gilletti is present in lower levels in the koala population compared with T. irwini, the first trypanosome to be described from koalas. The results of the present study extend the analysis presented in the previous description of T. irwini (McInnes et al. Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009), which reported a prevalence of 38·2% for T. irwini in 68 koalas examined. Analysis of a larger number of koalas has identified a higher prevalence of T. irwini, perhaps augmented by seasonal variation of vectors and/or koala habits.
The new koala trypanosome, T. gilletti, identified in the present study, is phylogenetically distinct from T. irwini and most closely related to the Australian marsupial trypanosome T. copemani, which has been isolated from common wombats, quokkas and Gilbert's potoroos (Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999; Hamilton et al. Reference Hamilton, Stevens, Gidley, Holz and Gibson2005; Austen et al. Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009). However, analysis of a shorter region of the 18S rDNA sequence, which included isolates not included in the concatenated analysis (due to the small size of the 18S rDNA sequence available (∼480 bp) and the lack of corresponding gGAPDH sequences for these isolates) suggests that T. gilletti is most closely related to trypanosome isolates from a chuditch (CHA1) and a number of woylies (T. sp. TRY1, TRY2, WYA1 and WYA2) in Western Australia (WA). The most informative phylogenetic analysis for T. gilletti and T. copemani (koala) therefore only includes in the T. copemani clade data from T. copemani (wombat AAP), T. sp. (KG1) and T. pestanai, as these are the only T. copemani clade isolates with available gGAPDH sequences. The overall topology of the concatenated 18S rDNA and gGAPDH ML tree produced in order to determine the evolutionary position of T. gilletti amongst the trypanosomes was similar to equivalent trees previously presented (Hamilton et al. Reference Hamilton, Gibson and Stevens2007; McInnes et al. Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009; Viola et al. Reference Viola, Almeida, Ferreira, Campaner, Takata, Rodrigues, Paiva, Camargo and Teixeira2009). The placement of T. gilletti in the T. copemani clade was supported by high aLRT branch support and bootstrap values (99–100%) in the 18S rDNA and gGAPDH analysis individually and in the concatenated analysis.
Trypanosoma copemani which was identified for the first time in 3 koalas appears to be a somewhat ubiquitous Australian trypanosome infecting a range of Australian marsupials from different parts of Australia. To date it has been identified in 3 wombats (Vombatus ursinus) originating from Launching Place, Victoria (Vic.) (H26) (Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999), from unknown locations in eastern Australia (AAP and AAI) (Hamilton et al. Reference Hamilton, Stevens, Gaunt, Gidley and Gibson2004, Reference Hamilton, Stevens, Gidley, Holz and Gibson2005), and in the Gilbert's potoroo (Potorous gilbertii) and the quokka (Setonix brachyurus) from Two Peoples Bay, WA (Austen et al. Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009; Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999). Though strict host specificity is the rule for some trypanosomes, species such as T. evansi, T. cruzi (Burleigh and Andrews, Reference Burleigh and Andrews1995) and T. rangeli (Anez, Reference Anez1982) are known to have wide host ranges. Trypanosoma copemani has now been identified in 4 species of Australian marsupials from 3 suborders of the order Diprotodontia from diverse locations in Australia.
The observation that koalas from the same geographical areas were simultaneously infected with up to 2 trypanosome species is interesting because it may impact the outcome of infection in these individuals. Mixed infections were identified in this study in 2 koalas and it is possible with the application of species-specific genetic tools that the prevalence of mixed infections in koalas is in fact higher. It is important to consider the effect mixed infections may have in modulating trypanosome infections in koalas when making inferences about the likely clinical significance of any individual trypanosome species. Animals experimentally infected with a mixture of T. cruzi strains with different levels of pathogenicity have been reported to show significantly different patterns or parasitaemia and/or pathogenicity (Franco et al. Reference Franco, Vago, Chiari, Meira, Galvao and Machado2003; Martins et al. Reference Martins, Toledo, Veloso, Carneiro, Machado-Coelho, Tafuri, Bahia, Valadares, Macedo and Lana2006).
No definitive morphological measurements of T. gilletti were able to be made as no trypomastigotes were observed in the blood smears of the 2 koalas with T. gilletti singular infections. Although a trypanosome was observed in a wet smear from one of these koalas (Timbo), no trypomastigotes were found in fixed and stained thin-blood smears and consequently no morphological measurements could be made. The only possible T. gilletti morphology comes from the observation of a uniquely-shaped trypomastigote in the koala Barbie with a mixed infection of T. gilletti and T. irwini. A blood smear from this koala contained 2 morphologically different trypomastigote forms. The predominant trypomastigote form was found to be indistinguishable from T. irwini trypomastigotes measured from the koala (McInnes et al. Reference McInnes, Gillett, Ryan, Austen, Campbell, Hanger and Reid2009). The other trypomastigote form observed was very different to bloodstream forms of both T. irwini from koalas and T. copemani from koalas, quokkas and Gilbert's potoroos and is most probably T. gilletti. Further analysis is required to confirm the identity of this slender trypomastigote.
Although the importance of trypomastigote morphology should not be discounted, the utility of delineating trypanosome species based on morphometrics alone is highly questionable as pleomorphism of bloodstream trypomatigotes of numerous T. spp. has been documented (Hoare, Reference Hoare1972; Ziccardi and Lourenco-de-Oliveira, Reference Ziccardi and Lourenco-de-Oliveira1999; Zintl et al. Reference Zintl, Voorheis and Holland2000; Lainson et al. Reference Lainson, Da Silva and Franco2008). Trypomastigote pleomorphism was noted in the present study when comparisons were made of morphometric measurements of T. copemani from koalas with those of T. copemani from Gilbert's potoroo and quokka. Austen et al. (Reference Austen, Jefferies, Friend, Adams, Ryan and Reid2009) also observed pleomorphism in the T. copemani trypomastigotes from both the Gilbert's potoroo and the quokka. Comparisons of the trypomastigotes from the T. copemani wombat isolates (AAP, AAI and H26) with those of T. copemani (koala, quokka and Gilbert's potoroo) are not appropriate as only in vitro-cultured wombat trypanosome forms were measured, and in vitro culture of bloodstream trypomastigotes stimulates change to vector infective forms (Hoare, Reference Hoare1972). However, the unique trypomastigote from Barbie had a similar morphology to in vitro cultured slender T. copemani trypomastigotes isolated from quokkas, Gilbert's potoroo and wombats (Noyes et al. Reference Noyes, Stevens, Teixeira, Phelan and Holz1999).
The description of a new trypanosome species based on molecular data alone is not ideal. However, trypanosomes have few morphological features detectable using light microscopy which can adequately delimit species (Gibson, Reference Gibson2009). Several new species of protozoan parasites have been described using only molecular data because of the limitations of the respective morphological characteristics. For example, for the genera Theileria and Babesia, a genetic distance of 0·7% and 3·4% respectively at the18S rRNA locus is sufficient to be classified as a distinct species (Schnittger et al. Reference Schnittger, Yin, Gubbels, Beyer, Niemann, Jongejan and Ahmed2003). Similarly, for Cryptosporidium, if the genetic distance at 2 unlinked loci is equal to or greater than currently accepted species, then this is strongly supportive of species status (Xiao et al. Reference Xiao, Fayer, Ryan and Upton2004). The complex life cycles and inherent pleomorphism of trypanosomes necessitate more reliance on genetic characterization. For example, the recently described trypanosome species T. copemani has been isolated from diverse hosts and exhibits significant pleomorphism which would, without genetic data, raise the prospect of it being erroneously classified as more than one species. In order to safely delimit species based on genetic information reliance on 18S rDNA data alone are inappropriate due to intraspecies variation at this locus occasionally exceeding interspecies variation in some trypanosome clades. It is proposed that significant portions of the 18S rDNA (inclusive of the V7–V8 region) and gGAPDH gene (>65%) are used and that the gGAPDH gene divergence to the most closely related trypanosome species be no less than 3·75% (a conservative measure which allows for a 50% buffer on the largest intraspecies variation noted in this study). These parameters will exclude many closely related species from being described on genetic distance alone. Species description of such trypanosomes would require added information to validate their species status.
The phylogenetic relationships of T. gilletti and T. copemani may be further clarified once more Australian native mammal trypanosome species are genetically characterized at both 18S rDNA and gGAPDH loci. Specifically, more genetic data on the trypanosome genotypes (TRY1, TRY2, WYA1, WYA2 and CHA1) from the woylie (Bettongia penicillata) and chuditch (Dasyurus geoffroii) (Smith et al. Reference Smith, Clark, Averis, Lymbery, Wayne, Morris and Thompson2008; Averis et al. Reference Averis, Thompson, Lymbery, Wayne, Morris and Smith2009), which appear to associate with the T. copemani clade, is needed to confirm their placement and relationship to T. copemani and T. gilletti. In addition, genetic information would be valuable for T. thylacis from the short-nosed bandicoot (Isoodon macrourus) (Mackerras, Reference Mackerras1959), the T. spp. from the southern brown bandicoots (Isoodon obesulus) (Bettiol et al. Reference Bettiol, Jakes, Le, Goldsmid and Hocking1998), the eastern barred bandicoots (Perameles gunnii) (Bettiol et al. Reference Bettiol, Goldsmid, Le and Driessen1996) and the bat trypanosomes T. pteropi and T. hipposideri (Mackerras, Reference Mackerras1959) in order to develop an increased understanding of the evolutionary and phylogenetic relationships of Australian native mammal trypanosomes.
The vector for T. gilletti is unknown and identification of vectors for a novel trypanosome is difficult due to the range of vectors known to transmit trypanosomes. Sometimes it is possible to infer vectors of a novel trypanosome from the types of vectors transmitting closely related trypanosomes. However, the vectors of the closest relatives of T. gilletti (T. copemani and T. pestanai) are currently unknown. There is a range of ectoparasites known to parasitise koalas, including ticks (Ixodes spp. and Haemophysalis spp.) (Roberts, Reference Roberts1970), fleas (e.g. Ctenocephalus felis), mites (Koalachirus perkinsi, Sarcoptes scabiei, Demodex spp. and Notoedres cati) (Jackson et al. Reference Jackson, Reid, Spittal, Romer, Jackson and 2003), mosquitoes and flies. The identification of T. copemani in quokkas, Gilbert's potoroos and koalas together with the host specificity of the wombat flea would not support the suggestion of Noyes et al. (Reference Noyes, Stevens, Teixeira, Phelan and Holz1999) that the wombat flea is the putative vector of T. copemani. Ticks are a more likely vector for koala trypanosomes, as ticks have been shown to be naturally infected with trypanosomes by a number of studies (el Kady, Reference el Kady1998; Latif et al. Reference Latif, Bakheit, Mohamed and Zweygarth2004; Thekisoe et al. Reference Thekisoe, Honda, Fujita, Battsetseg, Hatta, Fujisaki, Sugimoto and Inoue2007), and koalas are commonly infested with ticks (Roberts, Reference Roberts1970). A trypanosome isolate (KG1) isolated from a naturally infected Haemaphysalis hystricis tick in Japan (Thekisoe et al. Reference Thekisoe, Honda, Fujita, Battsetseg, Hatta, Fujisaki, Sugimoto and Inoue2007), which is associated with the T. copemani clade, suggests that ticks may be good candidate vectors. There is, however, no single tick species common to all the T. copemani hosts identified thus far. It is possible that the T. copemani vector is not a single tick species common to all the hosts but a range of tick species.
In conclusion, the genetic analysis of 2 unlinked loci confirms that the novel trypanosome identified in this study is a new species of trypanosome of the koala; Trypanosoma gilletti. In addition the host range of T. copemani is extended by the confirmation of the occurrence of this trypanosome in the koala.
ACKNOWLEDGEMENTS
Thanks to the staff, volunteers and wildlife carers at and connected with the Australia Wildlife Hospital, Qld and Moggil Koala Hospital, Qld, especially to wildlife veterinarian, Dr Amber Gillett. Special thanks to Megan Aitken for her kind assistance with updating the koala database and Howard Tam for assistance with graphics. Thanks to Jill Austen, Murdoch University, for providing quokka and Gilbert's potoroo T. copemani measurement data.
