Introduction
Poplar, as an important fast-growing timber and shelterbelt species in China, plays an irreplaceable role in ecological construction and economic development. However, poplar is increasingly threatened by severe pest infestations, with Micromelalopha sieversi (Staudinger) emerging as a highly destructive phytophagous pest (Cai, Reference Cai1981). Belonging to the family Notodontidae (Lepidoptera), this pest is widely distributed in China’s poplar-growing areas and frequently triggers large-scale outbreak disasters. Currently, its distribution spans provinces including Hebei, Heilongjiang, Henan, and Jiangsu, with the affected area exceeding 66,667 hectares (over 1 million mu) during peak outbreak periods, leading to its classification as a National Level III Forestry Pest in China (Yang and Gong, Reference Yang, Wang, Zhang, Liu, Gong and Wang1999; Guo et al., Reference Guo, Du, Liu, Li, Yang, Ji, Zhu and Huang2006; Lu, Reference Lu2022). The larval stage of M. sieversi inflicts the most severe damage to poplars: 3rd- to 5th-instar larvae exhibit a marked surge in feeding intensity, and during the high-temperature season (July–August), they can completely defoliate poplar trees within a short period. This extensive defoliation not only hinders the growth and development of individual poplar trees but also reduces forest productivity, incurs substantial economic losses to the poplar industry, and triggers adverse ecological impacts (Wu, Reference Wu2010; Gu and Wang, Reference Gu and Wang2014; Liu et al., Reference Liu, Zhang, Guo, Li, Wang, Zhang and Kong2019).
Currently, the management of M. sieversi primarily relies on three main strategies – physical, chemical, and biological control – each constrained by inherent limitations that hinder their long-term effectiveness in forestry pest management. Physical control tactics centre on manual pupal extraction, larval nest removal, and adult trapping via frequency-vibrational insecticidal lamps. While environmentally benign, this approach is impractical for large-scale poplar plantations due to its high labour intensity, as manual operations are neither cost-effective nor scalable (Mu, Reference Mu2021). In contrast, chemical control predominantly involves foliar spraying of insecticides and the deployment of aerial application technologies. Although this method delivers rapid pest suppression, prolonged or improper usage inevitably induces insecticide resistance in M. sieversi, disrupts the stability of natural enemy communities, and poses significant environmental pollution and ecological risks – undermining the sustainability of forestry ecosystems (Fan, Reference Fan2014; Li et al., Reference Li, Zhang and Yuan2014). For biological control, natural enemies – including Telenomus spp., Cyanopica cyanus, and Bacillus thuringiensis – are employed for the ecological regulation of M. sieversi populations. However, this strategy is highly susceptible to environmental conditions and exhibits a delayed onset of efficacy, limiting its reliability in urgent pest outbreak scenarios (Zhang and Zheng, Reference Zhang, Wang, Yang, Liu, Zheng, Gong and Zhang1999; Wang and Wang, Reference Wang and Wang2001). Collectively, these inherent drawbacks of conventional control methods result in an existing pest management framework that fails to meet the long-term, efficient, and eco-sustainable requirements of modern forestry conservation. This disconnect between current practices and conservation needs urgently necessitates the exploration of innovative, sustainable control technologies anchored in the intrinsic physiological and biochemical mechanisms of M. sieversi. Accordingly, dissecting the molecular adaptive mechanisms of this pest and developing species-specific targeted control strategies has emerged as a critical and promising research frontier.
During the long-term co-evolution of plants and insects, plants have evolved the ability to synthesise a repertoire of secondary metabolites – including terpenoids, phenolics, and nitrogen-containing compounds – to defend against phytophagous insects (Chen et al., Reference Chen, Kang and Shi2015; Zaynab et al., Reference Zaynab, Fatima, Abbas, Sharif, Umair, Zafar and Bahadar2018). Tannic acid (TA) is one of the core defensive secondary metabolites in poplars, which exerts anti-herbivore effects by inhibiting insect digestive enzyme activities and disrupting nutrient absorption(Liu et al., Reference Liu, Xue and Zhang2010; Ma et al., Reference Ma, Tang, Liang, Xia, Zhang and Gao2019). Cytochrome P450 (CYP450) proteins constitute a key detoxification enzyme family that enables insects to cope with xenobiotics (Tao et al., Reference Tao, Xue, Huang, Chen and Mao2012; Wang, Reference Wang2020). Among them, the CYP9 subfamily has been widely confirmed to participate in the detoxification of plant allelochemicals and host adaptation in phytophagous insects. For example, the expression of CYP9A14 and other related genes is significantly induced by gossypol in Helicoverpa armigera (Tao et al., Reference Tao, Xue, Huang, Chen and Mao2012); and in Trichogramma chilonis, genes including CYP6A2, CYP9AG4, CYP9E2, CYP9P3, and CYP9P4 are primarily involved in imidacloprid detoxification and play a crucial role in the evolution of insecticide resistance (Lu et al., Reference Lu, Xie and Yang2025). In our previous transcriptomic analysis of M. sieversi larvae under TA stress (Feng et al., Reference Feng, Tang, Zhang and Nong2021), the CYP9 family gene MsCYP9A319 was identified as the most significantly upregulated CYP450 gene and was differentially expressed in response to TA treatment. Its strong induction by TA indicated a close association with TA tolerance and detoxification. Given its response to TA stress and the well-recognised importance of the CYP9 family in xenobiotic metabolism, MsCYP9A319 was therefore selected as the ideal candidate gene for further functional characterisation. Nevertheless, its expression characteristics and functional mechanisms underlying stress resistance have not been characterised.
In summary, the severe damage inflicted by M. sieversi and the inherent limitations of existing control technologies underscore the urgent need for innovative pest management strategies. Thus, elucidating the molecular mechanisms underlying its host adaptation and developing species-specific targeted control technologies constitutes a promising research direction. Accordingly, based on our transcriptome screening results, the present study was designed to achieve the following objectives: (I) clone the differentially expressed gene MsCYP9A319 that was significantly upregulated by TA from the transcriptome; (II) elucidate the induction of MsCYP9A319 expression by the plant allelochemical TA; and (III) clarify the function of MsCYP9A319 in the resistance of M. sieversi to TA stress. This study aims to reveal the molecular mechanisms underlying adaptation to host defensive compounds in M. sieversi. RNAi-based green control strategies targeting MsCYP9A319 show potential for development as novel ‘immunity-disrupting agents’ that specifically silence key adaptive genes in pests, thereby weakening their ability to tolerate host defences and providing a promising molecular target for the sustainable management of M. sieversi.
Materials and methods
Experimental insects
M. sieversi larvae used in this study were collected from Xuzhou, Jiangsu Province, China. Larvae were reared indoors under controlled environmental conditions: 26 ± 1 °C constant temperature, 16 h light: 8 h dark photoperiod, and 50 ± 5% relative humidity. Fresh poplar leaves, consistent with the natural host plant of the larvae, were provided ad libitum to ensure a uniform nutritional supply throughout the rearing period. Fresh poplar leaves (Populus spp.) used in this study were collected from healthy, pest-free, untreated trees growing in an unpolluted environment. After collection, the leaves were immediately rinsed three times with sterile ultrapure water to remove surface dust, microorganisms, and potential contaminants, then air-dried on sterile filter paper before use in subsequent experiments.
RNA extraction and cDNA synthesis
Healthy and size-matched 3rd-instar larvae of M. sieversi were selected for total RNA extraction. Each biological replicate consisted of five larvae, and three independent biological replicates were set up per treatment group. Total RNA was extracted from M. sieversi using the TSINGKE Total RNA Extraction Reagent Kit (Beijing Tsingke Biotech Co., Ltd., Beijing, China), following the manufacturer’s protocol. RNA concentration and purity were measured using a spectrophotometer, with acceptable samples defined by A260/A280 ratios of 1.8–2.0 and A260/A230 ratios ≥2.0. RNA integrity was verified via 1.0% agarose gel electrophoresis, characterised by clear 28S and 18S rRNA bands. First-strand cDNA was synthesised using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech Co., Ltd., Nanjing, China) with 1 μg of total RNA as template. The synthesised cDNA was quantified, recorded, and stored at −80 °C.
Cloning of the full-length MsCYP9A319 gene
A partial DNA sequence of MsCYP9A319 was retrieved from the M. sieversi transcriptome database. The open reading frame (ORF) of the transcript was predicted using the ORF Finder online tool (National Center for Biotechnology Information (NCBI)). Based on the predicted ORF sequence, gene-specific primer pairs for full-length target gene amplification were designed with Primer 5.0 software (Table 1). Subsequently, polymerase chain reaction (PCR) amplification was performed in a 50 µL reaction volume consisting of 1 µL cDNA template, 0.4 µL each of forward and reverse primers, 22 µL PrimeSTAR Max Premix, and nuclease-free water to bring the volume to 50 µL. The thermal cycling programme was as follows: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 15 s and annealing at 57 °C for 15 s; and a final extension at 72 °C for 10 min. After successful cloning of the partial MsCYP9A319 sequence, gene-specific 3′-rapid amplification of cDNA ends (3′-RACE) primers were designed (Table 1). The 3′-RACE assay was performed using the TaKaRa 3′-Full RACE Core Set (TaKaRa Bio Inc., Shiga, Japan; Code No. 6106). First-strand cDNA was synthesised from total RNA using the kit-supplied 3′-RACE Adaptor primer, with reaction conditions: 42 °C for 60 min, followed by heat inactivation at 70 °C for 15 min. Nested PCR was then employed for amplification, using the gene-specific outer primer (GSP1) in combination with the kit-supplied 3′-RACE Outer Primer. The thermal cycling protocol included 25–35 cycles, with parameters per cycle: denaturation at 94 °C for 30 s, annealing at 70 °C for 30 s, and extension at 72 °C for 2 min. Following amplification, the specific PCR product was cloned into the pCE-3 vector. At least three positive clones were selected for Sanger sequencing verification to ensure sequence accuracy. Negative controls (without reverse transcriptase) and no-template controls were included in all amplification steps to eliminate false-positive results and ensure experimental reliability.
Primers used in this study
Table 1 Long description
Columns list Gene, Primer, Sequence 5 prime to 3 prime, and Application. For MsCYP9A319 cloning fragments, Primer F sequence is ATGCGCAGTTCAGCGGCGCand Primer R sequence is GGCAATGTGGCTAAGTTCTAAT. For MsCYP9A319 3 prime race, GSP1 sequence is GATTACGCCAAGCTTGTTGACTCCCAATCCGACAACAGTC. For MsCYP9A319 RT-qPCR, Primer F sequence is GCTAGAAGTTGGCAAGGAAATG and Primer R sequence is ACAGAGTTCTCGTGCTTCTATG. For MsActin internal references for RT-qPCR, Primer F sequence isGCGGCGCGACTCACCGACTAC and Primer R sequence is GGGAAGAGAGCCTCAGGGCAAC. For dsMsCYP9A319 RNAi, Primer F sequence is CTAGCTAGCTAGGCTTTCGGTCTGAAGGTTG and Primer R sequence is CCCAAGCTTGGGTGTAGCATATCCAGCGTCATT. For dsGFP RNAi, Primer F sequence is CTAGCTAGCTAGTTGAACGGATCCATCTTCAand Primer R sequence is CCCAAGCTTGGGACTTTTCACTGGA.
Note: The underlined parts were the restriction enzyme cutting sites, and italicized nucleotides indicated protective bases.
Phylogenetic tree construction of MsCYP9A319
The ORF of MsCYP9A319 was predicted using the ORF Finder online tool (NCBI), and the corresponding amino acid sequence was deduced from the ORF sequence. Homologous alignment of the cloned MsCYP9A319 gene sequence was performed using the NCBI Protein BLAST online tool (https://www.ncbi.nlm.nih.gov/BLAST). Representative gene sequences from the CYP9, CYP6, and CYP303 families with high homology to MsCYP9A319 and clear functional annotations within Lepidoptera were selected. Typical P450 sequences from closely related lepidopteran species, including Spodoptera exigua, Manduca sexta, Mythimna separata, Helicoverpa armigera, Spodoptera frugiperda, Mamestra brassicae, Heliothis virescens, Cnaphalocrocis medinalis, Ostrinia furnacalis, Bombyx mori, Bombyx mandarina, Acthrcia grisella, Leptidea sinapis, and Phenacoccus solenopsis, were included as references. All reference sequences were downloaded from the NCBI GenBank database. Phylogenetic trees were constructed using MEGA X software with the Neighbour-Joining method, and bootstrap analysis with 1000 replicates was performed to evaluate branch confidence. The classification of P450 family clades followed the standard P450 gene family nomenclature, based on amino acid sequence identity, conserved motif characteristics, and the established evolutionary classification system of lepidopteran P450s reported in previous studies. Genes were assigned to distinct families including CYP9, CYP6, and CYP303 (Feyereisen, Reference Feyereisen1999).
Tissue-specific expression analysis
Healthy fifth-instar M. sieversi larvae were anesthetised on ice for 5 min and dissected with sterile tools to isolate the head, exoskeleton, midgut, fat body, and haemolymph. All tissues were immediately flash-frozen in liquid nitrogen and stored at −80 °C until total RNA extraction. For each sample, five larvae were collected to constitute one biological replicate, and three independent biological replicates were established in all experiments.
Developmental stage-specific expression analysis
To characterise MsCYP9A319 expression across developmental stages, healthy M. sieversi larvae from 1st to 5th instar were collected at equivalent developmental time points and immediately flash-frozen at −80 °C. Total RNA was extracted from the larval samples, and first-strand cDNA was synthesised following the aforementioned protocols. Six larvae were randomly selected from each instar to form one biological replicate, and three independent biological replicates were performed.
Tannic acid-induced expression analysis
To investigate the inductive effect of TA on the expression of MsCYP9A319, two concentrations (0.1 and 1 mg/mL) were selected based on the natural tannin content of poplar leaves (0.25–1.12 mg/g fresh weight) (Cheng et al., Reference Cheng, Yan, Sui, Chi, Gao and Liu2006) and commonly used concentration ranges in related studies on Lepidoptera (Shi et al., Reference Shi, Fu and Tang2019; Tang et al., Reference Tang, Tu, Shang, Gao and Liang2020; Zhang et al., Reference Zhang, Tu and Tang2024). Healthy and developmentally synchronised third-instar larvae were fed poplar leaves soaked with the above TA solutions, while leaves treated with ddH2O served as the control. For each treatment, 10 larvae were randomly selected as one biological replicate, with three replicates per group. Larvae were sampled at 24, 48, and 72 h post-treatment, placed in 1.5 mL centrifuge tubes, and immediately frozen and stored at −80 °C. Total RNA extraction and first-strand cDNA synthesis were performed according to the methods described previously.
RT-qPCR assay
M. sieversi Actin (MsActin) was used as the internal reference gene. Gene-specific primers for MsCYP9A319 and MsActin were designed with Primer 5.0 software (Table 1), and their specificity was verified by agarose gel electrophoresis and Sanger sequencing. Primer amplification efficiency was validated using LinReg PCR software (version 2016.1). RT-qPCR was subsequently performed on an ABI 7500 Real-Time PCR System using VIOX/SCIENTIFIC 96-well plates and the ChamQ Blue Universal SYBR qPCR Master Mix (Tsingke Biotechnology Co., Ltd., Beijing, China). The 20 µL reaction volume consisted of 10 µL ChamQ Blue Universal SYBR qPCR Master Mix, 0.4 µL each of forward and reverse primers, 1 µL cDNA template, and 8.2 µL nuclease-free water. The thermal cycling programme was as follows: initial denaturation at 95 °C for 60 s; 40 cycles of 95 °C for 10 s and 60 °C for 30 s; and a melting curve analysis (95 °C for 15 s, 60 °C for 1 min) to confirm amplification specificity. Relative MsCYP9A319 expression levels were calculated using the 2−ΔΔCt method (Livak and Schmittgen Reference Livak and Schmittgen2001; Damgaard and Treebak Reference Damgaard and Treebak2022), with three independent biological replicates included for each treatment.
Homology modelling and molecular docking of MsCYP9A319
To study the interaction between the MsCYP9A319 protein and TA at the molecular level, we carried out homology modelling and molecular docking experiments in this part. The three-dimensional structure of the MsCYP9A319 protein was built through the SWISS-MODEL online server (https://swissmodel.expasy.org/). The 3D structure of the TA ligand was downloaded from the NCBI PubChem database (https://pubchem.ncbi.nlm.nih.gov/). The AutoDock v4.2.6 software was used to complete the molecular docking process between MsCYP9A319 and TA. After the docking calculation was completed, the PyMOL software (http://pymol.org/) was used to visualise and analyse the final docking results.
Synthesis of MsCYP9A319-targeted dsRNA
Gene-specific primers for MsCYP9A319 and Green Fluorescent Protein (GFP, used as a negative control) were designed based on their respective known nucleotide sequences, with flanking restriction enzyme sites added (Table 1). The MsCYP9A319 interference fragment was amplified from M. sieversi cDNA, while the GFP interference fragment was amplified from a GFP-containing vector. PCR amplification products were purified, followed by double digestion of the purified MsCYP9A319 and GFP fragments with restriction enzymes NheI and HindIII. The L4440 vector was double-digested with the same restriction enzymes. The digestion reaction was incubated at 37 °C for 5 h, after which the digested vector and target fragments were separately identified and purified via 1% agarose gel electrophoresis. Purified MsCYP9A319 and GFP amplicons were ligated into the digested L4440 vector using T4 DNA ligase to construct recombinant plasmids L4440-dsMsCYP9A319 and L4440-dsGFP, respectively. Subsequently, the recombinant plasmids were transformed into Escherichia coli (E. coli) strain HT115 (DE3). Plasmids extracted from transformed E. coli HT115 (DE3) cells were submitted to Tsingke Biotechnology Co., Ltd. (Beijing, China) for bidirectional Sanger sequencing. Bacterial strains with verified correct sequences were stored at −80 °C in 20% glycerol.
Successfully transformed E. coli HT115 (DE3) cells were inoculated at a 1:1000 dilution (bacterial culture: medium, v/v) into Luria–Bertani broth supplemented with ampicillin (75 μg/mL) and tetracycline (12.5 μg/mL). Cultures were incubated at 37 °C with constant shaking at 180 rpm until the optical density at 600 nm (OD600) reached 0.5. Isopropyl-β-d-thiogalactopyranoside (IPTG) was then added to a final concentration of 0.8 mM (corresponding to a 1:125 v/v ratio of IPTG to culture) to induce dsRNA expression, and incubation was continued under the same conditions for an additional 4 h. dsRNA was extracted from induced bacterial cultures using TaKaRa RNAiso Plus reagent (TaKaRa Bio Inc., Shiga, Japan) following the manufacturer’s protocol. The extracted dsRNA was sequentially digested with RNase A and DNase I to remove contaminating genomic DNA and single-stranded RNA. dsRNA integrity was verified by 1% agarose gel electrophoresis, and its concentration was quantified using an Eppendorf BioSpectrometer Basic. Qualified dsRNA samples were aliquoted and stored at −80 °C for subsequent experiments.
Determination of dsMsCYP9A319 RNAi efficiency
Third-instar M. sieversi larvae with uniform developmental status were selected for dsRNA injection. The injection site was the intersegmental membrane of the penultimate abdominal segment, with each larva receiving 1.0 μg of dsMsCYP9A319. Larvae injected with an equivalent amount of dsGFP and ddH₂O served as the negative control and blank control, respectively. Post-injection, larvae were transferred to rearing boxes with fresh poplar leaves, which were replaced every 24 h. Each experimental treatment was conducted with 3 biological replicates, and 10 larvae were assigned to each replicate. Larval samples were collected at 24, 48, and 72 h post-injection, immediately flash-frozen, and stored at −80 °C. RNAi efficiency was evaluated by quantifying MsCYP9A319 expression levels via RT-qPCR as described previously.
Functional analysis of dsMsCYP9A319 under tannic acid stress
Uniformly developed third-instar M. sieversi larvae were used as experimental subjects, with six treatment groups established: three groups exposed to TA (dsMsCYP9A319 + TA, dsGFP + TA, ddH2O + TA) and three groups without TA (dsMsCYP9A319 + PBS, dsGFP + PBS, ddH2O + PBS). Each group included five independent biological replicates (10 larvae per replicate).
Larvae in the respective groups were microinjected with 1.0 μg of dsMsCYP9A319, dsGFP, or equal-volume ddH2O into the hemocoel, then maintained in an artificial climate chamber (26 ± 1 °C, 50 ± 5% RH, 16L:8D photoperiod) for 48 h to ensure effective gene silencing. Subsequently, TA-challenged larvae were fed poplar leaves dipped in 0.1 mg/mL TA solution for 10 s and air-dried, while non-challenged controls received PBS-treated leaves following the same protocol. All larvae were reared individually in tubes, with fresh leaves replaced daily at a fixed time. Larval mortality was recorded daily over a 7-day consecutive observation period.
Statistical analysis
All experimental data were analysed using SPSS® Statistics Version 26 (IBM Corp., Armonk, NY, USA, 2019). Prior to parametric analyses, continuous data were validated for normality via the Shapiro–Wilk test and homogeneity of variance via Levene’s test. One-way analysis of variance (ANOVA) followed by the Least Significant Difference post hoc test was used to compare MsCYP9A319 relative expression levels among different tissues, developmental stages of M. sieversi, and RNAi treatment groups (blank control, dsGFP-treated, and dsMsCYP9A319-treated). Differences were denoted by distinct lowercase letters on error bars representing standard error (SE) at P < 0.05. Independent samples t-tests were used to assess the inductive effects of TA (0.1 and 1 mg/mL) on MsCYP9A319 expression, with pairwise comparisons to the control group. For the combined RNAi and TA challenge assay, Pearson’s chi-square test with Bonferroni correction was employed to assess significant differences in mortality among three groups: the dsCYP9A319 + TA co-treatment group, the dsCYP9A319 group, and the untreated control group. Survival curves were constructed via the Kaplan–Meier method, and the Log-rank (Mantel–Cox) test was utilised to evaluate statistically significant disparities between these curves. Statistical significance was indicated as: *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. Graphs (expression bar charts, survival curves, mortality rate histograms) were generated using GraphPad Prism 9.0, with sample size and error bar type (SE) specified in the figure legends.
Results and analysis
Cloning and sequence analysis of the full-length MsCYP9A319 gene from M. sieversi
In the present study, the P450 gene MsCYP9A319, which was significantly upregulated, was identified from the transcriptome of M. sieversi under TA stress. The full-length cDNA sequence of MsCYP9A319 was obtained by cloning and RACE techniques. As illustrated in Fig. S1, this gene harbours an ORF of 1593 bp, which encodes a polypeptide consisting of 530 amino acid residues. The sequence was submitted to the NCBI GenBank database under the accession number PRJNA1445007. A phylogenetic tree was constructed using the amino acid sequence of MsCYP9A319 from M. sieversi and typical CYP450 family genes of closely related lepidopteran insects retrieved from the NCBI database (fig. 1). The phylogenetic analysis results revealed that MsCYP9A319 is clearly clustered within the CYP9 family, consistent with the classification of lepidopteran CYP450 orthologs, reflecting its evolutionary conservation in this subfamily. Multiple sequence alignment and conserved domain analysis of the deduced amino acid sequence revealed four canonical CYP450-specific conserved motifs: the C-helix motif (WxxxR), two K-helix motifs (ExLR and PERF), and the heme-binding loop (FxxGxxxCxG) (fig. 2). These domains share high similarity with orthologous CYP450s from other lepidopteran insects, confirming MsCYP9A319 as a functionally conserved CYP450 superfamily member.
The phylogenetic tree of MsCYP9A319 with homologous cytochrome P450 proteins. Different colour ranges represented different CYP clans, and colours of branches indicated bootstrap values (1000 replicates).
Figure 1 Long description
The circular phylogenetic tree illustrates the relationships among cytochrome P450 proteins. The tree is divided into three color-coded sections representing different CYP clans: red, green and blue. Each branch is labeled with specific protein names, with MsCYP9A319 highlighted in bold. The branches are colored to indicate bootstrap values, with a legend showing the color scale from red to green. The tree structure is radial, with branches extending outward from the center, demonstrating evolutionary connections among the proteins.
Multiple sequence alignment and conserved motif analysis of MsCYP9A319 with orthologous cytochrome P450 proteins. The K-helix corresponds to the region within the green and blue boxes, the C-helix to the region within the orange box, and the heme-binding domain to the region within the yellow box. Micromelalopha sieversi CYP9A319 (MsCYP9A319); Heliothis virescens CYP9A (HvCYP9A, AAC25787.1); Trichoplusia ni CYP9e2 (TnCYP9e2, XP_026729221.1); Mythimna separata CYP9A101 (MsCYP9A101, QEL53083.1); Helicoverpa armigera CYP9A17v2 (HaCYP9A17v2, NP_001341723.1); Chilo suppressalis CYP9A69 (CsCYP9A69, AHW57316.1); Amyelois transitella CYP9e2 (AtCYP9e2, XP_013199514.1); Spodoptera exigua CYP9A97 (SeCYP9A97, ASO98011.1); Spodoptera exigua CYP9A9 (SeCYP9A9, BAG71410.1); Phthorimaea operculella CYP9A314 (PoCYP9A314, XLU17692.1).
Figure 2 Long description
Three stacked protein sequence alignment blocks with row names on the left and position numbers above each block. Top block: Position numbers shown above include 120, 130, 140, 150, 160, 170 and 180. Row labels at left read MsCYP9A319, HvCYP9A, TnCYP9e2, MsCYP9A101, HaCYP9A17v2, CsCYP9A69, AtCYP9e2, SeCYP9A97, SeCYP9A9, PoCYP9A314. A boxed region spans multiple columns across the alignment. A label below the block reads C dash helix. Middle block: Position numbers shown above include 360, 370, 380, 390, 400 and 410. The same set of row labels appears at left. Several boxed regions appear within the alignment, including a prominent boxed segment near the center. A label below the block reads K dash helix. Bottom block: Position numbers shown above include 420, 430, 440, 450, 460 and 470. The same set of row labels appears at left. Multiple boxed regions appear across the alignment, including a boxed segment near the middle and another boxed segment toward the right. Two labels below the block read PERF motif and Heme dash binding loop.
Tissue and instar-specific expression of MsCYP9A319
The relative expression level of MsCYP9A319 was determined by RT-qPCR in five tissues (head, fat body, exoskeleton, midgut, and haemolymph) dissected from fifth-instar M. sieversi larvae, as well as in whole larvae from the 1st to 5th instars. As shown in figs. 3 and 4, MsCYP9A319 displayed distinct tissue- and instar-specific expression patterns. The gene was most highly expressed in the midgut and head, with the lowest expression observed in haemolymph. Regarding developmental expression, MsCYP9A319 reached its peak in 3rd-instar larvae, with significant differences compared to other instars, while the lowest transcript levels were detected in 4th- and 5th-instar larvae.
Tissue-specific expression analysis of MsCYP9A319 in fifth-instar M. sieversi larvae. Experiments were conducted with three biologically independent replicates. One-way ANOVA followed by the Least Significant Difference test was used to analyse the differences in the relative expression levels of MsCYP9A319 in different larval tissues. Different letters above error bars (standard error) indicated significant differences (P < 0.05).
Instar-specific expression analysis of MsCYP9A319 across 1st to 5th instar M. sieversi larvae. Experiments were conducted with three biologically independent replicates. One-way ANOVA followed by the Least Significant Difference test was used to analyse the differences in the relative expression levels of MsCYP9A319 among different larval instars. Different letters above error bars (standard error) indicated significant differences (P < 0.05).
Induced expression of MsCYP9A319 by tannic acid
To investigate the regulatory effect of TA on MsCYP9A319 expression, 3rd-instar larvae were fed poplar leaves soaked in two concentrations of TA (0.1 and 1 mg/mL); larvae fed leaves soaked in ddH2O served as the control group. As illustrated in fig. 5, RT-qPCR analysis revealed concentration-dependent induction of MsCYP9A319: compared to the control group, the relative expression level was significantly upregulated by 0.1 mg/mL TA at 48 h post-treatment, whereas it was downregulated in the 1 mg/mL TA treatment group.
Concentration-dependent regulatory effect of tannic acid on MsCYP9A319 expression in 3rd-instar M. sieversi larvae. (A) 0.1 mg/mL tannic acid treatment; (B) 1 mg/mL tannic acid treatment. Data are presented as mean ± standard error (SE) of three independent biological replicates. Asterisks indicated significant differences compared to the control group (independent samples t-test: *P < 0.05; ns, not significant).
Homology modelling and molecular docking of MsCYP9A319
The quality evaluation results of the homology model showed that 91.12% of the amino acid residues in the constructed MsCYP9A319 protein model were located in the most favoured regions of the Ramachandran plot, and only 2.37% of the residues were in the disallowed regions. The rotamer outlier rate was 1.09%, and no bad bonds were found in the model. All residues with steric clashes were located on the protein surface, far away from the active pocket region. These results indicated that the protein model had a reliable structure and could be used for subsequent molecular docking studies.
Molecular docking was performed using AutoDock v4.2.6 software. As shown in fig. 6A, the TA molecule could fully embed into the hydrophobic active pocket of the MsCYP9A319 protein without obvious steric hindrance. The calculation of binding energy showed that the best binding energy between them was −8.86 kcal/mol, which indicated that MsCYP9A319 had a relatively strong binding affinity with TA, and they had good matching characteristics in spatial structure. The galloyl groups of TA were distributed radially and formed multi-point interactions with different sub-regions of the pocket, which greatly enhanced the binding affinity. The shape of the binding pocket was highly complementary to the spatial conformation of TA, which was consistent with the induced-fit model of enzyme-substrate binding.
Molecular docking simulation results of the MsCYP9A319 protein with tannic acid. (A) Schematic diagram of the overall structure of MsCYP9A319 and the binding position of tannic acid. The blue cartoon represents the protein backbone, and the orange sticks represent the tannic acid molecule; (B) 2D interaction diagram between tannic acid and amino acid residues in the active pocket of MsCYP9A319. Different coloured lines and regions represented different types of non-covalent interactions respectively: green dashed lines for conventional hydrogen bonds, light green dashed lines for carbon–hydrogen bonds, red dashed lines for unfavourable donor–donor interactions, orange solid lines for π–cation interactions, purple dashed lines for π–sigma interactions, pink dashed lines for π–π T-shaped interactions and light green shaded regions for van der Waals interactions; (C) Close-up view of the active pocket. The blue sticks represent the key amino acid residues involved in tannic acid binding, the yellow dashed lines represent hydrogen bonds, and the numbers are the hydrogen bond lengths (unit: Å).
As shown in fig. 6B, C, MsCYP9A319 and TA formed a very dense hydrogen bond network, and a total of 12 stable conventional hydrogen bond interactions were detected. Especially, the strong hydrogen bonds formed by SER-334 (2.2 Å), GLU-261 (2.3 Å), and ASN-207 (2.3 Å) played a decisive role in stabilising the complex structure. All these hydrogen bond lengths were within the reasonable range of 2.2–3.4 Å, indicating that they had relatively strong binding strength and could effectively fix the spatial orientation of TA in the active pocket to prevent the substrate from shifting during the catalytic process. In addition, a π–π T-shaped interaction was formed between the benzene ring of PHE-215 residue and one benzene ring of TA (shown as a pink dashed line in the figure); a π–cation interaction was formed between HIS-263 residue and the benzene ring of TA (shown as an orange dashed line in the figure). Besides, the TA molecule also had extensive van der Waals interactions with multiple hydrophobic residues around the active pocket, including ILE-212, LEU-262, PHE-330, ILE-518, etc. (shown as green regions in the figure).
Based on all the above results, the binding between the MsCYP9A319 protein and TA was driven by hydrogen bonds, π–π stacking interactions, π–cation interactions, and van der Waals forces. Among these interactions, the dense hydrogen bond network played a dominant role in fixing the spatial orientation of the substrate, while hydrophobic interactions and π-type interactions further enhanced the binding affinity between them. This multi-type and multi-level interaction mode enabled TA to stably bind to the catalytic active centre of MsCYP9A319 with high affinity, which provided the necessary molecular basis for MsCYP9A319 to catalyse the degradation of TA.
RNAi-mediated silencing of MsCYP9A319 reduces larval tolerance to tannic acid
To evaluate the silencing efficiency of MsCYP9A319 RNAi, we quantified the relative expression of MsCYP9A319 in M. sieversi larvae at 24, 48, and 72 h after injection with dsMsCYP9A319. Compared with both the blank control (CK) and dsGFP control groups, the transcript level of MsCYP9A319 was significantly downregulated at all three time points, with silencing efficiencies of 39.23%, 70.81%, and 26.11%, respectively. The most robust knockdown was achieved at 48 h post-injection, where the relative expression of MsCYP9A319 was reduced to only 0.29-fold of the control level. This time point was therefore selected for subsequent functional assays to ensure maximal silencing efficiency (fig. 7).
Effect of dsMsCYP9A319-mediated knockdown on the relative expression level of MsCYP9A319 in M. sieversi larvae. Experiments were conducted in three biologically independent experiments. One-way ANOVA followed by the Least Significant Difference test was used to analyse the differences in the relative expression levels of the MsCYP9A319 gene among different treatment groups. Different letters on the bars (standard error) indicated significant differences at the same time (P < 0.05).
To further evaluate the function of MsCYP9A319 in TA tolerance, larvae injected with dsMsCYP9A319 were fed poplar leaves treated with 0.1 mg/mL TA at 48 h after RNAi treatment. As illustrated in Table 2, at the specific time points of 60, 84, and 96 h post-diet switch, the mortality of larvae in the dsMsCYP9A319 + TA co-treatment group was significantly higher than that in the dsMsCYP9A319 monotherapy group. Specifically, the mortality rates reached 68% at 84 h and 82% at 96 h (84 h: χ2 = 41.215, P < 0.001; 96 h: χ2 = 59.255, P < 0.001). The Kaplan–Meier survival curve demonstrated that the survival rate of M. sieversi larvae subjected to dsMsCYP9A319 knockdown was substantially lower than that of untreated control larvae; furthermore, the mortality of the dsMsCYP9A319-TA co-treatment group was significantly higher than that of all other experimental groups (fig. 8).
Discussion
CYP450s constitute a major family of detoxification enzymes in insects and play a central role in the adaptation of phytophagous insects to host plants by counteracting the stress of plant secondary metabolites (Nauen et al., Reference Nauen, Bass, Feyereisen and Vontas2022). In this study, the full-length cDNA sequence of a CYP450 gene, MsCYP9A319, was successfully cloned from M. sieversi. The gene contains a 1593 bp ORF encoding 530 amino acids. Sequence analysis revealed that it exhibits the typical conserved domains of the CYP450 superfamily, and phylogenetic analysis assigned it to the CYP9 family. These results indicate that MsCYP9A319 possesses the characteristic structural features of evolutionarily conserved detoxification-related P450 genes, providing a structural basis for its involvement in the detoxification and metabolism of xenobiotics.
Mortality of M. sieversi by dsMsCYP9A319 combined with tannic acid
Table 2 Long description
Mortality plus or minus standard error is reported as percent at treatment times of 60, 84, and 96 hours for CK, CK plus TA, dsGFP, dsGFP plus TA, dsMsCYP9A319, and dsMsCYP9A319 plus TA, with chi squared and P columns. At 60 hours, mortality values are CK 8.00 plus or minus 2.00 with marker b, CK plus TA 4.00 plus or minus 2.45 with marker d, dsGFP 6.00 plus or minus 2.45 with marker d, dsGFP plus TA 6.00 plus or minus 2.45 with marker d, dsMsCYP9A319 16.00 plus or minus 2.45 with marker c, and dsMsCYP9A319 plus TA 32.00 plus or minus 2.00 with marker a; chi squared is 26.895 and P is less than 0.001. At 84 hours, mortality values are CK 20.00 plus or minus 0.00 with marker c, CK plus TA 26.00 plus or minus 2.45 with marker b, dsGFP 16.00 plus or minus 2.45 with marker c, dsGFP plus TA 26.00 plus or minus 2.45 with marker b, dsMsCYP9A319 38.00 plus or minus 2.00 with marker b, and dsMsCYP9A319 plus TA 68.00 plus or minus 2.00 with marker a; chi squared is 41.215 and P is less than 0.001. At 96 hours, mortality values are CK 22.00 plus or minus 2.00 with marker c, CK plus TA 26.00 plus or minus 2.45 with marker c, dsGFP 22.00 plus or minus 2.00 with marker c, dsGFP plus TA 28.00 plus or minus 2.00 with marker c, dsMsCYP9A319 48.00 plus or minus 2.00 with marker b, and dsMsCYP9A319 plus TA 82.00 plus or minus 2.00 with marker a; chi squared is 59.255 and P is less than 0.001.
CK, the control group; a, b, and c, statistically significant differences in accordance with Bonferroni-corrected P-value (P < 0.05).
Survival curves of M. sieversi larvae fed TA-treated poplar leaves following dsMsCYP9A319-mediated knockdown. Experiments were conducted in five biologically independent experiments. Significant differences between curves were determined via the Log-rank (Mantel–Cox) test. Asterisks indicated significant differences between groups (***P < 0.001, **P < 0.01, *P < 0.05, ns: non-significant).
Figure 8 Long description
The x axis label is, Treatment time slash h. The x axis range is 0 to 96, with tick labels at 0, 24, 48, 72 and 96. The y axis label is, Survival probability slash percent. The y axis range is 0 to 100, with tick labels at 0, 20, 40, 60, 80 and 100. A legend lists six line labels: control, dsGFP, dsMsCYP9A319, control plus TA, dsGFP plus TA and dsMsCYP9A319 plus TA. The control line stays at 100 from 0 to 60, then steps down to 92 at 60, to 80 at 84 and remains at 78 at 96. The dsGFP line stays at 100 from 0 to 60, then steps down to 88 at 72, to 84 at 84 and remains at 78 at 96. The dsMsCYP9A319 line stays at 100 from 0 to 60, then steps down to 84 at 60, to 72 at 72, to 62 at 84 and to 52 at 96. The control plus TA line stays at 100 from 0 to 60, then steps down to 90 at 72, to 74 at 84 and remains at 74 at 96. The dsGFP plus TA line stays at 100 from 0 to 60, then steps down to 84 at 72, to 74 at 84 and remains at 72 at 96. The dsMsCYP9A319 plus TA line stays at 100 from 0 to 60, then steps down to 68 at 60, to 46 at 72, to 32 at 84 and to 18 at 96. Text annotations near the right side include, ns, asterisks and a vertical bracket with asterisks.
Gene expression profiles offer critical insights for inferring gene function. In the present study, MsCYP9A319 exhibited distinct tissue-specific expression in M. sieversi larvae: high expression was detected in the midgut and head (with the highest level in the midgut), while the lowest expression was observed in the haemolymph. This expression pattern aligns with the canonical functional localisation of insect CYP450 monooxygenase genes, as the midgut serves as the primary organ for the absorption and initial metabolism of plant secondary metabolites and a key site for detoxification enzyme accumulation (Cui et al., Reference Cui, Wang, Ma and Geng2016). For example, in Bombyx mori, CYP9A19 is highly expressed in the midgut, Malpighian tubules, silk gland, and fat body, whereas CYP9A22 shows the strongest expression in the midgut, with lower levels observed in the silk gland and Malpighian tubules (Zhao et al., Reference Zhao, Zhao, Gao, Wang, Zhang, Ding, Li, Lu, Shen and Wei2011). Consistent with these reports, our data confirm that MsCYP9A319 is predominantly expressed in the midgut – an evolutionarily conserved key organ for xenobiotic metabolism in lepidopteran insects. Collectively, these lines of evidence strongly support the hypothesis that MsCYP9A319 plays a crucial role in mediating the defensive response of M. sieversi larvae against phytotoxic secondary metabolites produced by their host poplar trees. Regarding developmental stage-specific expression, MsCYP9A319 transcript levels were highest in 3rd-instar M. sieversi larvae and significantly reduced in 4th- and 5th-instar larvae. This expression pattern may be associated with stage-specific feeding requirements and detoxification pressure: 3rd-instar larvae undergo a transition from gregarious to solitary feeding, with an expanded feeding range that increases their exposure to diverse plant secondary metabolites and elevated doses of these compounds, thereby enhancing the demand for detoxification enzymes. In contrast, although 4th- and 5th-instar larvae enter an intensive feeding phase, their dependence on MsCYP9A319 may be diminished due to prior metabolic adaptation to host plant secondary metabolites or functional compensation by other detoxification enzyme families.
TA, a major phenolic secondary metabolite in poplar, serves as a key defensive compound against M. sieversi feeding. It mediates insecticidal and antifeedant activities primarily by inhibiting larval digestive protease activity and disrupting nutrient assimilation in the midgut – the primary site of nutrient acquisition and xenobiotic detoxification in lepidopterans (Liu et al., Reference Liu, Xue and Zhang2010). In the present study, low-concentration TA significantly induced the upregulation of MsCYP9A319 expression. This finding was consistent with the regulatory patterns of P450 gene expression induced by plant secondary metabolites in other insects, such as Helicoverpa armigera (Liu et al., Reference Liu, Yuan, Li and Qiu2015) and Cydia pomonella (Chen et al., Reference Chen, Chen and Ge2020), suggesting that MsCYP9A319 participates in the response of M. sieversi to TA stress. The upregulation of this gene may enhance larval adaptation to host defensive compounds. In this study, two TA concentrations were applied: 0.1 mg/mL (close to natural physiological levels in poplar) and 1 mg/mL (high-concentration stress). The results showed that only low-concentration TA significantly induced the upregulation of MsCYP9A319 expression, whereas high-concentration TA instead downregulated its expression. Further analysis suggested that low-concentration TA may act as an inductive signal to activate the expression of detoxification genes. In contrast, high-concentration TA may exceed the physiological tolerance of larvae, causing cytotoxicity and global transcriptional repression, thereby resulting in the downregulation of MsCYP9A319. Previous studies have confirmed that excessive concentrations of plant secondary metabolites exert acute toxicity in insects and suppress the expression of detoxification genes (Wang et al., Reference Wang, Staehelin, Xia, Su and Zeng2015; Zhao et al., Reference Zhao, Feng, Tang and Qiu2015; Tan et al., Reference Tan, Wu, Yan and Jiang2022), which is consistent with the results of the present study. Collectively, these observations demonstrate that MsCYP9A319 exhibits a sensitive and specific response to TA exposure, and its expression is dynamically regulated by TA stress.
To better understand the interaction between the MsCYP9A319 protein and TA, we performed homology modelling and molecular docking simulations in this study. The results showed that TA could stably bind to the catalytic active pocket of MsCYP9A319 with a relatively low binding energy. This proper spatial matching provided the necessary structural condition for MsCYP9A319 to catalyse the degradation of TA. Analysis of the interaction patterns revealed that hydrogen bonds and π-type interactions were the main driving forces for the binding between MsCYP9A319 and TA. Several polar residues, including GLU-261, GLN-211, and ASN-207, formed hydrogen bonds with multiple hydroxyl groups of TA, which fixed the spatial orientation of TA in the active pocket. Meanwhile, PHE-215 and HIS-263 residues interacted with the benzene rings of TA through π–π stacking and π–cation interactions, respectively, which significantly increased the binding affinity between the protein and the ligand. They directly proved that the MsCYP9A319 protein could specifically recognise and bind to the TA substrate at the atomic level, and further supported the core role of MsCYP9A319 in TA detoxification of M. sieversi. We found that this binding pattern of MsCYP9A319 and TA showed a certain degree of conservation compared with the binding patterns of CYP family proteins from other lepidopteran insects and their corresponding substrates. For example, previous studies have reported that CYP321A subfamily P450 proteins in S. litura can also form stable binding with various plant secondary metabolites such as flavonoids and aflatoxins through hydrogen bonds and π-type interactions. This phenomenon indicates that this substrate recognition mechanism, based on hydrogen bonds and hydrophobic interactions, is widely present in different CYP subfamilies of lepidopteran insects (Wang et al., Reference Xiao, Wang, Deng, Yang, Peng, Huang, Sun and Lu2023).
After silencing MsCYP9A319 via RNAi, the mortality rate of M. sieversi larvae was significantly increased and their survival rate markedly decreased under TA stress, directly demonstrating that this gene contributes to larval tolerance and detoxification of TA. This finding is consistent with numerous functional studies of CYP450 genes in other lepidopteran insects that have used RNAi as a core validation strategy. For instance, RNAi-mediated knockdown of CYP9A307v2 in Tuta absoluta significantly enhanced larval susceptibility to the insecticide abamectin (Liu, Reference Liu2023), and silencing CYP9A134 in Mythimna separata increased larval mortality following exposure to beta-cypermethrin (Zhang et al., Reference Zhang, Yang, Li, Zhang, Hu and Fan2023). These studies collectively confirm the conserved central role of CYP9 family genes in conferring resistance to xenobiotic stress. In accordance with these reports, our Kaplan–Meier survival analysis further confirmed that the survival time of M. sieversi larvae in the dsMsCYP9A319 + TA treatment group was significantly shortened compared with other groups. Taken together with the tissue-specific expression, developmental expression pattern, and inducible expression profile of MsCYP9A319, our RNAi-based functional evidence strongly supports that MsCYP9A319 acts as a key gene responsible for TA tolerance in M. sieversi. Transcriptional upregulation of this gene enhances the larval detoxification potential and improves tolerance to host-derived defensive metabolites. Collectively, the consistent expression patterns and in vivo RNAi functional results provide reliable evidence demonstrating that MsCYP9A319 contributes to the detoxification of TA and mediates defence against TA stress in M. sieversi.
To sum up, this study systematically clarified that MsCYP9A319 is an important functional gene for M. sieversi to respond to TA stress, through gene cloning, expression characteristic analysis, molecular docking analysis, and functional verification. This gene is involved in regulating the larval tolerance to TA, laying a foundation for further exploring its detoxification and metabolic functions. The results of this study provide a novel molecular perspective for understanding the adaptive mechanism underlying outbreak disasters in M. sieversi and establish a solid theoretical foundation for developing innovative RNAi-based insect management technologies targeting the key P450 gene MsCYP9A319.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0007485326101163.
Author contributions
F.W.: software; validation (lead); formal analysis (lead); investigation (lead); data curation (lead); writing – original draft; visualisation (lead). X.R.: validation (supporting); formal analysis (supporting); data curation (supporting). T.Z.: investigation (supporting); visualisation (supporting); F.T.: conceptualisation; methodology; supervision; project administration; funding acquisition; writing – review and editing.
Financial support
This work was financially supported by the National Natural Science Foundation of China [32371883] and the Priority Academic Program Development Fund of Jiangsu Higher Education Institutions.
Competing interests
The authors have no conflicts of interest to declare.
