Introduction
Although 14 species of carcharhinid sharks have been reported in Puerto Rico (Russell et al., Reference Russell, Gutherz and Barans1988; Dennis, Reference Dennis2000; Bunkley-Williams & Williams, Reference Bunkley-Williams and Williams2004), this number may be an underestimate due to a lack of monitoring and data reporting on the island, especially for the pelagic and deep-water species. The night shark (Carcharhinus signatus, Poey 1868) is a species of pelagic and coastal distribution throughout its range in the Atlantic Ocean with reports from shelf regions of the eastern North, Central and South American continents, a few Caribbean islands, and off western Africa (Espinoza et al., Reference Espinoza, Díaz, Angulo, Hernández and Clarke2018; Ehemann et al., Reference Ehemann, González-González, Tagliafico and Weigmann2019; Mejía-Falla & Navia, Reference Mejía-Falla and Navia2019). Genetic connectivity between the north and south Atlantic populations of this species is considered low (Domingues et al., Reference Domingues, Bruels, Gadig, Chapman, Hilsdorf and Shivji2018), and once common in Cuban waters it is now considered rare (Castro, Reference Castro2011). In US waters, fisheries-dependent data indicated no apparent decline of C. signatus (Carlson et al., Reference Carlson, Cortés, Neer, McCandless and Beerkircher2008), yet significant population reductions throughout its range led to the species' reclassification from ‘Vulnerable’ to ‘Endangered’ (A2bd ver 3.1) by the IUCN in the most recent Red List assessment (Carlson et al., Reference Carlson, Charvet, Blanco-Parra, Briones Bell-lloch, Cardenosa, Crysler, Espinoza, Herman, Morales-Saldaña, Naranjo-Elizondo, Pacoureau, Pérez Jiménez, Schneider, Simpson and Talwar2021). The native range of C. signatus has been postulated to include Puerto Rico, yet no confirmed records were available to date.
Elasmobranchs are a common occurrence in Caribbean fisheries, either targeted directly or caught incidentally (Bonfil, Reference Bonfil1997; Hacohen-Domené et al., Reference Hacohen-Domené, Polanco-Vásquez, Estupiñan-Montaño and Graham2020; Del Pilar Blanco-Parra & Niño-Torres, Reference Del Pilar Blanco-Parra and Niño-Torres2022). The diversity and abundance of sharks in the insular Caribbean have been reportedly low except in areas with relatively lower fishing pressure (Ward-Paige et al., Reference Ward-Paige, Mora, Lotze, Pattengill-Semmens, McClenachan, Arias-Castro and Myers2010; Van Beek et al., Reference Van Beek, Debrot and de Graaf2013; MacNeil et al., Reference MacNeil, Chapman and Heupel2020). Small-scale fisheries in Puerto Rico generally do not target pelagic sharks, however incidental captures and discards of sharks are rarely reported to the species level. Landings of sharks by commercial fishers in Puerto Rico are relatively low (less than 20,000 lb year−1), yet the species composition for elasmobranchs is mostly unknown (Schärer-Umpierre et al., Reference Schärer-Umpierre, Ruiz, Zayas-Santiago and Bond2021), which may limit the identification of fisheries impacts upon threatened and endangered sharks.
Confirmed species reports and accurate distributions are key to inform biodiversity hotspots, conservation status and to inform fisheries management in the region (Macbeth et al., Reference Macbeth, Butcher, Collins, McGrath, Provost, Bowling, Geraghty and Peddemors2018). Challenges with accurate shark species identification, limited research and lack of monitoring as well as a scarcity of fishery discard reports increase the probability that rare and uncommon species are overlooked and unreported (Mucientes et al., Reference Mucientes, Vedor, Sims and Queiroz2022). The development and increased accessibility of genetic identification techniques such as DNA barcoding have improved the accuracy and number of elasmobranch reports in areas with limited capacity (Cañedo-Apolaya et al., Reference Cañedo-Apolaya, Ortiz-Alvarez, Alfaro-Cordova, Alfaro-Shigueto, Velez-Zuazo, Mangel and Ramirez2021). In a combination of fishers' cooperation, photo identification and genetic analysis of samples collected, this note provides the first confirmed record of C. signatus in Puerto Rico.
Materials and methods
A large unidentified species of shark was captured during a small-scale commercial fishing trip targeting deep-water (100–500 m) snappers and groupers. This incidental capture occurred on 23 August 2019, off western Puerto Rico, 51.5 km west of Mayagüez (18.256°N 67.637°W) in a fishing ground known as La Rondana. This area is situated in between seamounts and deep (200–500 m) ridges that extend from Puerto Rico towards Cabo Engaño, Dominican Republic (Figure 1).
Location of capture site (
) La Rondana, in the Mona Passage, Puerto Rico.
The hook and line gear used is known locally as ‘cala con boya’ with a weighted vertical long line with 12 circle hooks (size #9) at the distal end baited with skipjack tuna (Katsuwonus pelamis), attached to a floating buoy that is left to drift with the current. Hook leaders measure ~46 cm from the main vertical braided line, which is retrieved with an electric reel. Upon retrieval the shark was dead, entangled by the main line at the distal end of the gear, with lines tightly wrapped around the tail and body with multiple hooks embedded in its skin. The gear had been soaking for ~30 min at a depth of 330 m. Photos, a description of the shark's appearance and a small tissue sample preserved in 90% alcohol were made available to the authors. All measurements were estimated by the crew prior to discarding it at sea.
DNA barcoding using mitochondrial gene cytochrome oxidase subunit 1 (CO1) was used to genetically identify the species. A small amount of white muscle was preserved in 90% ethanol, and genomic DNA was extracted from ~25 mg of the tissue sample using the QIAGEN DNeasy kit (QIAGEN Inc., Valencia, CA, USA). A ~355-base pair (bp) fragment from the region was amplified with polymerase chain reaction (PCR) using the primer set LCOI (5′- ggtcaacaaatcataaagatattgg -3), and HCOI (5′- taaacttcagggtgaccaaaaaatca -3′) (Folmer et al., Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994). The thermal conditions of the PCR reaction were: 3 min at 94°C; 35 cycles of 40 s at 94°C, 40 s at 50°C and 1 min at 72°C; and a final extension of 7 min at 72°C as was performed by Fariña et al. (Reference Fariña, Quinteiro and Rey-Méndez2014). The amplified product was sent to MCLAB-San Francisco, CA for sequencing. DNA (CO1) sequences were inspected for quality, end-trimming and base assignment accuracy in Geneious (v11.1.5). Sequence direction was determined and standardized across sequence sets using Geneious and the Basic Local Alignment Search Tool (BLASTn) in the National Center for Biotechnology Information (NCBI) for identification.
Results
The non-gravid female shark had an estimated total length of 215 cm and approximate weight of 65 kg (Figures 2 and 3). Photos were examined by one of the authors and some of the most notable characteristics used for preliminary identification of Carcharhinus signatus included large green coloured eyes, a slender pointed snout, and relatively low first dorsal fin. Genetic analysis of the tissue sample's COI sequences (363 bp) matched 99.45% with the COI sequence of C. signatus (GenBank: MH911151.1). There was no sequence divergence (p-distance) between the Puerto Rico and the Brazil specimen. Thus, the species identification of this specimen is confidently assigned to C. signatus (GenBank: MZ413382).
Ventral view of shark head.
Lateral view of shark head and pectoral fins.
Discussion
This observation confirms the species range and increases the island's recorded elasmobranch biodiversity. The range of C. signatus includes most of the Atlantic Ocean, mainly off the North-west Atlantic continental shelf, including the USA, Caribbean and Gulf of Mexico to South America extending to Argentina (Bigelow et al., Reference Bigelow, Farfante and Schroeder1948; Compagno, Reference Compagno1984; Menni et al., Reference Menni, Hazin and Lessa1995; Marín et al., Reference Marín, Brum, Barea and Chocca1998). It has also been reported off the West African coast in both Senegal and Namibia (Castro, Reference Castro2011; Ebert et al., Reference Ebert, Fowler and Compagno2013). Caribbean reports to date have occurred mostly off the Central American and South American continental shelves and the islands of the Bahamas and Cuba (Kohler et al., Reference Kohler, Casey and Turner1998; Santana et al., Reference Santana, Lessa and Carlson2006; Aguilar et al., Reference Aguilar, González-Sansón, Hueter, Rojas, Cabrera, Briones, Borroto, Hernández and Baker2014; Cortés et al., Reference Cortés, Domingo, Miller, Forselledo, Mas, Arocha, Campana, Coelho, Da Silva, Hazin, Hotzhausen, Keen, Lucena, Santos, Semba-Murakiami and Yokawa2015; Hacohen et al., Reference Hacohen-Domené, Polanco-Vásquez, Estupiñan-Montaño and Graham2020). Movement data gleaned from one tagged C. signatus showed migration between Cuba and Belize (Baremore et al., Reference Baremore, Polanco-Vásquez, Hacohen-Domené, Castellanos and Graham2019).
Although Puerto Rico is within the reported range of C. signatus a confirmed locality is key to understanding their population connectivity in the western Atlantic (Domingues et al., Reference Domingues, Bruels, Gadig, Chapman, Hilsdorf and Shivji2018). It is also important for studies of zoogeography, since one other elasmobranch, Urobatis jamaicensis, occurs only at Mona Island (Dennis et al., Reference Dennis, Smith-Vaniz, Colin, Hensley and McGehee2005), and not 42 km eastwards on the insular platform of Puerto Rico. This report also increases the confirmed number of species in the family Charcharhinidae occurring in Puerto Rico to 15 (Russell et al., Reference Russell, Gutherz and Barans1988; Dennis, Reference Dennis2000; Bunkley-Williams & Williams, Reference Bunkley-Williams and Williams2004).
The night shark is a deep-water coastal or semi-oceanic species inhabiting waters ranging from 50–600 m in depth (Compagno, Reference Compagno1984; Ebert et al., Reference Ebert, Fowler and Compagno2013). Its vertical distribution coincides with pelagic long-lines as well as demersal hook and line gears, often deployed at seamounts and abrupt seafloor features (D’Ambrosio-Ferrari et al., Reference D'Ambrosio-Ferrari, Kotas and Spach2018). Fisheries interactions with sharks in Puerto Rico have only recently been documented for the local small-scale commercial fleet (Schärer-Umpierre et al., Reference Schärer-Umpierre, Peña-Alvarado, Smith, Appeldoorn and Ault2019), and very limited information regarding mortality and discards from long-liner logbooks is available for the region (Cortés et al., Reference Cortés, Brown and Beerkircher2007; Mucientes et al., 2022). The size of this female suggests it was mature, based on the total length at maturity (205 cm) reported in the south-western equatorial Atlantic (Hazin et al., Reference Hazin, Lucena, Souza, Boeckman, Broadhurst and Menni2000). Due to the scant information available regarding the ontogenetic habitat use of sharks, the relative risk of non-targeted fishery interactions to highly migratory species in the US Caribbean remains unknown.
Confirmation of C. signatus occurrence in Puerto Rico for the first time is likely due to a combination of misidentifications, misreporting, lack of a fisheries landing's validation programme, absence of at-sea observers (contrary to the fleets operating off USA) and research capacity limitations. The low biological productivity, highly migratory nature, low resilience to fishing mortality (Musick et al., Reference Musick, Burgess, Cailliet, Camhi and Fordham2011) combined with unreported discards of endangered, threatened and protected sharks (Mucientes et al., 2022) require a particular methodology to evaluate the effectiveness of fisheries management and conservation strategies for this and other highly migratory as well as threatened and endangered species. Species-specific information regarding the distribution, habitat use and types of fishery interactions is required to design adequate strategies to address the decline of shark populations in the region.
SYSTEMATICS
Order CARCHARHINIFORMES Family CARCHARHINIDAE Genus Carcharhinus Carcharhinus signatus (Poey, 1868)
Data
All relevant data are within the manuscript.
Acknowledgements
Cooperation of the fishers was instrumental to document this report. We are indebted to N. Schizas for the use of the laboratory facilities at the Department of Marine Sciences, University of Puerto Rico, Lajas.
Author contributions
M.T.S. conceptualized the research, collected the data, investigated, created the figures, drafted the original manuscript, and edited the various versions. G.F.-R. conducted the laboratory and sequencing analyses and reviewed and edited the manuscript.
Financial support
The Save Our Seas Foundation (grant # SOSF 516) funded all of the genetic analyses, and partial support for G.F.-R. was provided by the Sea Grant College Program of the University of Puerto Rico, Mayagüez Campus.
Conflict of interest
None.
Ethical standards
Not applicable.
