Introduction
Waterhemp [Amaranthus tuberculatus (Moq.) J. D. Sauer] is a small-seeded, summer annual weed indigenous to North America (Sauer Reference Sauer1957; Waselkov and Olsen Reference Waselkov and Olsen2014). Over the last 30 yr, A. tuberculatus has gone from virtual obscurity to being the most commonly encountered and troublesome weed in corn (Zea mays L.) and soybean [Glycine max (L.) Merr.] production fields in the midwestern United States, including Nebraska (Prince et al. Reference Prince, Shaw, Givens, Owen, Weller, Young, Wilson and Jordan2012; Sarangi and Jhala Reference Sarangi and Jhala2018). Amaranthus tuberculatus is a highly competitive weed; for example, Steckel and Sprague (Reference Steckel and Sprague2004) reported that season-long interference of A. tuberculatus at 270 plants m−2 can reduce corn yield by 74%. A study in Illinois reported that A. tuberculatus allowed to compete with soybean up to 10 wk after soybean unifoliate expansion at a density up to 362 plants m−2 reduced soybean yield by 43% (Hager et al. Reference Hager, Wax, Stoller and Bollero2002). Favorable biological attributes such as rapid growth rate, high net assimilation rate, prolific seed production, and smaller seed size have provided opportunities for A. tuberculatus to persist as the most successful and problematic weed in corn and soybean production systems in the midwestern United States (Costea et al. Reference Costea, Weaver and Tardif2005; Hartzler et al. Reference Hartzler, Battles and Nordby2004; Horak and Loughin Reference Horak and Loughin2000; Sellers et al. Reference Sellers, Smeda, Johnson, Kendig and Ellersieck2003). Additionally, the ability of A. tuberculatus to survive and produce seeds under abiotic stresses such as water stress is another important biological attribute for its survival (Sarangi et al. Reference Sarangi, Irmak, Lindquist, Knezevic and Jhala2016).
Amaranthus tuberculatus biotypes resistant to acetolactate synthase (ALS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), 4-hydroxyphenylpyruvate dioxygenase, and photosystem II (PSII) inhibitors and synthetic auxins have been confirmed in Nebraska (Anderson et al. Reference Anderson, Roeth and Martin1996; Bernards et al. Reference Bernards, Crespo, Kruger, Gaussoin and Tranel2012; Oliveira et al. Reference Oliveira, Jhala, Gaines, Irmak, Amundsen, Scott and Knezevic2017; Sarangi et al. Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015). Moreover, the dioecious nature of A. tuberculatus is believed to promote the rapid spread of herbicide-resistant traits through pollen-mediated gene flow and hasten the evolution of multiple herbicide–resistant biotypes (Sarangi et al. Reference Sarangi, Tyre, Patterson, Gaines, Irmak, Knezevic, Lindquist and Jhala2017b).
Protoporphyrinogen oxidase (PPO)-inhibiting herbicides were one of the key components of weed management in soybean before the commercialization of glyphosate-resistant crops; however, the widespread adoption of glyphosate-resistant crops in the United States substantially reduced the use of this chemistry (Dayan et al. Reference Dayan, Barker and Tranel2017). The selection pressure imposed by the extensive use of glyphosate has led to the evolution of glyphosate-resistant weeds, with A. tuberculatus and Palmer amaranth (Amaranthus palmeri S. Watson) being the most problematic weeds in row-crop production fields in the United States. This has resulted in a resurgence of interest in using PPO-inhibiting herbicides in soybean for effective POST control of glyphosate-resistant weeds (Sarangi and Jhala Reference Sarangi and Jhala2019; Sarangi et al. Reference Sarangi, Sandell, Kruger, Knezevic, Irmak and Jhala2017a; Whitaker et al. Reference Whitaker, York, Jordan and Culpepper2010).
PPO is the last enzyme in the common tetrapyrrole biosynthetic pathway that produces heme and chlorophyll (Matringe et al. Reference Matringe, Camadro, Block, Joyard, Scalla, Labbe and Douce1992). Two nuclear genes, PPX1 and PPX2, encode PPO in plants, where PPX1 functions in the plastids and PPX2 works in the mitochondria (Lermontova et al. Reference Lermontova, Kruse, Mock and Grimm1997; Watanabe et al. Reference Watanabe, Che, Iwano, Takayama, Yoshida and Isogai2001). The inhibition of PPO enzymes following a herbicide application results in the accumulation of protoporphyrinogen IX, which leaks from plastid to the cytoplasm, where it is oxidized into protoporphyrin IX (Matringe and Scalla Reference Matringe and Scalla1988; Witkowski and Halling Reference Witkowski and Halling1989). In the presence of sunlight, protoporphyrin IX in the cytoplasm generates highly reactive singlet oxygen, leading to the death of susceptible plants (Becerril and Duke Reference Becerril and Duke1989; Jacobs et al. Reference Jacobs, Jacobs, Sherman and Duke1991).
Amaranthus tuberculatus resistant to PPO-inhibiting herbicides was first reported in 2001 in Kansas in a continuous soybean production field with a history of repeated POST application of PPO-inhibiting herbicides (Shoup et al. Reference Shoup, Al-Khatib and Peterson2003). By 2019, a total of 13 weed species had evolved resistance to PPO-inhibiting herbicides worldwide, with 4 weed species reported in the United States (Heap Reference Heap2019c). The mechanism of PPO-inhibitor resistance in an A. tuberculatus biotype from Illinois was identified as the deletion of a codon in the coding sequence of PPX2L (a longer version of PPX2), resulting in the loss of glycine at position 210 (ΔG210). The mutation conferring PPO-inhibitor resistance in A. tuberculatus is unique in that it involves an amino acid deletion rather than a substitution (Patzoldt et al. Reference Patzoldt, Hager, McCormick and Tranel2006).
In 2016, the survival of A. tuberculatus after POST application of fomesafen and lactofen was reported by soybean growers in eastern Nebraska. This research was necessary to confirm whether putative resistant A. tuberculatus biotypes from Nebraska were resistant to PPO-inhibiting herbicides and cross-resistant or multiple resistant to other herbicide sites of action. The objectives of this research were to (1) confirm the existence of PPO inhibitor–resistant A. tuberculatus in Nebraska using a whole-plant dose–response bioassay in the greenhouse, (2) investigate the mechanism of PPO-inhibitor resistance in A. tuberculatus, (3) examine the potential multiple herbicide resistance in a putative PPO inhibitor–resistant biotype, and (4) evaluate the response of PPO inhibitor–resistant A. tuberculatus to soybean POST herbicides.
Materials and Methods
Plant Materials
Seven soybean fields in eastern Nebraska, where A. tuberculatus control failures were observed after application of PPO-inhibiting herbicides, were surveyed in the fall of 2016. The seedheads of at least 20 A. tuberculatus plants were collected from each field. Seeds were cleaned thoroughly using a seed blower (South Dakota Seed Blower, Seedburo Equipment, Des Plaines, IL) and stored separately in airtight polyethylene bags at 4 C for 6 mo. In 2017, composite seed samples from each site were planted separately in plastic trays (51 cm by 38 cm by 10 cm) containing potting mix (Berger BM1 All-Purpose Mix, Berger Peat Moss, Saint-Modeste, QC, Canada). Seedlings emerged 4 d after seeding, and the plants were kept in a greenhouse maintained at a 28/24 C day/night temperature with a 16-h photoperiod supplemented by metal-halide lamps. Sufficient water and nutrients (24-8-16, Miracle-Gro® Water Soluble All-Purpose Plant Food, Scotts Miracle-Gro Products, Marysville, OH) were supplied as needed.
Screening for Fomesafen Resistance
Seedlings were thinned, and 80 to 150 plants were allowed per tray. Three trays for each of the seven biotypes were screened in the greenhouse to evaluate their response to fomesafen. Seedlings at 8- to 10-cm height were sprayed with fomesafen (Flexstar®, 225 g ai L−1) at 263 g ha−1 plus crop oil concentrate (COC; Agri-Dex®) at 1% v/v and ammonium sulfate (N-Pak AMS Liquid) at 2.5% v/v using a single-tip spray chamber (DeVries Manufacturing, Hollandale, MN 56045) fitted with an 8001E nozzle (TeeJet® Technologies, Spraying Systems, Wheaton, IL 60187) calibrated to deliver 140 L ha−1 spray volume at 207 kPa pressure at a speed of 4 km h−1. Surviving seedlings from each biotype were counted at 21 d after treatment (DAT), and the percentage of survival was calculated.
Whole-Plant Dose–Response Bioassay
A biotype (hereafter referred to as “NER”) collected from a soybean field in Saunders County, NE (41.24°N, 96.50°W) survived the initial fomesafen screening in the greenhouse and was selected for the whole-plant dose–response bioassay to confirm resistance to PPO-inhibiting herbicides applied POST such as acifluorfen (Ultra Blazer®, 240 g ai L−1, United Phosphorus, King of Prussia, PA), fomesafen, and lactofen (Cobra®, 240 g ai L−1, Valent U.S.A., Walnut Creek, CA). The greenhouse dose–response bioassay was conducted in 2017 at the University of Nebraska–Lincoln. Experiments were repeated in time beginning 14 d after the first experiment. A greenhouse environment similar to that described earlier was maintained for the dose–response bioassay. An A. tuberculatus biotype from Illinois (hereafter referred as “ILR”) with confirmed resistance to PPO-inhibiting herbicides was included in this study as a positive control. Two A. tuberculatus biotypes from Clay County (S1) and Saunders County, NE (S2), with a known history of effective control with PPO-inhibiting herbicides applied POST were included in this study for comparison.
Amaranthus tuberculatus seedlings were grown in 72-cell germination trays and transplanted at the first true-leaf stage into square plastic pots (10 cm by 10 cm by 12 cm) containing potting mix. A single A. tuberculatus plant was allowed to grow in each pot and was considered an experimental unit. Greenhouse experiments were laid out in a randomized complete block design with 10 replications. Seedlings of NER and ILR biotypes were sprayed at 8- to 10-cm height in the spray chamber using eight doses (0, 0.125X, 0.25X, 0.5X, 1X, 2X, 4X, and 16X) of PPO-inhibiting herbicides, where the labeled doses (1X) for acifluorfen, fomesafen, and lactofen were 420, 263, and 220 g ha−1, respectively. The S1 and S2 biotypes were also sprayed with eight doses of these herbicides at rates of 0, 0.063X, 0.125X, 0.25X, 0.5X, 1X, 2X, and 4X. The COC at 1% v/v and ammonium sulfate at 2.5% v/v were mixed with all treatments.
Aboveground biomass of A. tuberculatus was harvested at 21 DAT and oven-dried at 65 C for 5 d. Biomass data were converted into percent biomass reduction compared with the nontreated control using the equation (Sarangi et al. Reference Sarangi, Sandell, Kruger, Knezevic, Irmak and Jhala2017a):
$${\rm{Aboveground \ biomass \ reduction \ }}\left( \% \right) = \left[ {{{C - B} \over C}} \right] \times 100$$
([1])
where C is the biomass of the nontreated control, and B is the biomass of a herbicide-treated plant.
Dose–Response Data Analysis
Aboveground biomass reduction data were regressed over the doses of acifluorfen, fomesafen, and lactofen using a four-parameter log-logistic function (Knezevic et al. Reference Knezevic, Streibig and Ritz2007) in R (R Statistical Software, R Foundation for Statistical Computing, Vienna, Austria):
$$Y = c + {{d - c} \over {1 + {\rm{exp}}[b(\log x - \log e)]}}$$
([2])
where Y is the response variable (reduction in the aboveground biomass), x is the herbicide dose, c is the lower limit (i.e., zero), d is the estimated maximum value of Y, e represents the effective doses of herbicide needed to reduce the aboveground biomass by 50% (i.e., 50% of d or relative ED50), and b is the slope around e. When d was not 100%, the ED50 (relative) values were adjusted using type = “absolute” function in the drc package in R to report the absolute ED50 values. The ED80 values were also estimated following a similar procedure. The resistance index (RI), the ratio between ED50 values of PPO inhibitor–resistant biotypes (NER or ILR) and susceptible biotypes (S1 or S2), was determined.
The goodness-of-fit parameters such as root mean-square error (RMSE) and model efficiency coefficient (E f ) were calculated using the equations (Sarangi et al. Reference Sarangi, Irmak, Lindquist, Knezevic and Jhala2016):
$${\rm{RMSE}} = {\rm{}}{\left[ {{1 \over n}\sum\nolimits_{i = 1}^n {{{\left( {{P_i} - {O_i}} \right)}^2}} } \right]^{1/2}}$$
([3])
$${E_f} = 1 - \left[ {\sum\nolimits_{i - 1}^n {{{\left( {{O_i} - {P_i}} \right)}^2}} /\sum\nolimits_{i = 1}^n {{{({O_i} - {{\overline O}_i})}^2}} } \right]$$
([4])
where Pi
is the predicted value, Oi
is the observed value,
$${{\overline O}_i}}$$
is the mean observed value, and n is the total number of observations. A smaller RMSE value means a better fit, and an E
f
value closer to 1 means more accurate predictions.
Screening for Target-Site Resistance in the PPX2L Gene
The Kompetitive Allele Specific PCR (KASP™) assay is a faster and less expensive method for genotyping SNPs (Broccanello et al. Reference Broccanello, Chiodi, Funk, McGrath, Panella and Stevanato2018; Patterson et al. Reference Patterson, Fleming, Kessler, Nissen and Gaines2017; Rosas et al. Reference Rosas, Bonnecarrère and Pérez de Vida2014) than other techniques, such as allele-specific PCR (Lee et al. Reference Lee, Hager and Tranel2008) or TaqMan® qPCR assays (Varanasi et al. Reference Varanasi, Brabham, Norsworthy, Nie, Young, Houston, Barber and Scott2018; Wuerffel et al. Reference Wuerffel, Young, Lee, Tranel, Lightfoot and Young2015a). Therefore, a novel assay using KASP™ was developed for the rapid and robust detection of the ΔG210 mutation in PPX2L alleles in the NER and ILR biotypes. A 50-mg sample of young meristematic leaf tissue was collected in a 1.5-ml microcentrifuge tube (Thermo Fisher Scientific, Waltham, MA) for each A. tuberculatus biotype—both the NER and ILR biotypes (which survived the application of acifluorfen, fomesafen, and lactofen at 4X and 16X doses in the dose–response bioassay) and the S1 and S2 biotypes (nontreated). A total of nine plants from NER and six plants from ILR biotypes were selected for leaf tissue collection. Three plants from the S1 and S2 biotypes were selected. The leaf samples were immediately frozen in liquid nitrogen and stored at −80 C until the commencement of the experiment.
Plant DNA Extraction
The DNA extraction and analysis were performed in the Molecular Weed Science Lab at Colorado State University using the Qiagen DNEasy Plant Mini Kit (Qiagen Science, Germantown, MD). DNA concentration and purity were measured in a spectrophotometer (NanoDrop 2000 Spectrophotometers, Thermo Fisher Scientific, Wilmington, DE), and samples were diluted to 5 ng µl−1.
Primer Design
Three primers were designed for the KASP™ assay to distinguish between A. tuberculatus with the ΔG210 mutation (the resistant allele) and biotypes retaining the G210 codon (the susceptible allele). The forward primer for the susceptible allele was appended at the 5′ end with the sequence complementary to the HEX fluorophore-quencher (GAAGGTCGGAGTCAACGGATTagcgattgaggatctccaccac), while the forward primer for the resistant allele was appended at the 5′ end with the sequence complementary to the FAM fluorophore-quencher (GAAGGTGACCAAGTTCATGCTagcgattgaggatctccacatg). Additionally, one universal reverse primer (gttatgacccttttgttgcggg) was also designed for the KASP™ assay.
KASP™ Assay
A primer master mix including both forward primers and the reverse primer was made according to the KASP™ assay manufacturer’s recommendations (LGC Genomics, Beverly, MA). The primers were resuspended in distilled water at 100 µM, and a primer master mix was assembled with 18 µl of resistant allele forward primer, 18 µl of the susceptible allele forward primer, 45 µl of the common reverse primer, and 69 µl of distilled water. The KASP™ master mix contained 432 µl of LGC Genomics Master Mix (which includes polymerase, dNTPs, buffer, and HEX- and FAM-tagged oligonucleotides) and 11.88 µl of the appropriate primer master mix.
The KASP™ reactions were assembled in a 96-well plate using 4 µl of the master mix with either 4 µl of water (no-template control) or 4 µl of genomic DNA (at a concentration of 5 ng µl−1). The reactions were performed in a Bio-Rad CFX Connect (Bio-Rad Laboratories, Hercules, CA) following the standard KASP™ protocol. The PCR conditions for amplifying the PPX2L gene were activation at 94 C for 15 min, followed by 10 touchdown cycles of 20 s at 94 C (denaturing), 61 to 55 C for 60 s (dropping 0.6 C per cycle for annealing and elongation), 23 C for 30 s (for accurate plate reading), followed by 26 cycles at 94 C for 20 s, 55 C for 60 s, and 23 C for 30 s. Real-time data for fluorescence were recorded with the plate reads at the end of every amplification cycle. Fluorescence data from the cycle showing the greatest distinction between clusters without any background amplification (29 to 31 of the amplification phase) were used for making genotype calls.
Data Analysis
The HEX and FAM fluorescence data for the individual samples were transformed into the percentage of relative fluorescence units (RFUs) for each fluorophore using the equation (Oliveira et al. Reference Oliveira, Gaines, Patterson, Jhala, Irmak, Amundsen and Knezevic2018):
$${\rm{RFU}}\left( \% \right) = {{X - {\rm{RF}}{{\rm{U}}_{{\rm{min}}}}} \over {{\rm{RF}}{{\rm{U}}_{{\rm{max}}}} - {\rm{RF}}{{\rm{U}}_{{\rm{min}}}}}} \times 100$$
([5])
where X is the HEX or FAM fluorescence for an individual data point, and RFUmin and RFUmax are the lowest and highest fluorescence signal, respectively, from a reaction. A stepwise linear discriminant analysis was performed using R statistical software for discriminating the three clusters (homozygous for the resistant or susceptible PPX2L alleles, or heterozygous) based on their similarity in HEX and FAM fluorescence values.
Screening for Multiple Herbicide Resistance
The NER biotype was tested for resistance to ALS (chlorimuron and imazethapyr), EPSPS (glyphosate), and PSII (atrazine) inhibitors in the greenhouse at the University of Nebraska–Lincoln in 2017. Whole-plant dose–response bioassays were conducted separately for each herbicide following the procedure described earlier for the PPO-inhibiting herbicides, and the experiments were repeated in time. The susceptibility of the S1 biotype to atrazine and glyphosate was known; therefore, the S1 biotype was included in the dose–response study for comparison. However, the S1 biotype had previously been identified as resistant to ALS-inhibiting herbicides (Sarangi et al. Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015); therefore, an A. tuberculatus biotype collected from Pawnee County, NE (“PAW”), with a relatively higher sensitivity to ALS-inhibiting herbicides was included in the dose–response bioassay. A confirmed glyphosate-resistant A. tuberculatus biotype from Dodge County, NE (“DOD”), was also included in the glyphosate dose–response bioassay as a positive control (Table 1). Aboveground biomass reduction data were recorded at 21 DAT and regressed over the herbicide doses using Equation 2.
The POST herbicides used for the whole-plant dose–response bioassays conducted at the University of Nebraska–Lincoln to confirm multiple herbicide–resistant Amaranthus tuberculatus in Nebraska a .
a Amaranthus tuberculatus biotypes collected from Saunders, Pawnee, and Dodge counties of Nebraska were designated as NER, PAW, and DOD, respectively. A known glyphosate- and atrazine-susceptible biotype (S1) was collected from Clay County, NE, and included in this study for comparison.
b Crop oil concentrate (COC; Agri-Dex®, Helena Chemical, Collierville, TN 38017) at 1% v/v was included in the chlorimuron, imazethapyr, and atrazine treatments; nonionic surfactant (NIS; Induce®, Helena Chemical), at 0.25% v/v was included in the glyphosate treatment; and ammonium sulfate (N-Pak® AMS Liquid, Winfield Solutions, St Paul, MN 55164) at 2.86 kg ai ha−1 was mixed with the treatments of chlorimuron, imazethapyr, and glyphosate.
c Abbreviations: ALS, acetolactate synthase; EPSPS, 5-enolpyruvylshikimate-3-phosphate synthase; PSII, photosystem II.
Response to POST Soybean Herbicides
The efficacy of POST soybean herbicides was evaluated for aboveground biomass reduction of NER. Treatments included registered POST soybean herbicides and their tank mixes (Table 2). The study was conducted in the greenhouse under the same growing conditions described for the dose–response study. Herbicide doses were selected based on the labeled doses for soybean (Table 2) and applied when plants were 10- to 15-cm tall. The response of the PPO inhibitor–susceptible biotype (S1) was also evaluated in this study. Experiments were repeated in time, beginning 14 d after the first experiment. Treatments were arranged in a randomized complete block design with five replications. Aboveground biomass data were recorded at 21 DAT and converted into percent biomass reduction using Equation 1.
The POST soybean herbicides and doses used in a greenhouse study at the University of Nebraska–Lincoln to determine the response of Amaranthus tuberculatus biotypes.
a Abbreviations: ALS, acetolactate synthase; AMS, ammonium sulfate; COC, crop oil concentrate; EPSPS, 5-enolpyruvylshikimate-3-phosphate synthase; GLS, glutamine synthetase; MSO, methylated seed oil; NIS, nonionic surfactant; PPO, protoporphyrinogen oxidase; PSII, photosystem II; SA, synthetic auxins.
b AMS at 2.86 kg ai ha−1; COC at 1.0% v/v; MSO at 1.0% v/v; and NIS at 0.25% v/v rate were mixed.
c Saflufenacil is labeled for preplant or PRE applications in soybean.
Statistical Analysis
Data were subjected to ANOVA using PROC GLIMMIX in SAS v. 9.4 (SAS Institute, Cary, NC). Experimental run, replication, and all interactions containing either of these effects were considered random effects. Herbicide treatment was considered a fixed effect in the model. Aboveground biomass reduction data for the nontreated control were excluded from the analysis, as all the replicated values were zero. To satisfy the assumptions of ANOVA, normality and homogeneity of variance were tested using PROC UNIVARIATE in SAS. Data were arc-sine square-root transformed before analysis; however, back-transformed original mean values are presented based on the interpretation of the transformed data. Treatment means were separated using Fisher’s protected LSD test at a significance level of 0.05.
Results and Discussion
PPO-Inhibitor Dose–Response Bioassay
Amaranthus tuberculatus biotypes collected from eastern Nebraska were screened for PPO-inhibitor resistance in the greenhouse using a single dose of fomesafen (263 g ha−1), and six of seven biotypes showed less than 5% survival; however, 63% of plants from the NER biotype survived the initial screening (unpublished data). It is evident that PPO inhibitor–resistant A. tuberculatus is not widespread in Nebraska, but that some plants less sensitive (or resistant) to fomesafen are present. Similarly, Crespo et al. (Reference Crespo, Wingeyer, Kruger, Riggins, Tranel and Bernards2017) also found an A. tuberculatus biotype in Nebraska that had reduced sensitivity to lactofen.
Acifluorfen applied POST at the labeled dose (420 g ha−1) reduced the aboveground biomass of the S1 and S2 biotypes by 93% and 95%, respectively (Table 3). However, the same dose caused ≤80% biomass reduction of the ILR and NER biotypes (Figure 1A; Table 3). Acifluorfen doses required for 50% (ED50) and 80% (ED80) biomass reduction of the NER biotype were 49 and 392 g ha−1, respectively, compared with 83 and 1,121 g ha−1, respectively, for the ILR biotype. The ED50 values for the susceptible biotypes were 11 g ha−1. The comparisons of relative potency between dose–response curves showed that the ED50 values of ILR and NER were higher (P < 0.05) than the ED50 values of the susceptible biotypes (data not shown). The dose response of the NER biotype to acifluorfen is depicted in Figure 2A.
Dose–response curves of a putative protoporphyrinogen oxidase (PPO) inhibitor–resistant Amaranthus tuberculatus biotype from Nebraska (NER), a known PPO inhibitor–resistant biotype from Illinois (ILR), and two known PPO inhibitor–susceptible biotypes from Nebraska (S1 and S2). Graphs presenting the effect of (A) acifluorfen, (B) fomesafen, and (C) lactofen for the aboveground biomass reduction of A. tuberculatus biotypes at 21 d after herbicide treatment in the whole-plant dose–response bioassays conducted in the greenhouse at the University of Nebraska–Lincoln.
Response of a putative protoporphyrinogen oxidase (PPO) inhibitor–resistant Amaranthus tuberculatus biotype from Nebraska (NER) to POST application of acifluorfen at 21 d after treatment. (A) Dose–response of A. tuberculatus, where 1X = 420 g ai ha−1; and (B) phenotypic response of PPO inhibitor–resistant A. tuberculatus plants: old tissue exhibits bronzing and necrosis from the damage caused by acifluorfen applied at the 2X dose, whereas new tissue shows minimal damage.
Estimates of the regression parameters, model goodness of fit, and acifluorfen doses required to reduce the aboveground biomass of Amaranthus tuberculatus biotypes by 50% (ED50) and 80% (ED80) at 21 d after acifluorfen treatments in a greenhouse whole-plant dose–response bioassay conducted at the University of Nebraska–Lincoln a .
a Abbreviations: E f , model efficiency coefficient; ILR, confirmed PPO inhibitor–resistant A. tuberculatus biotype from Illinois; NER, putative PPO inhibitor–resistant biotype from Nebraska; RI, resistance index; RMSE, root mean-square error; S1, PPO inhibitor–susceptible biotype from Clay County; S2, PPO inhibitor–susceptible biotype from Saunders County; SEM, standard error of the mean.
b Acifluorfen labeled dose (1X) = 420 g ai ha−1.
c RI was determined using the ratio between ED50 values of the NER or ILR and the susceptible biotypes (S1 or S2).
Shortly after the PPO-inhibiting herbicide application, resistant plants from the NER and ILR biotypes exhibited injury symptoms typically found with this chemistry, including chlorosis, necrosis, and crinkling of leaves; however, within 10 d of herbicide application, new growth arose from the apical meristem and/or the axillary buds (Figure 2B). A similar phenomenon was also observed in the PPO inhibitor–resistant A. tuberculatus biotypes from Illinois (Patzoldt et al. Reference Patzoldt, Tranel and Hager2005) and Kansas (Shoup et al. Reference Shoup, Al-Khatib and Peterson2003). Results of acifluorfen dose–response bioassay confirmed that the putative PPO inhibitor–resistant biotype (NER) was 4-fold resistant to acifluorfen compared with the susceptible biotypes (Table 3).
The fomesafen dose–response bioassay revealed that the level of resistance in the NER biotype was higher than that of the confirmed PPO inhibitor–resistant biotype from Illinois (ILR) (Figure 1B). Biologically effective doses of fomesafen required for 50% reduction in the aboveground biomass (ED50) of ILR, NER, S1, and S2 were 41, 75, 17, and 12 g ha−1, respectively (Table 4). The labeled dose of fomesafen (263 g ha−1) caused 85% and 75% biomass reduction of the ILR and NER biotypes, respectively; however, that dose resulted in 91% and 92% reduction in the biomass of the S1 and S2 biotypes, respectively. Thus, the NER biotype showed a 4- to 6-fold resistance to fomesafen compared with the known susceptible biotypes.
Estimates of the regression parameters, model goodness of fit, and fomesafen doses required to reduce the aboveground biomass of Amaranthus tuberculatus biotypes by 50% (ED50) and 80% (ED80) at 21 d after fomesafen treatments in a greenhouse whole-plant dose–response bioassay conducted at the University of Nebraska–Lincoln a .
a Abbreviations: E f , model efficiency coefficient; ILR, confirmed PPO inhibitor–resistant A. tuberculatus biotype from Illinois; NER, putative PPO inhibitor–resistant biotype from Nebraska; RI, resistance index; RMSE, root mean-square error; S1, PPO inhibitor–susceptible biotype from Clay County; S2, PPO inhibitor–susceptible biotype from Saunders County; SEM, standard error of the mean.
b Fomesafen labeled dose (1X) = 263 g ai ha−1.
c RI was determined using the ratio between ED50 values of the NER or ILR and the susceptible biotypes (S1 or S2).
The labeled dose of lactofen (220 g ai ha−1) resulted in 58% and 71% biomass reduction of the ILR and NER biotypes, respectively (Table 5). Lactofen applied at the labeled dose showed the least injury to the ILR and NER biotypes compared with acifluorfen and fomesafen. Shoup et al. (Reference Shoup, Al-Khatib and Peterson2003) also reported that the PPO inhibitor–resistant A. tuberculatus biotype from Kansas had a higher level of resistance to lactofen compared with acifluorfen and fomesafen.
Estimates of the regression parameters, model goodness of fit, and lactofen doses required to reduce the aboveground biomass of Amaranthus tuberculatus biotypes by 50% (ED50) and 80% (ED80) at 21 d after lactofen treatments in a greenhouse whole-plant dose–response bioassay conducted at the University of Nebraska–Lincoln a .
a Abbreviations: E f , model efficiency coefficient; ILR, confirmed PPO inhibitor–resistant A. tuberculatus biotype from Illinois; NER, putative PPO inhibitor–resistant biotype from Nebraska; RI, resistance index; RMSE, root mean-square error; S1, PPO inhibitor–susceptible biotype from Clay County; S2, PPO inhibitor–susceptible biotype from Saunders County; SEM, standard error of the mean.
b Lactofen labeled dose (1X) = 220 g ai ha−1.
c RI was determined using the ratio between ED50 values of the NER or ILR and the susceptible biotypes (S1 or S2).
Effective doses of lactofen required to reduce aboveground biomass of the NER biotype by 50% (ED50) and 80% (ED80) were 58 and 1,526 g ha−1. The ED50 values for the susceptible biotypes (S1 and S2) were 11 and 12 g ha−1 (Figure 1C; Table 5). Comparison of the effective doses showed that the ED50 values were similar for the ILR and NER biotypes (P = 0.26); however, the values were higher for the resistant biotypes than the susceptible biotypes (data not shown). The RI for the NER biotype was 5; however, the values ranged from 10 to 11 for the ILR biotype depending on the susceptible biotypes used for comparison (Table 5).
The RMSE values for the dose–response bioassays of the PPO-inhibiting herbicides ranged between 5.2 and 19.5, with the E f values ranging from 0.6 to 0.9, showing a good fit of the four-parameter log-logistic model (Tables 3–5).
Mechanism of PPO-Inhibitor Resistance
A KASP™ assay designed to evaluate the PPO-inhibitor resistance mechanism (a target-site resistance) in A. tuberculatus was able to distinguish the resistant biotypes from the susceptible biotypes. Four clusters were identified in the linear discriminant analysis, including three genotype clusters and one no-template control, and the RFU values for the FAM (resistant alleles) ranged from 80.3% to 100% in the homozygous condition and from 32.8% to 41.2% in the heterozygous condition (Figure 3). Results revealed that all samples of the NER biotype tested positive for the ΔG210 mutation, but that the individuals selected for the KASP™ assay were heterozygous. The same mutation was also present in the plants of a known PPO inhibitor–resistant biotype, ILR, but in a homozygous condition (Figure 3). As expected, the KASP™ assay detected the susceptible allele containing the G210 codon in both A. tuberculatus biotypes that were phenotypically susceptible to PPO-inhibiting herbicides. No ambiguous sample was detected in the 18 samples tested using the KASP™ assay.
Results of the Kompetitive Allele Specific PCR (KASP™) assay showing the presence of target-site mutation (ΔG210) in a putative protoporphyrinogen oxidase (PPO) inhibitor–resistant Amaranthus tuberculatus biotype from Nebraska (NER) and a known PPO inhibitor–resistant biotype from Illinois (ILR). No-template control (NTC) and known PPO inhibitor–susceptible biotypes (S1 and S2) were included for comparison, and the HEX and FAM fluorescence data were transformed into the percentage of relative fluorescence units. Dashed lines represent the cutoffs for making genotyping calls, and the solid quarter circle represents the cutoff for no amplification.
A target-site resistance mechanism involving a codon deletion in the PPX2L gene, resulting in the loss of a glycine residue at the position 210 (ΔG210) of the PPO enzyme, confers PPO resistance in the NER biotype. Surveys have indicated that the ΔG210 mutation in PPO inhibitor–resistant A. tuberculatus was widespread in Illinois, Kansas, and Missouri (Shergill et al. Reference Shergill, Bish, Jugulam and Bradley2018b; Thinglum et al. Reference Thinglum, Riggins, Davis, Bradley, Al-Khatib and Tranel2011; Wuerffel et al. Reference Wuerffel, Young, Lee, Tranel, Lightfoot and Young2015a). The presence of ΔG210 was also confirmed in PPO inhibitor–resistant A. palmeri in Arkansas (Salas et al. Reference Salas, Burgos, Tranel, Singh, Glasgow, Scott and Nichols2016). Two additional mutations of the PPX2 gene (R128G and R128I mutations encoding for a glycine [G] or an isoleucine [I] substitution for an arginine at the 128th [R128] site) likely to confer resistance to PPO inhibitors were recently detected in A. tuberculatus biotypes collected from the Midwest; however, it was suspected that the interspecific gene flow among Amaranthus spp. aided in accumulation of these mutations along with the G210 codon deletion in A. tuberculatus (Nie et al. Reference Nie, Mansfield, Harre, Young, Steppig and Young2019). In our study, these mutations were not tested in the NER biotype.
Multiple Herbicide Resistance
The NER biotype showed a high level of resistance to ALS-inhibiting herbicides. Chlorimuron and imazethapyr at labeled doses (13.1 and 70 g ai ha−1, respectively) caused 41% and 27% aboveground biomass reduction of the NER biotype, respectively. The highest doses of these herbicides (32X the labeled doses) were not able to provide 80% reduction of the aboveground biomass. The biologically effective doses of chlorimuron and imazethapyr for 50% reduction in the aboveground biomass of the NER biotype were 35 and 235 g ha−1, respectively (Table 6). RIs of the NER biotype for ALS-inhibiting herbicides tested in this study were >7.0. It was evident that the NER biotype was cross-resistant to chlorimuron and imazethapyr and that the level of resistance was high. The high level of resistance to ALS-inhibiting herbicides in A. tuberculatus biotypes has also previously been documented in several states in the Midwest (Foes et al. Reference Foes, Liu, Tranel, Wax and Stoller1998; Shergill et al. Reference Shergill, Barlow, Bish and Bradley2018a), including Nebraska (Sarangi et al. Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015).
Estimates of herbicide doses resulting in 50% (ED50) and 80% (ED80) reduction in the aboveground biomass of Amaranthus tuberculatus biotypes at 21 d after treatment in the greenhouse whole-plant dose–response bioassay conducted at the University of Nebraska–Lincoln. a
a Abbreviations: DOD, confirmed glyphosate-resistant A. tuberculatus biotype from Dodge County; NER, PPO inhibitor–resistant biotype from Nebraska; PAW, biotype collected from Pawnee County; RI, resistance index; S1, glyphosate- and atrazine-susceptible biotype from Clay County; SEM, standard error of the mean.
b Exact values could not be estimated, as the selected dose range did not cover sufficiently large doses for this biotype.
c The labeled doses (1X) of chlorimuron, imazethapyr, glyphosate, and atrazine are 13.1, 70, 870, and 2,240 g ai ha−1, respectively.
d RI was determined using the ratio between ED50 values of the resistant biotypes and susceptible biotypes.
e RI for the NER biotype was calculated based on the ED50 values of the PAW biotype; however, no known susceptible biotype was available for comparison.
The ALS-inhibiting herbicides have been used for more than 30 yr, targeting most of the weed species in major agronomic crops in the United States, which resulted in high selection pressure on weed species (Tranel and Wright Reference Tranel and Wright2002). Moreover, the ALS enzyme is vulnerable to gene point mutations that confer resistance. ALS inhibitor–resistant weed species, including Amaranthus spp., are widely distributed in Nebraska (Sarangi and Jhala Reference Sarangi and Jhala2018; Sarangi et al. Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015). Tranel et al. (Reference Tranel, Wu and Sadeque2017) revealed that the corresponding genes for resistance to ALS- and PPO-inhibiting herbicides (ALS and PPX2) were genetically linked in a multiple herbicide–resistant A. tuberculatus biotype found in Illinois. In our study, the mechanism for ALS-inhibiting herbicide resistance was not tested.
Glyphosate applied at the labeled dose (870 g ae ha−1) resulted in 70% aboveground biomass reduction of the NER biotype (Table 6). Glyphosate doses needed for 50% reduction in the biomass reduction (ED50) of the NER and S1 biotypes were 371 and 111 g ha−1, respectively. A known glyphosate-resistant A. tuberculatus biotype (designated “DOD”) from Nebraska showed a relatively high level of resistance to glyphosate compared with the NER biotype, and the ED50 value for the DOD biotype was 1,046 g ha−1 for biomass reduction (Table 6). Comparison of biologically effective doses of glyphosate showed that the ED50 value for the S1 biotype was lower (P < 0.05) than values for the NER and DOD biotypes (data not shown). The RIs were 3 and 9 for the NER and DOD biotypes, respectively.
Glyphosate-resistant A. tuberculatus is widespread in the eastern part of Nebraska (Vieira et al. Reference Vieira, Samuelson, Alves, Gaines, Werle and Kruger2018). Sarangi et al. (Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015) revealed that A. tuberculatus biotypes collected from seven counties in eastern Nebraska were 3- to 39-fold resistant to glyphosate compared with known susceptible biotypes. Moreover, a total of 18 states in the midwestern and southern United States have confirmed the presence of glyphosate-resistant A. tuberculatus (Heap Reference Heap2019a).
The atrazine dose required for 50% aboveground biomass reduction (ED50) of the NER biotype was 1,323 g ai ha−1 (Table 6). The labeled dose of atrazine (2,240 g ha−1) provided 62% biomass reduction of the NER biotype. The ED50 value for the NER biotype was higher (P < 0.05) than that of the susceptible biotype (S1) (data not shown), and based on the ED50 values, the NER biotype was 7-fold resistant to atrazine compared with the S1 biotype. Atrazine-resistant A. tuberculatus in Nebraska was first reported in 1990 (Anderson et al. Reference Anderson, Roeth and Martin1996), and A. tuberculatus resistant to atrazine applied POST is widespread in Nebraska: a 2014 survey of 85 fields in eastern Nebraska revealed that atrazine-resistant A. tuberculatus was present in 73% of all fields surveyed (Vennapusa et al. Reference Vennapusa, Faleco, Vieira, Samuelson, Kruger, Werle and Jugulam2018). The occurrence of atrazine-resistant A. tuberculatus with a high level of resistance is also widespread in other states in the Midwest (Heap Reference Heap2019b): for example, a recent report suggested that a multiple herbicide–resistant biotype from Missouri showed 7- to 19-fold resistance to atrazine (Shergill et al. Reference Shergill, Barlow, Bish and Bradley2018a).
Response of the NER Biotype to POST Soybean Herbicides
With the confirmed resistance to four herbicide sites of action, there are limited POST herbicide choices for soybean growers to control the NER biotype. The ALS-inhibiting herbicides applied alone or in mixture with glyphosate reduced the aboveground biomass of the NER biotype up to 43% (Table 7). Glufosinate, 2,4-D choline plus glyphosate, and dicamba caused ≥92% aboveground biomass reduction of the NER biotype. Therefore, it is evident that the multiple herbicide–resistant NER biotype can only be controlled effectively using POST herbicides in glufosinate-, 2,4-D-, and dicamba-resistant soybean. Similarly, in a previous study, Sarangi et al. (Reference Sarangi, Sandell, Knezevic, Aulakh, Lindquist, Irmak and Jhala2015) reported that glufosinate applied POST at 594 g ai ha−1 reduced aboveground biomass up to 93% in glyphosate-resistant A. tuberculatus biotypes collected from soybean fields in eastern Nebraska. Additionally, Chahal et al. (Reference Chahal, Aulakh, Rosenbaum and Jhala2015) reported that glyphosate-resistant A. tuberculatus at 10-cm height was controlled 90% with 2,4-D choline plus glyphosate applied at 1,640 g ha−1. An A. tuberculatus biotype from Nebraska was previously confirmed with 10-fold resistance to 2,4-D and reduced sensitivity to dicamba in a continuous grass seed–production pasture (Bernards et al. Reference Bernards, Crespo, Kruger, Gaussoin and Tranel2012); therefore, proper stewardship is needed to preserve herbicide-resistant soybean technologies against the spread of multiple herbicide–resistant weeds.
Control and biomass reduction of PPO inhibitor–resistant (NER) and PPO inhibitor–susceptible (S1) Amaranthus tuberculatus biotypes in response to soybean POST herbicides at 21 d after treatment in the greenhouse study conducted at the University of Nebraska–Lincoln. a,b
a Data were arc-sine square-root transformed before analysis; however, back-transformed original mean values are presented based on the interpretation of the transformed data.
b Means presented within each column with no common letter(s) are significantly different according to Fisher’s protected LSD at a significance level of 0.05.
Saflufenacil, a PPO-inhibiting herbicide, is labeled for preplant or PRE applications in soybean, and a stakeholders’ survey in 2015 revealed that saflufenacil was one of the most commonly used preplant herbicides in Nebraska (Sarangi and Jhala Reference Sarangi and Jhala2018). Saflufenacil applied at the labeled dose reduced aboveground biomass 77% in the NER biotype compared with 94% biomass reduction of PPO inhibitor–susceptible biotype (S1) (Table 7). Salas-Perez et al. (Reference Salas-Perez, Burgos, Rangani, Singh, Refatti, Piveta, Tranel, Mauromoustakos and Scott2017) reported that fomesafen-resistant A. palmeri biotypes from Arkansas showed higher sensitivity to saflufenacil than other foliar-applied PPO-inhibiting herbicides.
Practical Implications
Results of this study confirmed that the NER biotype was multiple resistant to herbicides from four sites of action (ALS, EPSPS, PPO, and PSII inhibitors) and that A. tuberculatus is the first weed species in Nebraska showing resistance to PPO-inhibiting herbicides. The ΔG210 mutation in the PPX2L gene conferred the PPO-inhibitor resistance in the NER biotype. Additionally, the results of the PPO-inhibitor dose–response bioassays most likely underestimated the level of resistance in the NER biotype because of the presence of heterozygous resistant plants, which was also confirmed in the KASP™ assay. Moreover, Patzoldt et al. (Reference Patzoldt, Hager, McCormick and Tranel2006) confirmed that PPO-inhibitor resistance in A. tuberculatus is an incomplete dominant trait.
A recent stakeholders’ survey in Nebraska indicated that PPO-inhibiting herbicides are used frequently in soybean for preplant (e.g., saflufenacil), PRE (flumioxazin and sulfentrazone), and POST (fluthiacet-methyl and lactofen) weed control (Sarangi and Jhala Reference Sarangi and Jhala2018). Non-transgenic soybean growers are also primarily relying on PPO inhibitors for POST control of Amaranthus spp. (Sarangi and Jhala Reference Sarangi and Jhala2019). Though it is reported that the evolution rate of PPO inhibitor–resistant weed biotypes is relatively slow compared with ALS-inhibitor resistance (Dayan et al. Reference Dayan, Barker and Tranel2017; Riggins and Tranel Reference Riggins and Tranel2012), pollen- and seed-mediated gene flow in A. tuberculatus may play an important role in spreading this biotype (Sarangi et al. Reference Sarangi, Tyre, Patterson, Gaines, Irmak, Knezevic, Lindquist and Jhala2017b).
The efficacy of soil-applied PPO-inhibiting herbicides was not tested in this study for the NER biotype; however, a variable sensitivity of the PPO inhibitor–resistant A. tuberculatus to soil-applied PPO inhibitors was reported previously (Patzoldt et al. Reference Patzoldt, Tranel and Hager2005; Wuerffel et al. Reference Wuerffel, Young, Matthews and Young2015b). Shoup et al. (Reference Shoup, Al-Khatib and Peterson2003) reasoned that a PPO inhibitor–resistant biotype might have reduced sensitivity to a particular PPO-inhibiting herbicide chemical family that has been used most frequently in a system. Moreover, Wuerffel et al. (Reference Wuerffel, Young, Matthews and Young2015b) reported that plant growth stages considerably impacted the sensitivity of A. tuberculatus to PPO-inhibiting herbicides. Umphres et al. (Reference Umphres, Steckel and Mueller2018) reported that A. palmeri resistant to POST-applied fomesafen had greater sensitivity to soil-applied PPO-inhibiting herbicides such as flumioxazin and saflufenacil.
While dicamba, 2,4-D choline, or glufosinate were effective for controlling the multiple herbicide–resistant A. tuberculatus biotype (NER), relying on a single herbicide or the herbicides with a same site of action will enhance selection pressure. Therefore, diversified weed management approaches, including cultural, mechanical, and chemical weed management and implementation of herbicide programs with multiple sites of action, are needed for sustainable management of weeds.
Author ORCIDs
Debalin Sarangi, https://orcid.org/0000-0002-1876-8400; Todd A. Gaines, https://orcid.org/0000-0003-1485-7665; Amit J. Jhala, https://orcid.org/0000-0001-8599-4996.
Acknowledgments
The authors would like to thank Aaron G. Hager, Associate Professor of Weed Science at the University of Illinois at Urbana–Champaign, for providing the seeds of the known PPO inhibitor–resistant A. tuberculatus biotype from Illinois (ILR). This work was partially supported by the USDA National Institute of Food and Agriculture, Hatch project NEB-22-396. We also appreciate the help of Ian Rogers, Jasmine Mausbach, and Murtaza Nalwala in this project. No conflicts of interest have been declared.
