Introduction
Temperate fruit orchards worldwide suffer substantial economic losses due to infestation by several lepidopteran pests, among which Cydia pomonella (codling moth) (Lepidoptera: Tortricidae), Grapholita funebrana (plum fruit moth) (Lepidoptera: Tortricidae), Euzophera bigella (quince moth) (Lepidoptera: Pyralidae), and Ectomyelois ceratoniae (locust bean moth) (Lepidoptera: Pyralidae) are the most destructive (Alford, Reference Alford2007). C. pomonella is a key pest of apples, pears, and walnuts, directly damaging fruits and reducing market quality, while G. funebrana primarily attacks Prunus spp., causing fruit damage and premature drop (Welter, Reference Welter, Resh and Cardé2009; Riolo et al., Reference Riolo, Bruni, Cappella, Rama and Isidoro2010; Brown, Reference Brown2022). Eu. bigella larvae feed internally on various fruits and on bark, whereas Ec. ceratoniae threatens pomegranate, carob, and other crops, limiting both yield and export potential (Simoglou et al., Reference Simoglou, Karataraki, Roditakis and Roditakis2012; Alford, Reference Alford2014). Collectively, these species impose major constraints on sustainable production, storage, and trade, underscoring the need for reliable diagnostic tools to support integrated pest management (IPM).
Accurate identification of these pests, particularly at the larval stage, remains challenging due to their morphological similarity and overlapping size, coloration, and feeding habits (Timm, Reference Timm2005; Timm et al., Reference Timm, Warnich and Geertsema2007, Reference Timm, Tembrock, Zink and Mollet2025; Chen and Dorn, Reference Chen and Dorn2009; Madden et al., Reference Madden, Young, Brown, Miller, Frewin and Hanner2019; Nam et al., Reference Nam, Kim, Lee, Heckel and Kim2021; Yokomi et al., Reference Yokomi, Delgado, Unruh, Barcenas, Garczynski, Walse, Pérez de León and Cooper2021). Even mature larvae require expert taxonomic knowledge and often dissection of minute structures for reliable identification. In mixed-fruit orchards, misidentification can lead to underestimated pest pressure and ineffective management.
Molecular techniques, especially DNA barcoding of the mitochondrial COI gene, have become widely used for distinguishing closely related moth species (Folmer et al., Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994; Simon et al., Reference Simon, Frati, Beckenbach, Crespi, Liu and Flook1994; Hebert et al., Reference Hebert, Cywinska, Ball and deWaard2003; Hebert and Gregory, Reference Hebert and Gregory2005; Liu et al., Reference Liu, Yang, Han, Ward and Zhang2014; Jin et al., Reference Jin, Hu, Han, Chen, Cai, Ruan, Liu, Luo, Wang, Liu, Ward, Wu, Wilson and Zhang2018). However, sequencing-based approaches are costly and impractical for routine monitoring. PCR-based methods with species-specific primers provide a rapid, sensitive alternative, and multiplex PCR allows simultaneous detection of multiple species in a single reaction, reducing time, cost, and labour (Sint et al., Reference Sint, Niederklapfer, Kaufmann and Traugott2014; Andrews et al., Reference Andrews, Bester, Manrakhan and Maree2022; Pava-Ripoll et al., Reference Pava-ripoll, Miller and Ziobro2023).
Molecular diagnostics have been widely applied to fruit moth pests worldwide, particularly in Europe, Asia, and North America, using DNA barcoding, species-specific PCR, and multiplex PCR to distinguish morphologically similar tortricids such as Cydia and Grapholita (Barcenas et al., Reference Barcenas, Unruh and Neven2005; Chen and Dorn, Reference Chen and Dorn2009; Hada and Sekine, Reference Hada and Sekine2011; Kwon et al., Reference Kwon, Kwon, Kim and Yang2018; Vulchi et al., Reference Vulchi, Daane and Wenger2021; Yokomi et al., Reference Yokomi, Delgado, Unruh, Barcenas, Garczynski, Walse, Pérez de León and Cooper2021; Timm et al., Reference Timm, Tembrock, Zink and Mollet2025). Despite the economic significance of C. pomonella, G. funebrana, Eu. bigella, and Ec. ceratoniae, molecular diagnostics for these pests remain largely unexplored in pome and stone fruit orchards of Iran (Mozaffarian et al., Reference Mozaffarian, Sarafrazi and Ganbalani2007; Nouri-Ganbalani et al., Reference Nouri-ganbalani, Sarafrazi and Mozaffarian2007; Mozaffarian et al., Reference Mozaffarian, Mardi, Sarafrazi and Nouri Ganbalani2008; Alipanah, Reference Alipanah2019; Rajaei et al., Reference Rajaei, Aarvik, Arnscheid, Baldizzone, Bartsch, Bengtsson, Bidzilya, Buchner, Buchsbaum, Buszko, Dubatolov, Erlacher, Esfandiari, de Freina, Gaedike, Gyulai, Hausmann, Haxaire, Hobern, Hofmann, Ignatev, Kaila, Kallies, Keil, Kiss, Kitching, Kun, László, Leraut, Mally, Matov, Meineke, Melichar, Mey, Mironov, Müller, Naderi, Nässig, Naumann, Nazari, Van Nieukerken, Nuss, Pöll, Prozorov, Rabieh, Rákosy, Rindoš, Rota, Rougerie, Schintlmeister, Shirvani, Sihvonen, Simonsen, Yu, Sinev, Sobczyk, Sohn, Tabell, Tarmann, Tokár, Trusch, Varga, Volynkin, Wanke, Yakovlev, Zahiri, Zehzad, Zeller, Zolotuhin and Karsholt2023; Latifian et al., Reference Latifian, Pirkhezri and Ghaemi2023).
Accurate identification is further complicated by morphological similarity, particularly between C. pomonella and G. funebrana or Ec. ceratoniae and Eu. bigella, which often co-occur in apple, quince, plum, and pomegranate orchards (Naserian et al., Reference Naserian, Farazmand, Vafaei, Avand and Azadbakht2013; Kermani et al., Reference Kermani, Farazmand, Karimzadeh and Avand2014). In Iran, no standardised molecular assay exists for routine differentiation, and traditional keys are often inadequate for larvae or damaged specimens. Conventional identification relies on genitalia dissection, a time-consuming approach unsuitable for regular monitoring (Pazuki, Reference Pazuki1976). In addition, inaccurate identification of co-occurring fruit-feeding moth species may complicate biological control programs by obscuring host–parasitoid relationships and reducing the efficiency of parasitoid-based management strategies (Besharatnejad et al., Reference Besharatnejad, Karimzadeh Esfahani, Ebrahimi, Yousefi, Jafari Nodoushan, Attaran and Rostagari2015; Gavara et al., Reference Gavara, Cabello, Gámez, Bastin, Hernández-suárez and Piedra-buena2023).
To address these challenges, we developed two species-specific multiplex PCR assays: one targeting COII to differentiate C. pomonella from G. funebrana, and another targeting COI for Ec. ceratoniae versus Eu. bigella. Both assays allow rapid, same-day identification from mixed or challenging samples, including immature and adult specimens from traps and infested fruits, supporting timely pest diagnosis and informed IPM decision-making. To our knowledge, these multiplex PCR assays represent the first validated molecular diagnostic tools for the simultaneous identification of these four economically important orchard pests in Iran. The assays are applicable to immature and adult specimens and supported by newly generated COI and COII reference sequences validated against GenBank records, offering practical solutions for researchers, extension personnel, and orchard managers.
Materials and methods
Sample collection and study area
Larval and adult specimens of four major lepidopteran orchard pests – Cydia pomonella, Grapholita funebrana, Ectomyelois ceratoniae, and Euzophera bigella – were collected from multiple orchards across Lorestan province, Iran (table 1). Sample sizes were 15, 16, 10, and 8 individuals, respectively. All available specimens were included in molecular analyses. Host plants included apple, quince, pomegranate, and plum/peach depending on species and location. Larvae of C. pomonella, Ec. ceratoniae, and Eu. bigella were reared to adulthood for morphological identification. For G. funebrana, larval specimens were not available during the sampling period; therefore, adults were collected using species-specific delta pheromone traps deployed in stone-fruit orchards. Specimens were preserved in 96% ethanol and stored at −20 °C until DNA extraction. Dissection tools were sterilised between samples to avoid cross-contamination.
Collection sites, sample stages, host plants, and GPS coordinates of four lepidopteran orchard pests in Lorestan province, Iran
Table 1 Long description
Columns are Species, Sample Stage, Collection Site or Orchard, County, Host Plant, and Latitude or Longitude. Row 1 lists Cydia pomonella, larva, Sarab-e Suri village, Khorramabad, apple, 33 degrees 25 minutes 45.0 seconds north and 48 degrees 32 minutes 57.0 seconds east. Row 2 lists Cydia pomonella, larva reared, Kakareza orchards, Khorramabad, apple, 33 degrees 43 minutes 30.0 seconds north and 48 degrees 15 minutes 44.0 seconds east. Row 3 lists Grapholita funebrana, adult, Khayan village, Borujerd, peach and plum, 33 degrees 46 minutes 27.0 seconds north and 48 degrees 54 minutes 02.0 seconds east. Row 4 lists Ectomyelois ceratoniae, larva, Zirtang-e Siab, Kuhdasht, pomegranate, 33 degrees 23 minutes 51.0 seconds north and 47 degrees 11 minutes 56.4 seconds east. Row 5 lists Euzophera bigella, larva, Khorramabad city markets, Khorramabad, quince, 33 degrees 29 minutes 15.0 seconds north and 48 degrees 21 minutes 22.0 seconds east.
DNA extraction
Genomic DNA was extracted from larval head capsules and, when adult specimens were available, from thoracic muscle tissue, using a standard CTAB protocol. DNA concentration and quality were assessed using NanoDrop spectrophotometry and 1% agarose gel electrophoresis. Only samples with A260/A280 ratios between 1.8 and 2.0 were used for downstream applications.
Gene selection, sequence dataset, alignment, and primer design
Species-specific primers were designed targeting mitochondrial cytochrome oxidase genes. COI was initially evaluated as a standard DNA barcode region; however, sequence analysis revealed insufficient interspecific variation to support reliable primer design for one of the target species pairs. Therefore, COII was selected for the C. pomonella–G. funebrana assay due to higher diagnostic polymorphism, while COI was retained for Ec. ceratoniae and Eu. bigella.
The initial objective was to develop a single four-species multiplex PCR; however, preliminary optimisation revealed primer incompatibility, overlapping annealing temperatures, and reduced amplification efficiency in combined reactions. Consequently, two independent multiplex PCR assays were developed for reliable species differentiation.
Reference sequences were retrieved from NCBI GenBank, including 44 sequences of C. pomonella, 60 of G. funebrana, 51 of Ec. ceratoniae, and 22 of Eu. bigella, representing multiple geographic regions.
Sequences were curated by removing duplicates, low-quality reads, ambiguous bases, and frameshift mutations, retaining only high-quality gene-specific regions corresponding to the target amplicons.
Multiple sequence alignments were performed using SeaView v5.0.4 (Gouy et al., Reference Gouy, Guindon and Gascuel2010) and manually inspected in GeneDoc v2.7 (Nicholas et al., Reference Nicholas, Nicholas and Deerfield1997) to identify conserved primer-binding sites and species-specific polymorphisms.
Primer pairs were designed using PrimerQuest (IDT) with optimisation of primer length, GC content (40–60%), and melting temperature (55–60 °C). Primer specificity was evaluated in silico using Primer-BLAST against closely related Tortricidae and Pyralidae species. Because suitable non-target specimens were unavailable, experimental cross-reactivity testing was restricted to the four target species. For each multiplex assay, species-specific forward primers were combined with a shared reverse primer to facilitate simultaneous species discrimination.
Final primers were synthesised by Metabion International AG (Germany) through Pishgam Biotech Co. (Iran) and stored at −20 °C. Expected amplicon sizes were 385, 577, 401, and 473 bp for C. pomonella, G. funebrana, Ec. ceratoniae, and Eu. bigella, respectively (table 2).
Primers used in multiplex PCR assays
Table 2 Long description
Columns give primer name, sequence from 5 prime to 3 prime, length in base pairs, annealing temperature in degrees C, GC content percent, target species, and PCR product size in base pairs. Cp F has sequence CTTATTAGATGAATTAAATAACCCC, length 25, annealing temperature 47.7, GC content 28, targets C. pomonella, and PCR product size 385. Gf F has sequence CTTTTTTCACGACCATACTTTAG, length 23, annealing temperature 49.9, GC content 34.8, targets G. funebrana, and PCR product size 577. CG R with an asterisk has sequence ACTTTCAATTACAATK then G slash T then GGTA, length 20, annealing temperature 45.6, GC content 27.5, targets C. pomonella and G. funebrana, and PCR product size is shown as a dash. Ec F has sequence CGGTAATTGATTAGTTCCT, length 19, annealing temperature 46.5, GC content 36.8, targets Ec. ceratoniae, and PCR product size 401. Eu F has sequence CAATACTATTGTCACAGGC, length 19, annealing temperature 48.1, GC content 42.1, targets Eu. bigella, and PCR product size 473. EE R with an asterisk has sequence CTGTTAATAATATAGTAATAGCTCC, length 25, annealing temperature 46.7, GC content 28, targets Ec. ceratoniae and Eu. bigella, and PCR product size is shown as a dash.
a Shared reverse primer.
PCR amplification and multiplex optimisation
Initial validation was performed using singleplex PCR to confirm primer specificity and expected product size. Each 25 μL reaction contained 12.5 μL 2 × PCR Master Mix, 0.5 μL of each primer (10 μM), 1 μL template DNA, and nuclease-free water.
Thermal cycling followed a touchdown protocol: initial denaturation at 94 °C for 3 min; 12 cycles with annealing decreasing from 60 to 50 °C; followed by 28 cycles at 50 °C annealing; and final extension at 72 °C for 5 min.
Following singleplex validation, two separate multiplex PCR systems were optimised by combining compatible primer sets for pairwise species detection.
All reactions included positive controls (previously sequenced DNA) and negative controls (no-template controls) and were performed in at least two technical replicates and multiple biological replicates.
Gel electrophoresis analysis
PCR products were separated on 1% agarose gels in 1× TAE buffer, stained with Safe-Red® and visualised under UV illumination. A 100 bp DNA ladder was used for fragment size estimation. Band sizes were compared with expected amplicon lengths to confirm species-specific amplification.
DNA sequencing and morphological confirmation
Specimens were first identified morphologically by rearing larvae to adults and examining external characters using standard Tortricidae and Pyralidae identification keys. Subsequently, DNA was extracted and molecular identification was performed through PCR amplification and sequencing.
For sequence validation, PCR products were amplified specifically for sequencing purposes. For Ec. ceratoniae and Eu. bigella, COI fragments were amplified using the primer set of Simon et al. (Reference Simon, Frati, Beckenbach, Crespi, Liu and Flook1994). The widely used Folmer et al. (Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994) barcode primers were also tested but showed inconsistent amplification and sequencing success in the target taxa; therefore, Simon et al. primers were adopted.
For C. pomonella and G. funebrana, COII fragments were amplified using the same species-specific primers developed for the multiplex assays. Sequencing was performed at Farhud Genetic Clinic (Tehran, Iran). Newly generated sequences were deposited in GenBank under accession numbers MN900745, MN900746, MN900747, MN900748, MW874645, PV974548, PV974549. Chromatograms were analysed using FinchTV, and sequences were compared with GenBank using BLASTn, yielding >99% sequence identity with reference records.
Morphological and molecular identifications were fully congruent across all examined specimens, and sequencing results were subsequently used to validate multiplex assay performance.
Gene tree reconstruction for sequence validation
To provide taxonomic context for the sequenced specimens and to support primer design, Neighbor-Joining (NJ) gene trees were reconstructed separately for the Cydia–Grapholita and Ectomyelois–Euzophera datasets using MEGA12 (Kumar et al., Reference Kumar, Stecher, Suleski, Sanderford, Sharma and Tamura2024). The aligned datasets comprised 324 bp (112 sequences) and 351 bp (124 sequences), respectively. Choristoneura conflictana and Spodoptera frugiperda were used as outgroups for the Cydia–Grapholita dataset, whereas Ephestia kuehniella and Plodia interpunctella served as outgroups for the Ectomyelois–Euzophera dataset. Bootstrap support was estimated from 1000 replicates. The resulting gene trees were used only to confirm sequence identity and the genetic distinctiveness of the target taxa and were not intended as comprehensive phylogenetic analyses or species delimitation.
Results
Sample collection and identification
Larvae and adults of four orchard pest species (C. pomonella, G. funebrana, Ec. ceratoniae, and Eu. bigella) were successfully collected from various orchards in Lorestan province, Iran. A total of 49 specimens were examined, including 15 C. pomonella, 16 G. funebrana, 10 Ec. ceratoniae, and 8 Eu. bigella individuals. All specimens were subjected to molecular analyses and multiplex PCR validation.
Species identity was confirmed through a combination of morphological and molecular methods. For C. pomonella, larvae were reared to adulthood, and adults were morphologically identified. Morphological and molecular identifications were fully congruent. G. funebrana was successfully identified from adults captured in pheromone-baited sticky traps, with large numbers of individuals observed on the traps. Ec. ceratoniae larvae were recovered from pomegranate fruits with typical signs of larval boring, while Eu. bigella larvae were found in quince fruits showing characteristic external symptoms of infestation.
Late-instar larvae were documented for C. pomonella, Ec. ceratoniae, and Eu. bigella, whereas G. funebrana was documented from adult specimens collected in pheromone traps. Representative photographs of infested host fruits, larvae, and adults used for species verification are presented in fig. 1.
Representative life stages and host fruit damage of the four target orchard pests. (A–C) Cydia pomonella: late-instar larva, adult reared from larval specimens, and infested apple fruit showing larval feeding damage. (D–F) Grapholita funebrana: adults captured on a pheromone-baited sticky trap, adult specimen, and plum fruit showing a characteristic larval entry hole. (G–I) Ectomyelois ceratoniae: late-instar larva, adult, and infested pomegranate fruit containing larvae. (J–L) Euzophera bigella: late-instar larva, adult, and infested quince fruit showing internal larval damage.
Multiplex PCR validation and sequencing confirmation
Prior to multiplex optimisation, each primer pair was evaluated independently in singleplex PCR reactions. Representative singleplex amplifications are shown in fig. 2A and E, where each primer set generated a single fragment of the expected size without detectable non-specific amplification. These preliminary results confirmed primer functionality and specificity before combining primer pairs in multiplex assays.
Validation and optimisation of singleplex and multiplex PCR assays for identification of four orchard pest species. Panels A and E show representative singleplex PCR reactions used for preliminary primer validation, including C1–C2 for C. Pomonella (385 bp), G1–G2 for G. Funebrana (577 bp), Ec1–Ec2 for Ec. Ceratoniae (401 bp), and Eu1–Eu2 for Eu. Bigella (473 bp). The remaining panels show multiplex PCR amplification of the two diagnostic species pairs across additional specimens. CN, GN, EcN, EuN, and Neg indicate negative controls. All PCR products were separated on 1% agarose gels, and a 100 bp DNA ladder was used for fragment size determination. Singleplex reactions produced a single amplicon of the expected size, and no diagnostic amplification was observed in negative controls.
The PCR products generated for each species exhibited distinct, non-overlapping band patterns, corresponding to the expected amplicon sizes of 385 bp for C. pomonella and 577 bp for G. funebrana (fig. 2B–D), and 401 bp for Ec. ceratoniae and 473 bp for Eu. bigella (fig. 2F and G). The bands were clearly separated with no cross-species amplification or non-specific bands, demonstrating high assay specificity. Specificity was evaluated across all available target specimens included in the study (15 C. pomonella, 16 G. funebrana, 10 Ec. ceratoniae, and 8 Eu. bigella).
In the initial multiplex reactions for the Ec. ceratoniae–Eu. bigella pair (fig. 2F), minor non-target bands were observed in some Euzophera samples, including faint secondary bands below or above the expected 473 bp fragment. These additional bands were weak and did not interfere with species identification. Subsequent optimisation of reaction conditions, including adjustment of annealing parameters and increased template DNA concentration, eliminated these non-specific amplifications, resulting in clean and specific banding patterns (fig. 2G). This optimisation confirmed the robustness and reproducibility of the multiplex assay under refined conditions.
Sequence validation
To confirm species identity and evaluate the suitability of the selected diagnostic regions for multiplex PCR development, representative amplicons from each target species were sequenced and compared with publicly available reference sequences. Sequencing results showed >99% similarity to the corresponding GenBank references, further confirming the molecular identity of the species. To assess primer robustness across geographic populations, additional COI and COII sequences from GenBank and BOLD were aligned and examined for variation within primer-binding regions. Primer-binding sites were highly conserved within each target species, with no critical mismatches observed at the 3′ ends of primers. In contrast, multiple mismatches were detected in closely related non-target taxa, supporting primer specificity. Representative sequences generated in this study (GenBank accession numbers MN900745, MN900746, MN900747, MN900748, MW874645, PV974548, PV974549) were fully consistent with their corresponding GenBank reference sequences (>99% identity). Additionally, morphological verification of larvae and adults, including specimens reared from infested host fruits, was fully congruent with molecular results.
Gene tree supporting primer design
NJ gene trees consistently grouped sequences according to species identity (fig. 3). Comparative analyses of publicly available COI and COII sequences demonstrated clear interspecific separation and low intraspecific variation (table 3), further supporting the selection of diagnostic regions for primer design.
Neighbor-Joining (NJ) gene trees reconstructed from mitochondrial COII sequences for the Cydia pomonella–Grapholita funebrana dataset (A) and mitochondrial COI sequences for the Ectomyelois ceratoniae–Euzophera bigella dataset (B). Additional closely related taxa were included to provide taxonomic context. Choristoneura conflictana (CC) and Spodoptera frugiperda (SF) were used as outgroups for the Cydia–Grapholita dataset, whereas Ephestia kuehniella (EK) and Plodia interpunctella (PI) served as outgroups for the Ectomyelois–Euzophera dataset. Newly generated sequences from this study (GenBank accession numbers MN900745–MN900748, MW874645, and PV974548–PV974549) clustered with their corresponding reference sequences, confirming species identity and supporting the selection of diagnostic regions for primer design. Bootstrap values (>50%) are shown at the major nodes.
Figure 3 Long description
Two circular Neighbor-Joining gene trees labeled A and B, each depicting relationships among moth species using mitochondrial sequences. In tree A, the left half is shaded in a light color with ′Cydia pomonella′ prominently labeled, while the right half is shaded in a darker color with ′Grapholita funebrana′ labeled. Various branches connect different species, with labels such as ′Cydia pomonella NYMPH USA′ and ′Grapholita funebrana TYPH USA′ visible. Moth illustrations are placed near the tree. Tree B is similarly structured, with the left half shaded in a light color labeled ′Euzophera bigella′ and the right half in a darker color labeled ′Ectomyelois ceratoniae′. Labels such as ′Euzophera bigella MN900745′ and ′Ectomyelois ceratoniae MN900746′ are present. Both trees include bootstrap values at major nodes, indicating the confidence of the branching patterns. Moth illustrations are also present near tree B.
Pairwise K2P genetic distances (%) among selected Tortricidae and Pyralidae taxa used to support primer design and species differentiation
Table 3 Long description
Pairwise K2P genetic distance values are listed in percent for species pairs, grouped by comparison type as within genus or between genera. Within genus, C. pomonella versus C. fagiglandana is 8 percent, C. pomonella versus C. strobilella is 7 percent, and C. fagiglandana versus C. strobilella is 6 percent. Within genus, G. funebrana versus G. dimorpha is 9 percent. Within genus, Eu. bigella versus Eu. pinguis is 13 percent and Eu. pyriella versus Eu. pinguis is 11 percent. Within genus, Ec. ceratoniae versus Ec. muriscis is 13 percent. Between genera, G. funebrana versus C. pomonella is 12 percent and G. dimorpha versus C. pomonella is 11 percent. Between genera, G. funebrana versus C. strobilella is 12 percent and G. dimorpha versus C. strobilella is 10 percent. Between genera, Ec. ceratoniae versus Eu. bigella is 12 percent.
Discussion
In this study, we developed and validated two multiplex PCR assays for the rapid and reliable differentiation of four economically important lepidopteran orchard pests, namely C. pomonella, G. funebrana, Ec. ceratoniae, and Eu. bigella. The assays produced clear, non-overlapping amplicons without cross-amplification, enabling accurate species identification across developmental stages, including early larval instars that are often difficult to distinguish morphologically. Comparable multiplex PCR approaches have been reported for other lepidopteran and agricultural pests (Chen and Dorn, Reference Chen and Dorn2009; Sint et al., Reference Sint, Niederklapfer, Kaufmann and Traugott2014; Kwon et al., Reference Kwon, Kwon, Kim and Yang2018; Yokomi et al., Reference Yokomi, Delgado, Unruh, Barcenas, Garczynski, Walse, Pérez de León and Cooper2021), but to our knowledge this is the first study providing a multiplex diagnostic framework for the simultaneous identification of these four orchard pests. The simplicity, rapidity, and cost-effectiveness of the method make it particularly suitable for routine diagnostics, monitoring programs, and IPM applications.
Accurate identification of immature lepidopteran stages remains challenging because diagnostic morphological characters are often absent or poorly developed. This limitation is particularly relevant for quarantine inspections, pheromone-trap monitoring, and surveys involving damaged specimens or infested plant material. Under such conditions, molecular diagnostic tools provide a reliable alternative for routine species identification (Hebert et al., Reference Hebert, Penton, Burns, Janzen and Hallwachs2004; Mutanen et al., Reference Mutanen, Wahlberg and Kaila2010; Lopez-vaamonde et al., Reference Lopez-vaamonde, Kirichenko, Cama, Doorenweerd, Godfray, Guiguet, Gomboc, Huemer, Landry, Laštůvka, Laštůvka, Lee, Lees, Mutanen, Van Nieukerken, Segerer, Triberti, Wieser and Rougerie2021; Vulchi et al., Reference Vulchi, Daane and Wenger2021; Yokomi et al., Reference Yokomi, Delgado, Unruh, Barcenas, Garczynski, Walse, Pérez de León and Cooper2021). The multiplex assays developed here therefore address an important practical need by enabling rapid species differentiation independent of host association or adult morphology.
The reliability of the developed assays was supported by sequencing, morphological verification, and multiplex PCR validation. Sequenced amplicons showed >99% similarity to reference sequences in GenBank and BOLD reference sequences, and molecular identifications were fully congruent with morphological determinations. Together, these results support the accuracy and suitability of the assays for routine orchard pest identification.
Marker selection proved critical for successful assay development. Although COI is the standard DNA barcoding marker, suitable diagnostic variation was insufficient for reliable differentiation between Cydia and Grapholita species. Consequently, COII was selected for this species pair. In contrast, COI provided adequate diagnostic variation for distinguishing Ectomyelois and Euzophera. Sequencing of multiplex PCR products further confirmed the accuracy of species assignments, whereas the widely used Folmer et al. (Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994) barcode primers showed inconsistent amplification success for some COI samples, necessitating the use of alternative primers (Simon et al., Reference Simon, Frati, Beckenbach, Crespi, Liu and Flook1994). These findings emphasise that effective molecular diagnostics depend on selecting the most informative marker for each taxonomic group rather than relying exclusively on a single universal barcode region (Han et al., Reference Han, Lee, Lee, Kim, Lee and Park2014; Wahlberg et al., Reference Wahlberg, Peña, Ahola, Wheat and Rota2016).
NJ gene trees were reconstructed only to verify the placement of the sequenced specimens and to support primer design. The resulting topology was consistent with previous studies of Tortricidae and Pyralidae (Soils and Mitter, Reference Soils and Mitter1992; Regier et al., Reference Regier, Brown, Mitter, Baixeras, Cho, Cummings and Zwick2012), while pairwise genetic distances were comparable to published values for related Lepidoptera (Zheng et al., Reference Zheng, Wu, Dorn and Chen2017; Jeong et al., Reference Jeong, Kim, Kim, Choi and Kim2021). Because the objective of this study was assay development rather than phylogenetic inference, these results should be regarded solely as supporting evidence for primer validation.
From an applied perspective, the developed multiplex PCR assays provide a rapid and reliable tool for identifying orchard pests at early developmental stages, thereby supporting monitoring programs and timely management decisions (Sint et al., Reference Sint, Niederklapfer, Kaufmann and Traugott2014). Similar molecular diagnostic approaches have been widely adopted for agricultural pest surveillance and food-associated pest detection (Barcenas et al., Reference Barcenas, Unruh and Neven2005; Kwon et al., Reference Kwon, Kwon, Kim and Yang2018; Pava-ripoll et al., Reference Pava-ripoll, Miller and Ziobro2023). Because the assays can identify immature specimens that are often difficult to distinguish morphologically, they may also support quarantine inspections and biosecurity programs aimed at preventing the spread of economically important pests (Yokomi et al., Reference Yokomi, Delgado, Unruh, Barcenas, Garczynski, Walse, Pérez de León and Cooper2021; Timm et al., Reference Timm, Tembrock, Zink and Mollet2025).
Despite these strengths, several limitations should be acknowledged. First, the assays were developed as two independent multiplex reactions rather than a single four-species system. Preliminary evaluations indicated that combining all primer sets substantially increased optimisation complexity and reduced amplification consistency. We therefore prioritised robustness, reproducibility, and ease of interpretation over maximal multiplexing capacity. Future studies may explore the development of a single four-species assay using alternative primer architectures or real-time PCR platforms.
Second, experimental validation was restricted to specimens collected from a limited geographic range. Although analyses incorporating sequences from geographically diverse populations supported primer conservation, broader validation would strengthen confidence in the wider applicability of the assays. Experimental testing against additional closely related non-target species was also not possible because suitable specimens were unavailable. Nevertheless, Primer-BLAST analyses and comparative sequence alignments revealed multiple mismatches within primer-binding regions, particularly near their 3′ ends, in related Tortricidae and Pyralidae taxa, supporting the expected specificity of the assays.
A potential concern is the use of a single species-specific primer for each target species. However, primer design was based on extensive sequence alignments of newly generated and publicly available sequences, ensuring that primer-binding sites were located within highly conserved regions. Specificity was further supported by sequencing, BLAST confirmation (>99% similarity), clear separation of the target species in the NJ gene tree, and the absence of cross-amplification under optimised conditions. Similar multiplex strategies have proven effective for closely related insect taxa (Sint et al., Reference Sint, Niederklapfer, Kaufmann and Traugott2014; Kwon et al., Reference Kwon, Kwon, Kim and Yang2018). Future studies may expand this framework to include additional pest species and integrate real-time PCR or High-Resolution Melt (HRM) approaches to further improve diagnostic sensitivity and versatility (Kermani et al., Reference Kermani, Farazmand, Karimzadeh and Avand2014; Andrews et al., Reference Andrews, Bester, Manrakhan and Maree2022).
In conclusion, this study provides the first multiplex PCR framework for the identification of four major orchard pests in Iran. The developed assays combine accuracy, speed, and cost-effectiveness, offering a practical tool for diagnostics, pest surveillance, quarantine inspections, and IPM programs. More broadly, these assays provide a practical molecular diagnostic tool for routine identification of morphologically similar orchard pests and may facilitate future development of multiplex diagnostics for additional economically important Lepidoptera.
Acknowledgements
The authors are grateful to the staff of the Plant Protection Department, Lorestan University, for providing laboratory facilities and technical support. We sincerely thank our colleagues for their assistance with field sampling and laboratory experiments. We would also like to express our appreciation to Mr. Qaedrahmat for facilitating the collection of C. pomonella larvae from his apple orchard, to Mr. Ali Dehghan for assistance in sampling G. funebrana from plum orchards, and to the residents of Khayan village for their cooperation during fieldwork. Special thanks are extended to the Farhud Genetic Clinic (Tehran, Iran) for performing the Sanger sequencing analyses.
Financial support
This research was conducted as part of an M.Sc. thesis and was supported by Lorestan University.
