Introduction
Honeybee, a commercially valuable insect, plays a key role in both crop pollination and the production of bee products. Therefore, the exploration of honeybee nutrition should be the focus of attention. A honeybee colony needs a diet containing approximately 20–25% protein for its proper growth and survival (Quinlan et al., Reference Quinlan, Milbrath, Otto, Smart, Iwanowicz, Cornman and Isaacs2021). Pollen contains 10 essential amino acids (EAAs) that are indispensable for the growth and development of bees, including arginine (Arg), histidine (His), lysine (Lys), tryptophan (Try), phenylalanine (Phe), methionine (Met), threonine (Thr), leucine (Leu), isoleucine (Ile), and valine (Val) (Groot, Reference Groot1953). To cope with unpredictable fluctuations in natural pollen availability, beekeepers have begun providing pollen substitutes to maintain colony egg-laying, brood rearing, and foraging activities. Numerous protein sources have been explored, including soybean flour, brewer’s yeast, skimmed milk powder, egg yolk powder, casein, pea powder, and fishmeal. Although various trials have shown these substitutes can partially sustain colony development, they cannot fully replace natural pollen (Paray et al., Reference Paray, Kumari, Hajam, Sharma, Kumar, Albeshr, Farah and Khan2021). We hypothesise that differences in amino acid profiles between natural pollen and its substitutes may be a contributing factor (Quinlan et al., Reference Quinlan, Milbrath, Otto, Smart, Iwanowicz, Cornman and Isaacs2021; Jee Kim et al., Reference Jee Kim, Hwang, Ullah, Mustafa and Kwon2022). Therefore, optimising the amino acid balance in pollen substitutes appears necessary.
Notably, Leu and Ile share structural similarities, and they are isomeric forms of each other. They belong to branched-chain amino acids (BCAAs), which have branches on the carbon chain and play important physiological functions in animals. They not only supplement the body’s nutrition, but also possess many biological functions, such as immunity, lipid metabolism, and protein synthesis. Both Leu and Ile have an impact on the composition of body components. Research has found that Leu promotes energy metabolism (glucose uptake, mitochondrial biosynthesis, and fatty acid oxidation), provides energy for protein synthesis, inhibits protein degradation, and regulates energy (Niu et al., Reference Niu, Qian, Feng, Yi, Li, Chen and Ye2021). Ile increased muscle mass through myogenesis and intramyocellular lipid deposition (Liu et al., Reference Liu, Sun, Zhao, Wang, Zhang and Pang2021). There exists a close interconnection between BCAAs metabolism and lipid biosynthesis, as evidenced by the superior ATP yield generated through BCAA catabolic oxidation compared to other amino acids (Yoon et al., Reference Yoon, Nam, Kim, Moon, Kim, Jang, Song, Jeong, Kim, Cho, Kim, Lee, Yang, Yoo, Kim, Kim, Yang, Cho, Park, Hwang, Yeon, Hwang, Han, Kim and Kim2020). Meanwhile, the body utilises Leu and Ile to produce a series of immune-related protein molecules (Qin et al., Reference Qin, Yang, Wei, Xin, Ding and Chen2024). Accumulating evidence reveals metabolic mechanisms of dietary regulation and its role in immune function (Hosomi and Kunisawa, Reference Hosomi and Kunisawa2020).
Leu and Ile are also the two EAAs required for the normal development of bees (Bryś and Strachecka, Reference Bryś and Strachecka2024). There has been more research on Leu and Ile, but mostly on mammals and fish, and relatively little on insects. Notably, caution is warranted when applying findings from mammals and fish to insects due to potential differences in physiology and metabolism, highlighting the need for dedicated research on honeybees. On the other hand, these findings indicate that the majority of research has centred on the individual requirements of amino acids, neglecting the potential interactions and synergistic effects that may arise from the combination of BCAAs. This study is conducted by incorporating Leu and Ile into artificial pollen diets, with the aim of exploring the interaction effects of these two EAAs on honeybees. The current research paper is dedicated to an analysis of colony reproductive, the composition of individuals, markers associated with lipid metabolism, and immune responsiveness processes of honeybees. By doing so, the study seeks to propose new opinions on how these amino acids interact within the honeybee physiology, thereby offering new ways for adjusting and optimising the composition of artificial pollen diets to better support the health and productivity of honeybee colonies.
Materials and methods
Honeybee colonies
Honeybee (Apis mellifera ligustica) colonies used in the experiment were provided by the experimental apiary of Shandong Agricultural University (Tai’an, Shandong). Twenty colonies of similar population size were selected and randomly divided into four groups of five replicates each. This trial was conducted from mid-April to June 2021, with a pre-feeding period of 24 days and a formal trial of 36 days. For the accuracy of the test and to exclude the interference of outside pollen on the colony, a pollen trap was installed throughout the test.
Experimental diets
A 2 × 2 factorial design was employed to investigate the effects of dietary Leu and Ile supplementation. Four experimental diets were formulated: 1) a control diet (CK) with low levels of both Leu and Ile, 2) a high-Leu diet (Leu) supplemented with Leu, 3) a high-Ile diet (Ile) supplemented with Ile, and 4) a combined high-Leu/high-Ile diet (L-I) supplemented with both amino acids. The experimental feed formulations are shown in table 1.
Composition of the experimental diets
Table 1 Long description
The table details the composition of four experimental diets, focusing on the percentage of various ingredients and their nutritional levels. Key differences include the presence of leucine in the Leu and L-I diets, and isoleucine in the Ile and L-I diets. The sugar content decreases progressively from CK to L-I, while crude protein content increases across the diets. The Leu and L-I diets have significantly higher leucine levels, while the Ile and L-I diets have elevated isoleucine levels. These variations are designed to study the impact of these amino acids on nutritional outcomes. All diets maintain a total composition of 100 percent.
The powder and water were mixed thoroughly in the ratio of 1:0.24; the mixture was covered with plastic wrap and stored for 12 h at room temperature. To ensure the freshness and palatability, the feed was changed every 3 days (approximately 500 g per colony), and the fresh weight of the feed should be recorded. Newly emerged bees were marked on the thoracic notum upon completion of the pre-feeding phase and sampled on day 9.
Population size
Colony strength parameters, including adult bee population size and capped brood area, were measured four times during the experimental period. Measurements were taken at the beginning of the trial and subsequently at 12-day intervals throughout the 36-day experiment.
A frame with two sides evenly covered with crawling bees was defined as a frame of adult bees. Both sides of a frame fully covered with capped pupae were a frame of capped brood.
Feed intake per stage (g/Frame) was calculated by dividing the total amount of consumption at stage (g) by the initial population size of that colony at the beginning of the stage (frame).
Survival curve
After the pre-feeding, 40 new bees were collected from each colony and housed in wooden boxes (23 cm × 9.5 cm × 5 cm, length × width × height). The boxes were maintained in an incubator at 32°C and 50% relative humidity. Fresh 50% (w: w) sucrose solution and water were provided daily, while the artificial pollen substitute was replaced every 3 days. The number of dead bees per box per day was recorded for a total of 40 days.
Haemolymph biochemical indicators analysis
The haemolymph of 9-day-old workers was extracted using capillary tubes. A group of 50 bees was considered as one sample, and the experiment was performed with three biological replicates. Haemolymph was stored in a 1.5 mL centrifuge tube with a trace amount of phenylthiourea at −80℃. Before assay, haemolymph was centrifuged at 8,000 g for 5 min at 4℃, and 200 μL supernatant was taken on the machine for measurement. Total protein (TP), total cholesterol (TCHO), triglyceride (TAG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured using a Hitachi 7020 automatic biochemical analyser.
Amino acid content analysis
The method was based on the Chinese food safety standard for the determination of amino acids in food (GB 5009.124-2016). Ten 9-day-old bees (with no guts and crops) were weighed, 10 mL of 6 mol/L hydrochloric acid solution was added to the hydrolysis tube, protected by nitrogen, the cap was tightened, and hydrolysed at 110°C for 22 h. After removal, the hydrolysis solution was cooled to room temperature and transferred to a 25 mL volumetric flask. The hydrolysis solution was transferred to a 25 mL volumetric flask and finally fixed with 6 mol/L hydrochloric acid and shaken well. 0.25 mL of filtrate is accurately absorbed into a 15 mL test tube, the pressure is reduced for drying at 40℃, re-dissolved with 0.02 mol/L hydrochloric acid solution, shaken and mixed thoroughly, then passed through a 0.22 μm microporous filter membrane, and finally measured by an amino acid auto-analyser (LA8080).
Enzyme activity assay
Nine-day-old worker bees were collected, and their guts and honey crops were removed. The remaining body tissues were stored at −80°C until analysis. For each assay, five bees were homogenised in PBS buffer at a mass ratio and volume ratio of 1:9, and the liquid was centrifuged at 4°C and 8,000 g for 10 min. The supernatant was used for the enzyme activity assay. Phenol oxidase (PO), lysozyme (LYS), glucose oxidase (GOD), fatty acid synthase (FAS), and acetyl-CoA carboxylase (ACC) activities were measured with an ELISA kit (Shanghai Enzyme Linkage). Protein content was determined with the BCA kit (New Saimei Biotechnology Co., Ltd.). The final result of enzyme activity is calibrated with protein concentration.
Total RNA extraction and gene expression analysis
Two 9-day-old workers were extracted using the Animal Tissue Total RNA Extraction Kit (New Saimei Biotechnology Co., Ltd.) and stored at −80°C for long-term storage. RNA concentration and purity were measured by micro UV-visible spectroscopy, and RNA was reverse transcribed to cDNA using Evo M-MLV RT Primix for qPCR Reverse Transcription Kit (AG, Acres Bio), under the following conditions: 37°C for 15 min, 85°C for 5 s. Synthesised cDNA was stored at −20°C until use. The relative expression of genes was detected by real-time PCR. The reaction was performed on ABI7500 PCR instrument according to the instructions of TransGen kit (Beijing All-Style Gold Reagent Company). The results were calculated by the 2−ΔΔCt. The internal reference gene was selected as β-actin, which is more consistently expressed. To comprehensively assess the impact of dietary Leu and Ile on honeybee health, we quantified the expression levels of key genes involved in immune response and lipid metabolism. The expression levels of target genes were selected to evaluate both immune and metabolic responses: apidaecin and defensin 1 (encoding antimicrobial peptides), along with IMD, Toll, and INR (representing immune signalling pathways) for immunity; adipokinetic hormone (AKH) and its receptor receptor of AKH (AKHR), as well as Lipase 1, Lipase 3, and hormone-sensitive lipase (HSL; involved in lipid metabolism) for lipid metabolism. The primers design and synthesis were done by Biotech Bioengineering (Shanghai) Co. (table 2).
Primer information
Table 2 Long description
The table provides information on various genes, detailing their forward and reverse primer sequences along with their Gene Bank accession numbers. Notable entries include β-actin with accession number NM_001185145 and primers CCGTGATTTGACTGACTACCT and AGTTGCCATTTCCTGTTC. Apidaecin is listed with NM_001011642.1 and primers CTAGATCCGCCTACTCGACCTACG and CGGATGAGGTGGTCTTGGTTGTG. The table also includes defensin 1, IMD, Toll, INR, AKH, AKHR, Lipase1, Lipase3, and HSL, each with unique primer sequences and accession numbers. This data is crucial for genetic research and analysis, providing essential information for identifying and amplifying specific gene sequences. The table does not indicate any trends or comparisons between the genes, focusing solely on the primer sequences and accession data.
Statistical analysis
Statistical analysis was performed using SPSS 25.0 (SPSS Inc., Chicago, IL, USA). Data are presented as means ± SEM. For data from the 2 × 2 factorial diet design, a two-way Analysis of variance (ANOVA) was used to test the main effects of dietary Leu and Ile levels and their interaction. When interaction was significant (P < 0.05), post hoc comparisons among treatment groups were conducted using Duncan’s test. For colony-level parameters (population size and number of capped broods), differences among the four experimental groups were assessed by one-way ANOVA followed by Duncan’s test for multiple comparisons. Survival curves were compared by the log-rank (Mantel–Cox) test. In all cases, differences were considered significant at P < 0.05.
Results
Population size of bee colonies
Firstly, we counted the population size, number of capped broods, and feed intake of the bee colony during the formal experimental period (36 days), and measured the lifespan of bees treated with different diets through indoor feeding. The interaction of Leu and Ile had no significant effect on the population size and the number of capped broods in 36 days (P > 0.05, fig. 1A, 1B). Across the four dietary groups, no statistically significant variations were observed in the lifespan of the bees (P > 0.05, fig. 1C). However, a notable exception was found at 24 days post-treatment, where the addition of Leu and L-I led to a significant increase in population size compared to CK (P < 0.05, fig. 1A). Regarding feed intake, neither Leu nor Ile had a significant impact during the 36 days of the formal experiment (P > 0.05, fig. 1D), despite showing a discernible decreasing trend in intake over time.
The effect of feeding experimental feed on population size (A), number of capped brood (B) of colony, survival curve (C), and feed intake (D) of Apis mellifera. Data were expressed as means ± SEM (n = 5). The ‘P’ in the figure represents the interaction between Leu and Ile. The letters represent the results of one-way ANOVA, different letters represent significant difference (P < 0.05).
Figure 1 Long description
The image A shows a line graph with the x-axis labeled 'Time (Days)' and the y-axis labeled 'Bee population (Frame)'. It displays data points at 0, 12, 24 and 36 days for four treatments: CK, Ile, Leu and L-I. The graph includes statistical annotations indicating significance levels. The image B shows a line graph with the x-axis labeled 'Time (Days)' and the y-axis labeled 'Capped Brood (Frame)'. It presents data points at 0, 12, 24 and 36 days for the same treatments, with statistical annotations. The image C shows a survival curve with the x-axis labeled 'Time (Days)' and the y-axis labeled 'Percent survival (%)'. It depicts survival rates over 40 days for CK, Ile, Leu and L-I treatments. The image D shows a bar graph with the x-axis labeled 'Time (Days)' and the y-axis labeled 'Feed Intake (g/Frame)'. It shows feed intake at 12, 24 and 36 days for the four treatments, with statistical annotations indicating significance levels.
Haemolymph components
To investigate the effects of Leu and Ile on nutrient deposition in honeybees, we analysed the content of several important components (TP, TAG, TCHO, HDL, and LDL) in the haemolymph of 9-day-old bees. The results demonstrated that the interaction between Leu and Ile significantly affected the levels of TP, TAG, and TCHO in bee haemolymph (P < 0.05, table 3). The TP content of the Leu group was significantly higher than that of the other three groups, while the TAG content of the Leu and Ile groups was significantly lower than that of the CK group (P < 0.05, table 3), TAG content of the L-I group is the lowest. The effects of Leu and Ile on HDL and LDL levels in haemolymph follow a similar pattern, and no significant interaction was observed (P > 0.05, table 3).
The effect of feeding experimental feed on the haemolymph components of Apis mellifera
Table 3 Long description
The table examines the impact of different treatments on the hemolymph components of Apis mellifera, including total protein, triglycerides, total cholesterol, high-density lipoprotein, and low-density lipoprotein. Leu treatment resulted in the highest total protein levels, while L-I treatment showed the lowest triglyceride levels. Total cholesterol was highest with Ile treatment, and high-density lipoprotein was highest with Ile treatment as well. Significant differences were noted across all components, with interaction effects between Ile and Leu treatments. The data suggest that Leu treatment significantly increases total protein levels, while L-I treatment reduces triglyceride levels, indicating potential benefits of specific feed compositions.
Note: Data are expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction. TP, total protein; TAG, triglyceride; TCHO, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein.
Amino acids deposition in body
Due to the influence of Leu and Ile on TP content in haemolymph, we further measured the deposition of amino acids in bee bodies. As presented in table 4, Leu and Ile produced a significant interaction effect on a range of amino acids, including aspartate (Asp), Thr, glutamate (Glu), glycine (Gly), cysteine (Cys), Val, Met, Ile, Leu, tyrosine (Tyr), Phe, Lys, His, Arg, and proline (Pro) (P < 0.05). Among these, Ile played a predominant role. The levels of Asp, Glu, Gly, Cys, Leu, Tyr, Phe, Arg, and Pro of the body in Ile group were significantly higher than those in Leu and CK groups (P < 0.05, table 4). Due to the fact that Leu, Ile, and Val all belong to BCAAs, we paid particular attention to their content in the bee body. The results demonstrated that the level of Ile in the L-I group was significantly higher than that in all other groups (P < 0.05, table 4). Meanwhile, the level of Leu in the L-I group was significantly higher than in the CK and Leu groups (P < 0.05, table 4). And the level of Val was significantly higher than that in the CK and Leu groups (P < 0.05, table 4). Although there was no statistically significant difference in Val levels between the L-I and Ile groups (P > 0.05, table 4), there was a trend of increase.
The effect of feeding experimental feed on the amino acid content of the body of Apis mellifera
Table 4 Long description
The table measures the amino acid content in Apis mellifera under different feed treatments, including control, Ile, Leu, and combined Ile-Leu. Key findings include significant increases in essential amino acids such as Thr, Val, and Ile in the Ile and Leu treatments compared to control. The combined Ile-Leu treatment often resulted in the highest amino acid content, indicating potential synergistic effects. Statistical significance was determined using two-way ANOVA, with interactions noted between Ile and Leu. Variability is expressed as means with standard error, highlighting differences across treatments. The data suggest that experimental feed can enhance amino acid profiles in honeybees, with implications for their nutrition and health.
Note: Data were expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction.
a Means EAAs for honeybee.
Lipid metabolism
Given the significant regulatory effects of Leu and Ile on TAG and TCHO concentrations in honeybee haemolymph, we analysed the markers associated with lipid metabolism levels of bee bodies. As shown in table 5, there was a significant interaction between Leu and Ile on the activity of ACC in 9-day-old workers (P < 0.05). The addition of Ile notably enhanced ACC activity, with the L-I group showing significantly higher activity compared to all other groups (P < 0.05, table 5). But, the addition of Leu and Ile did not result in an interaction effect on FAS activity of honeybees at 9 days (P > 0.05, table 5). Table 6 further demonstrates that Leu and Ile interacted significantly in affecting the expression of AKHR, Lipase 1, Lipase 3, and HSL (P < 0.05). The expressions of AKHR and Lipase 1 in the Leu and Ile groups were lower than that in the L-I group (P < 0.05, table 6).
The effect of feeding experimental feed on the activities of lipid metabolism enzymes in Apis mellifera
Table 5 Long description
The table examines the impact of different experimental feeds on the activities of lipid metabolism enzymes, specifically acetyl CoA carboxylase (ACC) and fatty acid synthase (FAS), in Apis mellifera. The L-I treatment resulted in the highest ACC activity at 18.313 units per milligram, significantly higher than other treatments. FAS activity was also highest in the L-I group at 198.966 units per milligram. Both ACC and FAS activities showed significant differences across treatments, with the interaction between isoleucine and leucine also being significant for ACC. These findings suggest that the L-I treatment most effectively enhances enzyme activity, indicating a potential benefit for lipid metabolism in bees.
Note: Data were expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction. ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase.
The effect of feeding experimental feed on the expression level of lipid metabolism genes in Apis mellifera
Table 6 Long description
The table examines the impact of experimental feed on lipid metabolism gene expression in honeybees, focusing on AKH, AKHR, Lipase 1, Lipase 3, and HSL. AKHR and Lipase 1 showed significant increases in expression levels when treated with L-I compared to control, with interaction effects observed for AKHR and Lipase 1. AKHR, Lipase 1, and Lipase 3 exhibited significant differences across treatments, with AKHR and Lipase 1 showing the highest expression under L-I treatment. Lipase 3 expression was notably higher with Ile treatment. The significance of these differences was determined using a two-way ANOVA, highlighting the interaction between Ile and Leu treatments.
Note: Data are expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction. AKH, adipokinetic hormone; AKHR, AKH receptor; HSL, hormone-sensitive lipase.
Immune function
Table 7 shows that there is a significant interaction between different Leu and Ile treatments on the PO, LYS, and GOD activities of 9-day-old workers (P < 0.05). High concentrations of either Leu or Ile led to an increase in PO, LYS, and GOD activities, which were notably higher in the L-I group (P < 0.05, table 7). Leu and Ile have an interactive effect on the expression of bee antimicrobial peptide genes (abaecin, apidaecin, defensin 1) and INR (P < 0.05, table 8). The expression levels of apidaecin and abaecin in the Ile and Leu groups were significantly reduced, while the expression level of abaecin in the L-I group increased compared to the Ile and Leu groups (P < 0.05, table 8), but remained similar to the CK (P > 0.05, table 8). The expression patterns of apidaecin and abaecin are similar, but the expression level of apidaecin in the L-I group is lower compared to the CK (P < 0.05, table 8). At the same time, the defensin 1 expression level in the Leu group was significantly higher than that in the other three groups (P < 0.05, table 8), and INR expression level in the Ile group was significantly lower than that in CK and Leu groups (P < 0.05, table 8).
The effect of feeding experimental feed on the immune enzyme activities of Apis mellifera
Table 7 Long description
The table examines the impact of different experimental feeds on the immune enzyme activities of Apis mellifera, specifically glucose oxidase, phenol oxidase, and lysozyme. The L-I treatment resulted in the highest enzyme activities across all measured enzymes, indicating a significant enhancement compared to CK, Ile, and Leu treatments. Glucose oxidase activity was notably higher in the L-I group, with a mean value of 12.424, compared to 8.212 in the CK group. Similarly, phenol oxidase and lysozyme activities were elevated in the L-I treatment, with values of 7.262 and 3.094 respectively, compared to lower values in other treatments. Statistical analysis shows significant differences in enzyme activities across treatments, with interaction effects between Ile and Leu also being significant. These findings suggest that the combination of Ile and Leu in the L-I treatment synergistically enhances immune enzyme activities.
Note: Data were expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction. GOD, glucose oxidase; PO, phenol oxidase; LYS, lysozyme.
The effect of feeding experimental feed on the expression level of immune genes in Apis mellifera
Table 8 Long description
The table examines the impact of different feed treatments on the expression levels of immune genes in honeybees. Defensin 1 expression is notably higher with Leu treatment compared to other treatments. Apidaecin and abaecin show significantly reduced expression levels with Ile and Leu treatments compared to the control. Toll and Imd genes have increased expression with Ile treatment. Hymenoptaecin expression is highest with Ile treatment and lowest with Leu. The significance of these differences is determined by statistical analysis, indicating that some treatments have a significant impact on gene expression.
Note: Data are expressed as means ± SEM (n = 5). The values with different letters within each row represent significant differences (P < 0.05). Significant effects were determined by the two-way ANOVA. P < 0.05: significant difference, Ile × Leu: interaction.
Discussion
Leu and Ile regulate bee colony development
The population size of honeybees is the most common way for beekeepers to judge the health of bee colonies. High-quality and reasonable food resource allocation is conducive to promoting the growth of population size. The results of this experiment demonstrated that the population size receiving the supplemented Leu and Ile was significantly increased compared to CK at 24 days. But the changes in concentration of Leu and Ile did not elicit a statistically significant alteration in the amount of capped brood, feed intake, or longevity of the bees, suggesting that the concentrations employed in the experimental design were judicious and did not compromise the colony’s normal survival and reproductive dynamics. Dai’s (Reference Dai, Cao, Wang, Cheng, Gao, Luo, Ren, Ji, Xie and Liu2016) results showed that Leu levels of 43.75 and 52.5 g/kg in the diet significantly promoted colony development of honeybees during the breeding period, and our findings were consistent with their conclusions. Co-treatment of high concentrations of Leu and Ile (L-I group) resulted in an increase in population size, indicative of an enhanced nutrient utilisation efficiency within the bee colonies and a propensity towards favourable colony development. Interestingly, while no significant change in capped brood was detected, the combined Leu and Ile supplementation may have accelerated larval emergence or increased emergence rate. However, direct evidence is needed to confirm this interpretation. We observed a decreasing trend in the feed intake of the bee colony during the three stages of feeding, which may be due to the installation of the pollen trap (McLellan, Reference McLellan2015).
Interaction of Leu and Ile affects body nutrient deposition in honeybees
The haemolymph of the honeybee serves as a crucial medium for delivering nutrients to all tissues and cells, which is essential for maintaining the body’s physiological balance and regulating appetite (Thompson, Reference Thompson2003). In the context of our study, the interaction between Leu and Ile had a significant impact on the levels of TP, TAG, and TCHO in honeybee haemolymph.
The quality of the diet can be reflected in the protein and amino acids content of the bee body (Schmickl and Crailsheim, Reference Schmickl and Crailsheim2001). Adding high-level Leu significantly increased TP concentrations, which is consistent with substantial evidence indicating that Leu serves as a direct nutrient signal to enhance protein synthesis through mTOR pathway activation (Kaspy et al., Reference Kaspy, Hannaian, Bell and Churchward-Venne2023). Proteins and amino acids constitute integral components of the cytoskeleton, enzymes, receptors, tissues, and immune proteins, among others (Azevedo et al., Reference Azevedo, de Paula, Zanuncio, Martinez and Serrao2016). Their maintenance at an optimal level within bodily fluids is crucial. In our study, the interaction of Leu and Ile significantly affected the deposition levels of 15 amino acids in 9-day-old bees. The supplementation with Ile notably increased the levels of the majority of these amino acids within the bees’ bodies, suggesting a potentially more significant role for Ile in influencing amino acid levels in honeybees. Adequate Ile can enhance amino acid deposition in Nile tilapia fingerlings' muscle and blunt snout bream (Megalobrama amblycephala) liver, thereby improving its nutritional value (Araújo et al., Reference Araújo, Michelato, Schemberger, Salaro, Vidal, da Cruz, Furuya and Furuya2021; Wang et al., Reference Wang, Huang, Liu, Xiao, Wang, Guo, Zhang, Fan, Li and Jiang2022). Conversely, the high-level addition of Leu was associated with a decrease in the content of Asp, Thr, Glu, Val, Ile, Leu, Phe, Lys, His, Arg, and Pro, implying that the Leu concentration of 43.8 g/kg might potentially impede the absorption of certain amino acids. Based on Wang et al.’s (Reference Wang, Huang, Liu, Xiao, Wang, Guo, Zhang, Fan, Li and Jiang2022) results, we think that Ile seems to alleviate some of these absorption barriers, suggesting a balance in amino acid supplementation could be crucial for optimal nutritional outcomes in honeybee colonies. However, it should be noted that direct comparisons between fish and insects are limited due to differences in their physiology and amino acid metabolism. Consequently, further studies specifically on honeybees is necessary.
TAG is predominantly stored in the fat body of bees as a form of energy reserve, particularly during periods of starvation and overwintering (Hahna and Denlinger, Reference Hahna and Denlinger2007). Our data demonstrated that Ile and Leu administration at tested concentrations significantly reduced lipid accumulation in honeybees, with their combination exhibiting a synergistic effect on TAG regulation, as evidenced by a greater reduction in TAG levels compared to individual high-level treatments. TCHO, a crucial constituent of insect biofilms (Haas et al., Reference Haas, Kim and Stanley2022), exhibited differential change in response to BCAAs supplementation. Our data revealed that high-level addition of Leu administration significantly reduced haemolymph TCHO levels, aligning with mammalian studies demonstrating Leu’s cholesterol-lowering effects (Ifrim et al., Reference Ifrim, Amalinei, Cojocaru and Matei2018). Interestingly, adding high-level Ile paradoxically increased TCHO concentrations, a phenomenon contrasting with reported effects in mammalian (Ifrim et al., Reference Ifrim, Amalinei, Cojocaru and Matei2018). The observed variation could potentially be attributed to intra-species metabolic discrepancies. The exact reasons for this difference require further investigation.
The debate over whether BCAAs, such as Leu and Ile, promote lipid deposition or lipolysis has been extensive, with varying results reported across different studies (Ma et al., Reference Ma, Zhou, Hu, Chen, Zhu and Shan2020; Liu et al., Reference Liu, Sun, Zhao, Wang, Zhang and Pang2021; Zhao et al., Reference Zhao, Dong, Guo, Feng, Liu, Jiang, Wu, Luo, Huang, Chen, Zhou and Jiang2022). In bees, lipid metabolism and synthesis are jointly controlled by multiple enzymes and hormones. FAS is a highly conserved key protein in the fatty acid biosynthesis pathway, especially the synthesis of palmitic acid, a precursor of many other lipids (Wang et al., Reference Wang, Shen, Xing, Xie, Li, Liu, Wang, Wu and Sheng2020). ACC catalyses the carboxylation of acetyl-CoA to form malonyl-CoA during the de novo synthesis of fatty acids. ACC plays a central role in the nutritional homeostasis of insects, and its activity is important for insect digestion, lipid synthesis and storage, and reproductive (Moraes et al., Reference Moraes, Braz, Santos-Araujo, Oliveira, Bomfim, Ramos and Gondim2022). Within lipid mobilisation pathways, general lipases mediate TAG hydrolysis to free fatty acids and glycerol (Holm et al., Reference Holm, Belfrage, Østerlund, Davis, Schotz and Langin1994), while HSL specifically governs the rate-limiting step of stored TAG catabolism, positioning it as a central modulator of energy balance (Toprak, Reference Toprak2020). These metabolic processes are coordinately regulated by the AKH and AKHR, which collectively control carbohydrate and lipid mobilisation from insect fat body (Lee and Park, Reference Lee and Park2004; Gáliková et al., Reference Gáliková, Diesner, Klepsatel, Hehlert, Xu, Bickmeyer, Predel and Kühnlein2015). Collectively, these interconnected systems maintain lipid homeostasis in the honeybee while modulating physiological performance.
Leu and Ile coordinate systemic lipid metabolism through insulin signal transmission, insulin secretion, and gut microbiota structure (Ma et al., Reference Ma, Zhou, Hu, Chen, Zhu and Shan2020; Liu et al., Reference Liu, Sun, Zhao, Wang, Zhang and Pang2021; Zhou et al., Reference Zhou, Chen, Sun, Wang, Zhu, Yue, Zhang, Shan, Ma and Wang2021). In honeybees, our results suggest a potential role for these BCAAs in modulating lipid homeostasis. We posit that BCAAs predominantly modulate lipid homeostasis within the body, facilitating the metabolism of excessive lipids during overnutrition. The results of the present study demonstrated that Leu and Ile had significant interaction effects on markers associated with lipid metabolism. Supplementation with high level of Ile specifically enhanced ACC activity and upregulated AKH and Lipase 3 expression. Notably, co-treatment of high concentrations of Leu and Ile (L-I group) induced coordinated changes in lipid metabolic enzymes and related genes. These results are basically consistent with previous research that Leu-Ile interaction mobilises lipid metabolism (Liu et al., Reference Liu, Sun, Zhao, Wang, Zhang and Pang2021; Zhou et al., Reference Zhou, Chen, Sun, Wang, Zhu, Yue, Zhang, Shan, Ma and Wang2021).
These findings suggest that dietary Leu and Ile with different concentrations coordinately regulate the composition of bee body components, including amino acids deposition and lipolytic activity. Previous studies have demonstrated that excessive dietary Leu impairs growth performance and induces metabolic dysregulation in pigs, a phenomenon attributed not to BCAA antagonism but rather to intrinsic Leu toxicity or the energy expenditure required for its catabolic processing (Ahmed and Khan, Reference Ahmed and Khan2008; Kwon et al., Reference Kwon, Touchette, Simongiovanni, Syriopoulos, Wessels and Stein2019). Notably, in our experimental system, the relatively high Leu supplementation did not elicit developmental abnormalities in honeybee colonies. Our experimental concentration of Leu was insufficient to cause toxicity to bees, adding Ile was sufficient to balance the decrease in amino acid deposition caused by Leu. Thus, at experimental concentrations, increasing the levels of Leu and Ile in the diet can stimulate lipid mobilisation without disrupting bee amino acid deposition, which could be beneficial for colony resilience. However, further studies involving measuring the level of lipid metabolism directly in honeybees are needed to definitively confirm the effects of Leu and Ile on lipid metabolism.
Interaction of Leu and Ile affects the immune performance of honeybees
From the above results, we know that the interplay between Leu and Ile modulates amino acid deposition and lipid metabolism of bees. The immune activity of bees requires amino acids to form immune-related peptides and the energy generated by lipid metabolism. Given this connection, we systematically investigated the immunomodulatory potential of Leu and Ile through a comprehensive analysis of immune performance indexes.
The honeybee immune system consists of a complex network including cellular and humoral immune defence (Evans and Spivak, Reference Evans and Spivak2010). The humoral component comprises innate immune factors in the haemolymph, primarily consisting of diverse immune enzymes, complemented by acquired immunity mediated through antimicrobial peptides, including abaecin, apidaecin, hymenoptaecin, and defensins (Danihlík et al., Reference Danihlík, Aronstein and Petřivalský2016). These peptides exhibit varying degrees of efficacy in inhibiting the growth of bacteria, parasites, and other microorganisms (Li et al., Reference Li, Mu, Wang, Yu, Hu and Li2017; Díaz-Garrido et al., Reference Díaz-Garrido, Cárdenas-Guerra, Martínez, Poggio, Rodríguez-Hernández, Rivera-Santiago, Ortega-López, Sánchez-Esquivel and Espinoza2021). PO plays a key role in insect melanin biosynthesis, serves as a crucial defence mechanism against pathogenic microorganisms (Eleftherianos and Revenis, Reference Eleftherianos and Revenis2011). GOD is a biomarker of social immunity and plays a catalytic function in the production of gluconic acid and hydrogen peroxide, which are key antimicrobial roles in colony sterilisation (Alaux et al., Reference Alaux, Ducloz, Crauser and Conte2010; Brudzynski, Reference Brudzynski2020). LYS enzymatically degrades bacterial cell walls via hydrolysis of β-(1,4)-glycosidic bonds in peptidoglycan (Ferraboschi et al., Reference Ferraboschi, Ciceri and Grisenti2021). Quantitative analysis of these enzyme activities, along with antimicrobial peptides expression profiles, provides a reference for assessing insect immunocompetence.
The results of the present study demonstrated a significant synergistic interaction between Leu and Ile in modulating honeybee immunity. Co-treatment of high concentrations of Leu or Ile elicited enhancement of three pivotal immune enzymes and differential expression of three antimicrobial peptides. Overall, the treatment with high levels of Leu and Ile demonstrated superior immune function compared to the treatment with either high Leu or Ile. A limitation of this study is that our conclusions regarding immune function are derived exclusively from measurements of immune enzyme activities and gene expression. While these biomarkers are widely used to infer immune status, survival analyses or pathogen load quantification following controlled infection would provide more direct evidence for the immunomodulatory effects of dietary Leu and Ile. Therefore, we recommend that future research combine dietary amino acid manipulation with pathogen challenge experiments to verify our findings further.
The mechanisms by which Leu and Ile modulate immune function have been more extensively investigated in mammals and fish. Based on these studies, the immune-enhancing effect of Leu on bees may be mediated by activating the metabolite of Leu, β-hydroxy β-butyric acid methyl ester or the gut microbiota structure of bees (Siwickia et al., Reference Siwickia, F, Nissen, Ostaszewski and Studnicka2000; Song et al., Reference Song, Zheng, Zha, Hu, Yang, Wang and Xiao2019). Ile can regulate the gut microbiota structure of bees or provide energy or substrates for immune system (Nie et al., Reference Nie, He, Zhang, Zhang and Ma2018; Jiang et al., Reference Jiang, Chen, Yang, Li, Jin, Ghonaim, Li and Ren2024). We think that Leu and Ile provide amino acid substrates and lipid metabolism energy supply for bee immune activity, reasonably. Unfortunately, there is no direct evidence to support this. Therefore, in subsequent studies, it is imperative to investigate further the mechanisms through which Leu and Ile coordinately regulate immune functionality in honeybees, with gut microbiota composition and its metabolic interaction as a potential study direction.
Conclusion
In summary, the interaction between Leu and Ile exerts a multifaceted influence on the nutritional deposition and immune responsiveness of honeybees. The addition of 43.8 g/kg Leu significantly reduced the amino acid deposition in the honeybees, while concurrent administration of 21.9 g/kg Ile effectively counterbalanced this trend. The synergistic combination of Leu and Ile significantly changed lipid metabolic processes, and the energy generated during this process may serve as a source for immune activation in bees. Therefore, based on this experiment, 43.8 g/kg Leu and 21.9 g/kg Ile in artificial pollen diets are more conducive to the development of bee colonies. Furthermore, our research findings underscore the importance of considering the interaction among amino acids, emphasising that the optimisation of their ratios is a crucial aspect of bee colony management. Adjusting the proportion of dietary amino acids may be a promising strategy for improving the reproductive and adaptability of bee colonies. It should be noted that, in practical application, the ratio of Leu to Ile should be adjusted according to the specific composition of different artificial pollen substitutes, which is also a limitation of this study.
Financial support
This work was financially supported by the Key R&D Program of Shandong Province, China (Nos. 2023TZXD079 and 2023LZGC017), the National Natural Science Foundation of China (No. 32272937), and the Earmarked fund for China Agriculture Research System (CARS-44).
