Introduction
In view of the ectothermic nature exhibited by insects, they are highly susceptible to various biotic and abiotic factors. Notably, temperature fluctuations in their surrounding environment pose significant challenges to their survival, and the ability to adapt to heat stress is paramount for the successful completion of their lifecycle (Clarke, Reference Clarke2003). Heat shock proteins (Hsps), a class of proteins synthesised in response to cold, heat or other environmental stressors, are crucial components of the genetic mechanism underlying insect thermotolerance (Arya et al., Reference Arya, Mallik and Lakhotia2007). The genetic mechanism of insect thermotolerance is regulated by the synthesis of Hsps. They are abundant in insects and play a crucial role in enhancing adaptation to biotic and abiotic stress in the environment, as well as regulating development and dormancy. These proteins are ubiquitously present in insects and play a vital role in facilitating adaptation to both biotic and abiotic stresses encountered in their environment, while also participating in the regulation of development and dormancy (Zhang and Denlinger, Reference Zhang and Denlinger2010; Zhao and Jones, Reference Zhao and Jones2012). Hsps, functioning as molecular chaperones, fulfil a distinctive role in safeguarding cellular proteins during biosynthesis and refolding processes (Zhang and Denlinger, Reference Zhang and Denlinger2010; King and MacRae, Reference King and MacRae2015a). Originally identified in Drosophila, subsequent investigations have revealed their abundance and considerable diversity (Ashburner and Bonner, Reference Ashburner and Bonner1979). Notably, Hsps can be classified into five major classes, namely Hsp100, Hsp90, Hsp70, Hsp60 and small (20–40 kD) Hsps, based on their amino acid sequences, molecular weights and functional attributes (Morimoto, Reference Morimoto1998).
Diapause, a crucial stage of developmental arrest observed in insects, serves as a prominent survival strategy allowing them to endure unfavourable environmental conditions (Denlinger, Reference Denlinger2002). This phenomenon is initiated by changes in photoperiod and temperature, while its regulation involves a complex interplay of endogenous hormones and molecular factors (King and MacRae, Reference King and MacRae2015b). A comprehensive understanding of the molecular mechanisms underlying diapause initiation and termination is instrumental in unravelling its intricate nature. Research endeavours have indicated a significant association between the regulation of Hsps and the specific type of diapause, with a particular focus on winter diapause in most extensive investigations (MacRae, Reference MacRae2010; King and MacRae, Reference King and MacRae2015b). Studies conducted on Drosophila melanogaster have revealed comparable levels of DtHsp70 between non-diapausing and diapausing insects (Kimura et al., Reference Kimura, Yoshida and Goto1998). In contrast, non-diapausing crustaceans exhibit upregulated expression of Hsp70A in comparison to their diapausing counterparts (Aruda et al., Reference Aruda, Baumgartner, Reitzel and Tarrant2011). Furthermore, diapausing individuals of the oriental fruit moth exhibit an upregulation of both Hsp70 and Hsp90 (Sonoda et al., Reference Sonoda, Fukumoto, Izumi, Yoshida and Tsumuki2006). In Sarcophaga crassipalpis, Hsp70 transcription is undetectable in non-diapausing individuals, but it becomes upregulated during the pre-diapause phase. Moreover, the expression of Hsp90 demonstrates a downregulation during diapause and maintains relatively low levels throughout this stage (Hayward et al., Reference Hayward, Pavlides, Tammariello, Rinehart and Denlinger2005). Collectively, these investigations suggest that different categories of Hsps may fulfil distinct roles during diapause across various species.
Aspongopus chinensis Dallas, 1851, holds significant importance as a valuable insect resource for medicinal and dietary purposes, exhibiting notable attributes such as anti-cancer, antibacterial, anticoagulant, tonic and aphrodisiac effects (Wei et al., Reference Wei, Shu, Luo and Guo2015; Yang et al., Reference Yang, Tan, Cao, Jin and Guo2016; Tan et al., Reference Tan, Tian, Cai, Yi, Jin and Guo2019). In recent years, the growing recognition of A. chinensis for its medicinal value, particularly in anti-cancer and antibacterial domains, has resulted in an escalating demand within the market (Tan et al., Reference Tan, Tian, Cai, Yi, Jin and Guo2019; Wu, Reference Wu2019). However, the wild population of A. chinensis is dwindling due to limited resources and detrimental practices like excessive collection and environmental pollution. Consequently, the adoption of artificial breeding emerges as a crucial approach to mitigate the scarcity of A. chinensis. Nonetheless, the occurrence of overwintering diapause poses a significant challenge, with a single generation experiencing a diapause period lasting 7–8 months (Wei et al., Reference Wei, Shu, Luo and Guo2015). Addressing the key scientific quandary of diapause is paramount for the successful implementation of large-scale artificial breeding programmes for A. chinensis, while the expression patterns of Hsps have been elucidated in Drosophila species and certain model insects (Kregel, Reference Kregel2002; Tower, Reference Tower2011), there is a dearth of information regarding Hsp expression patterns in A. chinensis. Exploring the Hsp gene family, identifying its distinctive characteristics, and investigating its involvement in diapause would be instrumental in addressing this critical scientific challenge and facilitating the achievement of large-scale artificial breeding of A. chinensis.
In this investigation, we have successfully identified a comprehensive set of 25 Hsp genes within the A. chinensis genome, encompassing two Hsp90, 14 Hsp70, four Hsp60 and five small heat shock protein (sHsp) genes. To gain insights into the expression dynamics of these Hsp genes in the context of diapause and non-diapause conditions, we conducted a thorough analysis of the A. chinensis transcriptome. Our findings reveal a noteworthy down-regulation of A. chinensis Hsp (AcHsp)70-5, a distinguished member of the Hsp70 subfamily, specifically during diapause, while exhibiting enrichment in the pathway of response to hormone. These observations were further corroborated by qPCR, unequivocally confirming the substantial differential expression of AcHsp70-5. By shedding light on the molecular evolution mechanism of the Hsp gene family within A. chinensis, our study established a compelling association between AcHsp70-5 and diapause, attributing its probable role in the pathway of response to hormone, providing a possibility to overcome the diapause of A. chinensis.
Materials and methods
Dataset resources and identification of Hsp genes
The intricate genomic composition of A. chinensis is accessible on the National Center for Biotechnology Information (NCBI) under the BioProject PRJNA729875 from our previous investigation (Jiang et al., Reference Jiang, Yin, Cai, Yu, Lu, Zhao, Tian, Yan, Guo and Chen2021). Retrieving the published Hsp protein families of Nilaparvata lugens, Drosophila ananassae and Bemisia tabaci (Wang et al., Reference Wang, Wang, Ban, Zhu, Liu and Wang2019) served as query sequences, and a tBlastN with a stringent E-value cut-off (<e-20) was employed to search against the A. chinensis genome. Significant hits were subjected to analysis using the NCBI Conserved Domain Database (NCBI CDD; http://www.ncbi.nlm.nih.gov/cdd) (Marchler-Bauer et al., Reference Marchler-Bauer, Derbyshire, Gonzales, Lu, Chitsaz, Geer, Geer, He, Gwadz, Hurwitz, Lanczycki, Lu, Marchler, Song, Thanki, Wang, Yamashita, Zhang, Zheng and Bryant2015) to confirm the identified sequences containing functional conserved domains related to each HSP family.
The chromosomal localisation of AcHsps was analysed using the TBtoools (Chen et al., Reference Chen, Chen, Zhang, Thomas, Frank, He and Xia2020) according to the physical map described in the genome annotation files (.gff3) of A. chinensis (Jiang et al., Reference Jiang, Yin, Cai, Yu, Lu, Zhao, Tian, Yan, Guo and Chen2021).
Phylogenetic analysis and classification of Hsp genes
For the purpose of phylogenetic analysis, all identified putative Hsps were aligned by Muscle v3.8.1551 (Edgar, Reference Edgar2004) with default option. Subsequently, the three phylogenetic trees were constructed utilising Iqtree v2.0.3 (Nguyen et al., Reference Nguyen, Schmidt, von Haeseler and Minh2015) through maximum likelihood employing the LG + F + R4, WAG + F + G4, WAG + F + G4 models, respectively. iTOL (https://itol.embl.de/itol.cgi) was used to enhance the visualisation of the phylogenetic trees (Letunic and Bork, Reference Letunic and Bork2021). PhyloSuite v1.2.3 was employed for reconstructing the phylogenetic tree utilising the Mrbayes method (Zhang et al., Reference Zhang, Gao, Jakovlic, Zou, Zhang, Li and Wang2020) to ensure the robustness of the ML method.
Characteristics of AcHsps
The molecular weight and isoelectric points of A. chinensis were determined using the Compute pI/Mw tool available on ExPASy (https://web.expasy.org/compute_pi/) (Bjellqvist et al., Reference Bjellqvist, Basse, Olsen and Celis1994). The prediction of subcellular localisation was accomplished using the PSORT tool (https://www.psort.org/) (Nakai and Horton, Reference Nakai and Horton1999).
To assess the genomic arrangements of Hsp genes in A. chinensis, the gff3 file of A. chinensis from BioProject PRJNA729875 (Jiang et al., Reference Jiang, Yin, Cai, Yu, Lu, Zhao, Tian, Yan, Guo and Chen2021) was imported into TBtools (Chen et al., Reference Chen, Chen, Zhang, Thomas, Frank, He and Xia2020), this facilitated the graphical depiction of coding sequence (cds)/intron numbers and positions.
The investigation of conserved motifs was performed using the online program Multiple Expectation Maximization for Motif Elicitation (Bailey et al., Reference Bailey, Boden, Buske, Frith, Grant, Clementi, Ren, Li and Noble2009) to evaluate the structural diversity of AcHsps. The following parameters were employed: distribution of motifs (zero or one per sequence), maximum number of motifs (20), number of repetitions (any) and optimum motif width ranging from 10 to 70 residues for Hsp family members. The outcomes were visually presented using TBtools.
Transcriptome analysis of diapause period and non-diapause period
Aspongopus chinensis individuals in diapause were gathered along the Chishui River in Xijiu Town, Guizhou Province, China (106°10′E, 28°09′N) in November 2017. Among these individuals, those in N-diapause were chosen and raised in laboratory under the conditions of an 8 h light/16 h photoperiod and a temperature of 28 ± 1°C until mating. The mating behaviour of A. chinensis serves as the identification standard of N-diapause (Wu et al., Reference Wu, Tian, Tan, Zhao, Zhou, Luo and Guo2021). The library underwent high-throughput sequencing on the Illumina HiSeq X Ten platform, featuring paired-end reads with a length of 150 bp, after quantification using the TBS380 system (Picogreen, Promega, Madison, WI, USA) (Wu et al., Reference Wu, Tian, Tan, Zhao, Zhou, Luo and Guo2021). Three biological replicates were sequenced for both the diapause and N-diapause groups. The raw sequence data have been deposited in the NCBI Short Reads Archive (SRA) under the BioProject number PRJNA1064550.
The transcriptome data of A. chinensis diapause and non-diapause periods, with three biological replicates per period, were analysed as follows, Fastp v0.20.0 (Chen et al., Reference Chen, Zhou, Chen and Gu2018) was used to remove low-quality reads to obtain clean data (Q-value < 20). Reference genome data and annotation files of A. chinensis were downloaded from BioProject PRJNA729875. Using RSEM v1.3.1 (Li and Dewey, Reference Li and Dewey2011), STAR v2.7.10a (Dobin et al., Reference Dobin, Davis, Schlesinger, Drenkow, Zaleski, Jha, Batut, Chaisson and Gingeras2013) was called to create index files and express quantification. Finally, the DESeq2 package (Haas et al., Reference Haas, Papanicolaou, Yassour, Grabherr, Blood, Bowden, Couger, Eccles, Li, Lieber, MacManes, Ott, Orvis, Pochet, Strozzi, Weeks, Westerman, William, Dewey, Henschel, LeDuc, Friedman and Regev2013) was invoked by trinityrnaseq-v2.14.0 (Haas et al., Reference Haas, Papanicolaou, Yassour, Grabherr, Blood, Bowden, Couger, Eccles, Li, Lieber, MacManes, Ott, Orvis, Pochet, Strozzi, Weeks, Westerman, William, Dewey, Henschel, LeDuc, Friedman and Regev2013) for differential expression analysis. The code can be obtained from https://github.com/Mxy0820/Transcriptome-expression-matrix-mapping.
We set the padj < 0.05 and | log 2 FC| > 1 as the standard to select the different expressed genes (DEGs) between the two stages. Functional enrichment analyses of DEGs were performed using the gene ontology (GO) term background data sets constructed according to A. chinensis mRNA sequences. In our study, the padj ≤ 0.05 was considered as significantly enriched GO terms by ClusterProfiler v3.16.0 (Yu et al., Reference Yu, Wang, Han and He2012). The analysis was done in Rstudio, the code was available in the following repository: https://github.com/Mxy0820/Transcriptome-expression-matrix-mapping.
RNA isolation and quantitative real-time PCR (qPCR)
All the insects were collected from the south campus of Guizhou University, Huaxi District, Guiyang City, Guizhou Province, China (26°25′39.62″N, 106°40′5.81″E).
Trizol method was used to extract the total RNA from the male and female of the A. chinensis (BBI, B900044-1000). The quantity and quality of RNAs were evaluated by 1.5% agarose gel electrophoresis and by a NanoDrop2000 Spectrophotometer (Thermo Scientific, USA). Approximately 2 μg RNA was reverse-transcribed using Thermo Scientific RevertAid MM (Thermo Scientific, M1631). qPCRs were conducted on the CFX96™ Real-Time system with SYBR green detection (Thermo Scientific). The gene-specific primers designed in Primer-BLAST were listed in table S2 (Ye et al., Reference Ye, Coulouris, Zaretskaya, Cutcutache, Rozen and Madden2012), and each gene was run in triplicate from three biological replicates. Aspongopus chinensis β-actin (forward primer 5′-3′: AACCGTCTACAACTCCATC; reverse primer 5′-3′: AGCGATGATCTTGATCTTGA) was used as endogenous control gene to normalise all data (Wu et al., Reference Wu, Tian, Tan, Zhao, Zhou, Luo and Guo2021; Zhou et al., Reference Zhou, Wu, Yin, Guo and Li2022).
The relative expression levels of qPCR results were assessed using the comparative cycle threshold (Ct) method (2−△△CT) and analysed in Excel 2016. In Rstudio, normality and homogeneity of variance tests were performed on the qPCR results. Following this, one-way ANOVA (Livak and Schmittgen, Reference Livak and Schmittgen2001) was applied to data derived from three distinct complementary DNA (cDNA) sets, each was obtained from three independent biological samples.
Results
Genome-wide identification of Hsp gene superfamily in A. chinensis and genomic location
Following tBlastN searches, a set of 25 non-redundant genes was successfully identified from the A. chinensis genome (table S4). Detailed information regarding the gene count in A. chinensis and three other reference species can be found in table 1. The AcHsps were subjected to classification based on the NCBI CDD analysis, resulting in the categorisation into distinct groups: Hsp90, Hsp70, Hsp60 and sHsp, with the numbers of 2, 14, 4 and 5, respectively. These AcHsps were located in chromosome 1, 2, 3, 4, 5, 7 and 10. Subfamilies numbering (90, 70 and 60) was followed by individual gene numbering. Notably, Hsp90A and Hsp90B were identified as different HSP protein subcellular locations, with Hsp90A being located in the cytoplasmic and nuclear regions, while Hsp90B was found exclusively in the nuclear compartment. Furthermore, Hsc70 was determined to represent the constitutive 70 kDa hsp, whereas Hsp70 was designated as the inducible type. Additionally, the nomenclature for small Hsps entailed the prefix ‘sHsp’, followed by their respective molecular weight.
Hsp genes identified in five sequenced insect genomes
As per the data presented in table 1, A. chinensis exhibited a relative expansion of Hsps, with 25 members. Among these, Hsp70 emerged as the most abundant. Detailed characteristics of AcHsps can be found in table 2. The length of AcHsps amino acids ranges from 123 (AcHsc70-2) to 739 (AcHsp90A), and their molecular weight largely corresponds to the respective gene family to which they belong. While a majority of Hsp proteins are predicted to localise in the cytoplasmic region, a subset of members demonstrated distinct organelle positioning, including the endoplasmic reticulum and mitochondria, among others. And chromosome positions of the AcHsps were shown in Figure 1.
Information on Hsp gene superfamily in A. chinensis
Chromosome position of the AcHsps. Grey bars represent the chromosomes with the scales of chromosome length (Mb) on the left. The AcHsps were named according to their position on the chromosomes.
Phylogenetic relationship analysis of all Hsps
To assess the phylogenetic associations among Hsps in A. chinensis and three other insect species, a comprehensive analysis was undertaken. This involved clustering and rootless tree construction based on all Hsps from the four insects. Figure 2 illustrates the categorisation of AcHsps into four distinct families, namely Hsp90, Hsp70, Hsp60 and Hsp10, which aligns closely with the outcomes of the NCBI CDD classification. In parallel, the Mrbayes method implemented in PhyloSuite was employed for phylogenetic tree reconstruction. Notably, the results obtained through this approach strongly corroborated with the findings from the ML method for tree establishment, thereby affirming the credibility of our study outcomes (figs S1 and S2).
Phylogenetic relationships analysis of heat shock proteins from A. chinensis, N. lugens, D. ananassae and B. tabaci. The left was the tree of Hsps without sHsp, the right was the tree of sHsp. The different coloured ranges and clades indicate different subfamilies, different coloured circles represent different insects.
Characteristics of AcHsps
In pursuit of a comprehensive comprehension of the interrelated evolutionary connections within the AcHsp superfamily, we conducted predictive and comparative investigations of their gene structures, drawing upon the methodology of phylogenetic analysis. The outcomes, depicted in fig. 3a, unveil a stratification of AcHsps into four distinct clusters. Remarkably, the observation presented in fig. 3d highlights the presence of introns in all AcHsp70 family members, with the sole exceptions of Achsp70-1, Achsp70-3, Achsp70-4, Achsp70-8 and Achsp70-11. Intriguingly, the Hsc70 gene showcases varying intron counts, ranging from 4 (AcHsc70-1) to 12 (AcHsc70-2). Furthermore, the genetic structure of AcHsp60 exhibited marked disparities, whereas the genetic architecture of the AcsHsp and AcHsp90 families exhibited a notable degree of conservation.
Phylogenetic relationships, protein motif analysis, conserved domains and gene structures analysis of the A. chinensis Hsp (AcHsp) gene superfamily. (a) The phylogenetic tree of AcHsps. The coloured ranges marked the different AcHsp subfamilies. (b) Each motif represented by a coloured box with numbers. The numbers shown on each gene corresponds to the motif numbers. Lengths of motifs for AcHsps are shown proportionally. (c) The conserved domains of AcHsps. Different coloured boxes represent different domains. Lengths of motifs for AcHsps are shown proportionally. (d) CDS/intron structures of AcHsps The green boxes, grey lines and yellow boxes, respectively, represent the cds, intron and untranslated regions. Lengths of motifs for AcHsps are shown proportionally.
To explore the structural diversity of AcHsp superfamilies, we performed a conservative motif analysis. We searched for 20 hypothetical motifs in each family, as shown in fig. 3b. In general, the base motif is highly conservative among closely related AcHsp members. In addition, some HSP proteins from sister clades even share a common motif composition. This phenomenon is related to gene structure and phylogenetic relationships. The conserved domains of AcHsps showed the same results (fig. 3c).
Transcriptome analysis of diapause and non-diapause stage in A. chinensis
To investigate the transcriptional expression patterns of A. chinensis at diapause and non-diapause, we collected six samples from the two stages of A. chinensis. Transcriptome sequencing of the cDNA library was performed on Illumina Hiseq X Ten. A total of 341,291,064 original reads and 27.2 Gb of data were obtained for all samples (Supplementary table S1).
After quality control of the transcriptome, 336,097,538 (98.48%) clean reads were obtained. We then mapped the clean reads to the reference genome and the results showed that the mapping rate was 55.59–82.19% (Supplementary table S1). We found that 485 transcripts were expressed, next, DEseq2 was used to standardise the raw expression matrix and then perform the differential transcripts analysis between groups. By differential expression analysis, 149 genes had significant differences. Among 149 differentially expressed genes, 65 genes were down-regulated and 84 genes were up-regulated (Supplementary fig. S3 and table S5).
We further performed GO enrichment analysis of DEGs. The top 20 biological processes, 10 cellular components and 10 molecular functions were shown separately (fig. 4). The results showed that there were four biological processes related to diapause, namely lipid homeostasis, lipid catabolic process, positive regulation of lipid transport and response to hormones. AcHsp70-5 was in the biological processes of response to hormone (fig. 6a). And the different expression of the related genes of the four progresses was shown in the heatmap (fig. 6b).
Enrichment of differentially expressed genes in biological pathways, cellular component and molecular function.
Gene expression of AcHsps at diapause stage and non-diapause stage
qPCR was performed to examine the expression patterns of A. chinensis, the primers of the 25 genes are listed in table S2 (Supplementary). As shown in fig. 5, there were significant differences in the expression of 14 genes, of which nine genes were up-regulated and four genes were down-regulated during diapause. The expressions of AcHsp70-1, 3, 4, 8, 11, AcHsp60-1, 4 and AcHsp19.4 were up-regulated during diapause, while the expressions of AcHsp90A, AcHsp70-5, 6, AcHsc70-1, 2 and AcHsp20.8 were down-regulated during diapause (fig. 5).
Quantitative real-time polymerase chain reaction (qPCR) analysis of expression profiles of AcHsps in diapause and non-diapause of A. chinensis.
Out of the 25 AcHsps analysed, three were identified in the transcriptome results: AcHsp70-5, AcHsp70-8 and AcHsc70-3. Notably, only AcHsp70-5 exhibited differential expression, distinguishing it from the other two genes. The expression pattern of AcHsp70-5 in the transcriptome aligns with the findings from qPCR analysis (fig. 6a), ensuring consistency in the observed results. Transcriptome analysis results showed significant differences in the expression of AcHsp70-5 in diapause, compared with non-diapause period, with padj value of 0.039 and log2FoldChange value of −1.09, which was the same as that of qPCR analysis. Through the analysis of the biological pathway of AcHsp70-5, which was enriched in the pathway of response to hormone (fig. 6b).
(a) Venn of transcripts, DEGs and AcHsps. (b) Biological pathway of AcHsp70-5 enrichment in transcriptome analysis.
Discussion
Expanded Hsp gene superfamily in A. chinensis
Using comprehensive bioinformatic methods, this study identified 25 Hsp genes encoding four distinct types of insect Hsps in the A. chinensis genome (AcHsps). Comparative analysis with previous studies on N. lugens and D. ananassae (Mei et al., Reference Mei, Jing, Tang, Chen, Chen, Duanmu, Cong, Chen, Ye, Zhou, He and Li2022) revealed an expansion of the Hsp gene superfamily in A. chinensis. Interestingly, the size of the Hsp gene superfamily was found to be species-specific and not directly proportional to genome size, as exemplified by the presence of only 18 Hsps in the larger genome of N. lugens among the four surveyed insects (Wang et al., Reference Wang, Wang, Ban, Zhu, Liu and Wang2019). This discrepancy could be attributed to gene loss events in Athalia rosae and N. lugens, while gene duplication occurred in A. chinensis. Notably, our results indicated that the Hsp70 clade constituted the largest group among the four types of insect Hsps, consistent with previous observations highlighting the prominent and abundant nature of the Hsp70 family (Csermely et al., Reference Csermely, Schnaider, Soti, Prohaszka and Nardai1998). Intriguingly, the absence of the Hsp10 family in the A. chinensis genome may be attributed to gene loss events that transpired during the course of evolution across different species. Hsp10, known for its crucial role in regulating mitochondrial function and structure (Gupta, Reference Gupta1995; Lau et al., Reference Lau, Patnaik, Sayen and Mestril1997), functions as a co-factor of Hsp60 in facilitating the folding of newly synthesised proteins imported into mitochondria (Frydman, Reference Frydman2001; Hartl and Hayer-Hartl, Reference Hartl and Hayer-Hartl2009; Hartl et al., Reference Hartl, Bracher and Hayer-Hartl2011). Hence, it can be speculated that A. chinensis relies on other chaperone proteins to maintain mitochondrial structure and function. Furthermore, phylogenetic tree analysis demonstrated distinct clustering of heat shock homologues between different species, suggesting repeated events within the heat shock superfamily following insect radiation (Wang et al., Reference Wang, Wang, Ban, Zhu, Liu and Wang2019).
Conserved sequence features of Hsp superfamily members in A. chinensis
To elucidate the expansion and divergence of the Hsp gene superfamily within the A. chinensis genome, we conducted a comparative analysis of gene structures and motif compositions among the members of the AcHsp superfamily. Our findings revealed a substantial degree of structural similarity among Hsps belonging to the same family. Specifically, with regard to coding sequence (cds)/intron structural characteristics, it was observed that 12 out of 14 Hsp70 genes lacked introns, while the remaining genes exhibited varying numbers of introns. The phylogenetic tree constructed for the AcHsps superfamily indicated that the AcHsp70 family underwent the earliest expansion within the evolutionary lineage, thereby potentially accounting for its structurally more complex nature, owing to a longer evolutionary history. It is worth noting that intronless genes are typically found in prokaryotic genomes (Huang et al., Reference Huang, Xian, Kang, Tang and Li2015). In the context of eukaryotic genomes, three pivotal mechanisms have been proposed to explain the emergence of intronless genes. Firstly, it is plausible that certain genes were horizontally transferred from ancient prokaryotes to eukaryotes. Subsequently, duplication events may have occurred in pre-existing intronless genes. Lastly, intron-containing genes could have undergone retroposition (Zou et al., Reference Zou, Guo and He2011). Research has shown that the similarities among Hsp70 family members are greater from different organisms than that from the same species in some cases (Lindquist and Craig, Reference Lindquist and Craig1988). Such phenomena indicated early gene duplication events and maintenance of this multigene family have occurred over evolutionary history.
Special AcHsps are important in the diapause of A. chinensis
Hsps are highly prevalent in eukaryotic cells and play a critical role in the survival and adaptation of insects to extreme thermal and cryogenic stresses, as evidenced by previous studies (Sorensen et al., Reference Sorensen, Giribets, Tarrio, Rodriguez-Trelles, Schou and Loeschcke2019). The up-regulation or down-regulation of HSP genes during diapause is crucial for insect survival in harsh environments (Rinehart et al., Reference Rinehart, Hayward, Elnitsky, Sandro, Lee and Denlinger2006; Rinehart et al., Reference Rinehart, Li, Yocum, Robich, Hayward and Denlinger2007; King and MacRae, Reference King and MacRae2015b).
A special gene in AcHsps was identified by combined transcriptome and qPCR analysis. AcHsp70-5 was found to be significantly down-regulated during the diapause period when compared to the non-diapause period. The result highlights the intricate and dynamic regulation of Hsps during diapause, indicating the involvement of distinct Hsps in various diapause-related processes, even within the same species (Zhang et al., Reference Zhang, Miano, Jiang, Peng, Zhang and Xiao2022). For instance, the upregulation of an embryo-specific form of AlHsp70 during diapause stage II in Austrofundulus limnaeus (Podrabsky et al., Reference Podrabsky, Lopez, Fan, Higashi and Somero2007), as well as the differential roles played by Hsp70 and Hsp90 in heat and cold tolerance, respectively, in diapause larvae of Sitodiplosis mosellana (Cheng et al., Reference Cheng, Li, Wang, Liu and Zhu-Salzman2016). Similarly, in P. melete, cryogenic chilling and thermal stress were found to induce significant upregulation of PmHsp90 in short-day and long-day pupae, while PmHsp90 expression remained relatively stable in non-diapause pupae (Wu et al., Reference Wu, Zou, Fu, Zhang and Xiao2018).
Furthermore, through a comprehensive GO enrichment analysis, we identified a significant enrichment of AcHsp70-5 in biological process associated with response to hormone. It was well-established that in insects, the induction of sexual communication mediated by pheromones after periods of reproductive inactivity is regulated by a complex interplay of exogenous factors, such as temperature and photoperiod, and endogenous regulatory factors, including hormones (Goehring and Oberhauser, Reference Goehring and Oberhauser2002; Anton et al., Reference Anton, Dufour and Gadenne2007). For instance, juvenile hormone (JH), a sesquiterpenoid hormone, exerts regulatory control over insect growth and development across all life stages (Ramaswamy et al., Reference Ramaswamy, Shu, Park and Zeng1997). Studies on Drosophila have reported the expression of sHsp genes in cultured cells in response to the moulting hormone, ecdysterone (Berger et al., Reference Berger, Goudie, Klieger, Berger and DeCato1992). Furthermore, previous research has demonstrated that Hsps are integral components of the steroid receptor complex and are released into the cell cytosol upon hormone binding, as observed in rat luteal cells (Tumlin et al., Reference Tumlin, Lea, Swanson, Smith, Edge and Someren1997). Considering these findings, we hypothesised that the modulation of AcHsp70-5 response to hormone may facilitate adaptation to the extreme environmental conditions experienced during diapause, which is possible to break the diapause of A. chinensis and carry out artificial breeding. The outcomes of this study served as a foundation for future investigations into AcHsp70-5, including the examination of mating dynamics before and after RNA interference. Additionally, exploring the role of hormones associated with the diapause, such as ecdysone and JHs, along with analysing differences in content, provides a groundwork for a more in-depth understanding of the functional aspects of AcHsp70-5.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0007485324000075.
Acknowledgements
This research was funded by the Guizhou Provincial Science and Technology Projects (Qiankehe Pingtai Rencai-GCC [2022]029-1).
Author contributions
Jianjun Guo and Haiyin Li: supervision, funding acquisition, project administration, conceptualisation, methodology and investigation. Xinyi Ma and Zhiyong Yin: original manuscript writing. Xinyi Ma and Zhiyong Yin: formal data analysis and software. Jianjun Guo: review and editing. All authors read and approved the final manuscript.
Competing interests
None.
