Introduction
Rhizocephalan barnacles of the genus Sylon are parasites of shrimps of the infraorder Caridea Dana, 1852. Body of Sylon sp. is ovoid; two small mantle pores without muscles arrange in the anterior part of the dorsolateral surface, left and right of the median plane; a single colleteric gland locates in the posterior part of the visceral mass; receptacles are not found; larvae are released as cyprids (Høeg and Lützen, Reference Høeg and Lützen1985).
Until 1992, the genus Sylon belonged to the monotypic family Sylonidae Boshma, 1928. Høeg and Rybakov (Reference Høeg and Rybakov1992) joined Sylonidae to the family Clistosaccidae with one monotypic genus Clistosaccus Lilljeborg, 1861. It is supported by similarity of their cypris larvae (Glenner et al., Reference Glenner, Høeg, Klysner and Brodin Larsen1989, Reference Glenner, Høeg, Stenderup and Rybakov2010; Jensen et al., Reference Jensen, Høeg, Bower and Rybakov1994a, Reference Jensen, Moyse, Høeg and Al-Yahyab) and molecular data (Glenner and Hebsgaard, Reference Glenner and Hebsgaard2006; Glenner et al., Reference Glenner, Høeg, Stenderup and Rybakov2010; Høeg et al., Reference Høeg, Rees, Jensen, Glenner, Smit, Bruce and Hadfield2019, Reference Høeg, Noever, Rees, Crandall and Glenner2020). At the same time, Clistosaccus and Sylon have different hosts (hermit crabs vs shrimps). Morphology and anatomy of their externae also considerably differ: Clistosaccus is tubular, has one mantle opening with muscles and one receptacle. Sylon is ovoid, has two mantle pores without muscles and lack receptacles totally.
The genera Sylon with a single species Sylon hippolytes M. Sars, 1870 and Clistosaccus with also a single species C. paguri Lilljeborg, 1861 are monotypic; however, both genera have a circumpolar distribution and multiple hosts (Høeg and Lützen, Reference Høeg and Lützen1985; Høeg and Rybakov, Reference Høeg and Rybakov1992). Therefore, both genera may comprise several cryptic species.
Shrimps infested by Sylon sp. were sampled during the 56 (2019) and 73 (2024) research cruises on board of the RV ‘Akademik Oparin’ along the Kuril Islands. The aim of this work is to identify parasite and host using morphological and molecular methods.
Material and methods
Material was collected along the deep-water transects from 200 to 800 m depth by the modified Sigsbee trawl. We describe here shrimps infected by Sylon sp. that we collected on Pacific bathyal slope of Simushir Island (the Kuril Islands) at 670 m depth, st. 6, 2024 (46°52’36’’N, 152°18’29’’E) (Figure 1A–C). One example was found on the Sea of Okhotsk side of Simushir Island at 633 m depth, st. 8, 2024 (47°13’8’’N, 152°07’36’’E). Additional specimen was collected near Raikoke Island in the Sea of Okhotsk at 241 m depth, st. 81, 2019 (48°19’60’’N, 15°10’42’’E). All shrimps were fixed in 96% ethanol. Four of these specimens were deposited at the Museum of the A.V. Zhirmunsky National Scientific Center of Marine Biology, FEB RAS, Vladivostok (MIMB).
Host shrimp, Heptacarpus maxillipes, infected by Sylon hippolytes (alive): with solitary immature externa (A), with solitary mature externa (B), with two externae (C). Externa of S. hippolytes (fixed): lateral view (D), dorsal view (E). mp, mantle pore.
Material examined
One specimen (3.2/3.0 mm, immature), on female (3.0 mm), at second pleopods, st. 6, 2024; was used for histology (Figure 1A).
One specimen (6.1/3.5 mm, with cyprids), on female (8 mm), between second and third pleopods, st. 6, 2024; was used for SEM (cuticle and larvae) and for genetics (catalogue number MIMB 51774).
One specimen (5.5/4.0 mm, with embryos), on female (8 mm), between second and third pleopods, st. 6, 2024; was used for genetics (catalogue number MIMB 51773) (Figure 1B).
Two specimens on female (8.0 mm): 5.5/2/5 mm, old, between second and third pleopods, cuticle was used for SEM; 4.0/2.6 mm, old, with cyprids, before first pleopods, st. 6, 2024; larvae were used for SEM.
Two specimens on male (5.0 mm): between first and second pleopods: 2.0/1.5 mm, virgin, was used for histology; 1.5/1.0 mm, virgin, was used for genetics, st. 6, 2024 (catalogue number MIMB 51772).
Two specimens on female (7.0 mm): 6.8/4.0 mm, with embryos, at first pleopods; 4.6/2.5 mm, with embryos, at third pleopods, st. 6, 2024 (Figure 1C).
One specimen (3.8/2.0 mm, old), on female (7.8 mm), between first and second pleopods, st. 6, 2024.
One specimen (5.0/3.0 mm, with embryos) on female (8.0 mm), at second pleopods, st. 6, 2024 (catalogue number MIMB 51775).
One specimen (4/0/3/0 mm, without embryos, on female (9.2 mm), between pereopods and first pleopods, st. 8, 2024.
One specimen (9.0/4.0 mm, with embryos), on female (10.0 mm), between first and second pleopods, st. 81, 2019; was used for histology (Figure 1D, E).
Molecular techniques
Three specimens of shrimp and rhizocephalan parasite were subjected to molecular analysis. Total DNA was extracted from a piece of tissue using a chelating resin Chelex 100 (Bio-Rad, USA) according to the protocol described by Jennings et al. (Reference Jennings, Golovan and Brix2020). Fragments of the mitochondrial cytochrome c oxidase subunit I (COI) gene were amplified and sequenced using the following primer pairs: LCO1490 (F) (5’- GGTCAACAAATCATAAAGATATTGG - 3’) and HCO2198 (R) (5’- TAAACTTCAGGGTGACCAAAAAATCA - 3’) (Folmer et al., Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994).
The PCR (polymerase chain reaction) was performed in 12 μl of reaction volume containing 4.5 μl of water; 1.2 μl of 10 × buffer without Mg2+ (Evrogen, Russia); 1.2 μl of dNTP (concentration 2.5 mM of each, Evrogen, Russia); 1.2 μl of each forward and reverse PCR primer (5 μmol/μl); MgCl2 (25 mM, Evrogen, Russia); 0.36 μl of DMSO (BioRad, USA); 0.14 μl of Taq DNA polymerase (5 units/μl, Biolabmix, Russia); and 1 μl of template DNA solution. The cycling parameters included an initial denaturation step at 98°C (3 min), followed by 30 cycles of denaturation for 10 sec at 98°C, annealing for 30 sec at 45°C, extension for 30 sec at 72°C, and a final extension phase at 72°C for 7 min. PCR products were checked for successful amplification and size conformity by electrophoresis in a 1.5% agarose gel using commercial DNA size standards. Amplification products were applied as templates for sequencing, using the same primers as for PCR and the BrilliantDye™ Terminator Cycle Sequencing kit v3.1 (NimaGen BV, the Netherlands), following the manufacturer’s protocol. Sequencing reaction products were purified by ethanol precipitation and analyzed on an ABI-3500 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific Inc., USA). Sequences were verified by forward and reverse comparisons.
Sequence editing and contig assembly were performed using SeqScape 2.5 (Applied Biosystems). Sections corresponding to the primer sequences at the 3’ and 5’ ends of both aligned gene sequences were eliminated before initiating the analyses. A BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 10 April 2025) was used to check new sequences against the database for possible contamination and sequence artefacts. The resulting sequences were submitted to the National Center for Biotechnology Information (GenBank, NCBI, https://www.ncbi.nlm.nih.gov/, accessed on 2 August 2025) nucleotide database with the following accession numbers: PX111337–PX111339 for parasite and PX111334–PX111336 for host (Table S1). To compare the obtained data and clarify the taxonomic position of Sylon sp., sequences of the species for the family Clistosaccidae from GenBank (NCBI, http://www.ncbi.nlm.nih.gov/, accessed on 2 August 2025) were comprised in the analysis. Sequences of Lernaeodiscus species were selected as the outgroup.
For species identification of the host, we used all available sequences of known host genera for this parasite. The host species tree was not rooted. Taxa included in the molecular analyses and their GenBank accession numbers are provided in Table S1.
For our analysis we used two datasets. One of them was for the family Clistosaccidae, and the second one was for host genera. Sequences were downloaded from GenBank and compiled into a single file in MEGA v.11.0.13 (Tamura et al., Reference Tamura, Stecher and Kumar2021). Sequences were aligned using MUSCLE (Edgar RC, 2004) implemented in MEGA v.11.0.13 (Tamura et al., Reference Tamura, Stecher and Kumar2021). The quality of alignment was checked visually. Future analyses were performed on the aligned DNA sequences. The length of sequences after alignment and trimming to the same length was 592 bp for parasites and 541 bp for their host species. The best-fit model of nucleotide substitution for the datasets was identified using ModelFinder (Kalyaanamoorthy et al., Reference Kalyaanamoorthy, Minh, Wong, von Haeseler and Jermiin2017) on the IQ-TREE webserver (http://www.iqtree.org/, accessed on 2 August 2025) (Trifinopoulos et al., Reference Trifinopoulos, Nguyen, von Haeseler and Minh2016). TIM + F + G4 and TVM + F + I + G4 were chosen as the best-fit models according to the Bayesian Information Criterion for Clistosaccidae and host species datasets, respectively.
The maximum likelihood tree was built using the online software IQ-TREE (Nguyen et al., Reference Nguyen, Schmidt, von Haeseler and Minh2015) on the IQ-TREE web server (http://www.iqtree.org/) (Trifinopoulos et al., Reference Trifinopoulos, Nguyen, von Haeseler and Minh2016). The tree topology was evaluated by ultrafast bootstrap approximation (UFBoot) (Minh et al., Reference Minh, Nguyen and von Haeseler2013; Hoang et al., Reference Hoang, Chernomor, von Haeseler, Minh and Vinh2018) for 10 000 replications with SH-aLRT (approximate likelihood ratio test [aLRT] and Shimodaira–Hasegawa [SH]-aLRT) branch test [-alrt] for 10 000 replicates (Guindon et al., Reference Guindon, Dufayard, Lefort, Anisimova, Hordijk and Gascuel2010) and Approximate Bayes test [-aBayes] with a 0.99 minimum correlation as convergence criterion (Anisimova et al., Reference Anisimova, Gil, Dufayard, Dessimoz and Gascuel2011). Result trees were visualized using FigTree v. 1.4.4 (Rambaut, Reference Rambaut2012). Pairwise genetic distances were calculated using MEGA v.11.0.13 (Tamura et al., Reference Tamura, Stecher and Kumar2021). The intra- and interspecific nucleotide variability of the analyzed species was calculated based on the Kimura 2-parameter model (K2P) (Kimura, Reference Kimura1980).
Morphological investigation of the externa
Infected shrimps were photographed alive. Microscopic examination of rhizocephalans was conducted under a MBS-10 stereomicroscope and an Olympus CX41 microscope. The following measurements of the parasite externae were made: length (distance between anterior and posterior ends) and height at the level of the stalk. The length of the anterior calcified part of the carapace (shield length) of the host shrimp was also measured. Sex of the host was determined based on the absence of appendix masculina on the second pleopod in females and the presence of it in males (Komai, Reference Komai1993; McLaughlin, Reference McLaughlin, Bartlett and Brewer1980). The location of the rhizocephalan externa on each host was noted.
One mature and two immature externae of the rhizocephalan fixed in ethanol 96⁰, were dehydrated in ethanol-chloroform and embedded in paraffin. Longitudinal sections, 6 μm thick, were stained with Ehrlich hematoxylin (Kiernan, Reference Kiernan2015). Material was examined with a Zeiss Axio Imager Z.2 light microscope equipped with a digital camera.
For SEM, the mantle and cypris larvae from two specimens were dehydrated though the series of ethanol, transferred to acetone, critical point dried in CO2, and sputtered with chromium. Specimens were observed with a Zeiss Sigma 300 VP microscope.
Host shrimp was identified as Heptacarpus maxillipes using keys of Komai (Reference Komai1993), Komai and Ivanov (Reference Komai and Ivanov2008), Komai and Komatsu (Reference Komai, Komatsu and Fujita2009), Poore and Ahyong (Reference Poore and Ahyong2023).
Results
Molecular analyses
The phylogenetic tree of Clistosaccidae for partial COI gene sequences showed two main clades, corresponding to two genera and two species of this family. Sequences of our specimens formed a single clade with S. hippolytes, and all sequences of Sylon clustered together (Figure 2) were subdivided into three subclades with mean distances between them varying from 6.96 ± 1.07% to 8.44 ± 1.19%. Two of the three subclades of Sylon (with genetic distances between them of 7.71%) were represented by samples from close geographic regions: MH242991 from San Juan Islands (USA), and MG313989–320127 from Queen Charlotte Sounds (British Columbia, Canada); the third subclade PX111337–PX111339 was represented by the sequences from the Pacific slope of the Kuril Islands (Russia). Mean intraspecific distances for S. hippolytes and Clistosaccus paguri were 5.89 ± 0.73% and 0.24 ± 0.11%, respectively. The mean intergeneric distance between Sylon and Clistosaccus was 37.64 ± 2.93%. All genetic distances are seen in Table S2.
ML-phylogenetic tree of the family Clistosaccidae for partial COI gene sequences. Numerals at nodes are bootstrap values of the ML analysis and Bayesian posterior probability values, respectively (ML/BI).
For the host species, there were no sequences belonging to the Heptacarpus maxillipes (Figure S1). The phylogenetic tree for host genera showed that the sequences of H. maxillipes had the closest match with H. tenuissimus Holmes, 1900, with a genetic distance between them of 13.07 ± 1.64%.
Taxonomy
Infraclass Rhizocephala Müller, 1862
Family Clistosaccidae Boschma, 1928
Genus Sylon M. Sars, 1870
Species Sylon hippolytes M. Sars, 1870
Short description of the parasite
We found ten shrimps infected by rhizocephalans: 9 females and 1 male. Carapace length of the infected shrimps ranged from 3 to 10 mm. Seven hosts were with one parasitic externa, three exemplars with two ones (Figure 1A–C). Externa was attached to the abdomen of the host between first and third pleopods via a short stalk. The stalk was located at the posterior part of the dorsal surface of the externa. Long axis of the externa was at an angle to the long axis of the host. The size of the externa ranged from 1.5 to 9.0 mm in length, from 1.0 to 4.0 mm in height. Six out of 12 parasites were ovigerous (two of them with the cyprids in mantle cavity). Three specimens were old and degenerating, three exemplars were immature.
Immature externae were rounded, white (Figure 1A); mature parasites were slightly elongated, pale or pink (Figure 1B). The mantle of the externa was thin and did not exceed 65 μm in thick. The external cuticle (15–20 μm) was smooth, without papillae or excrescences (Figure 3A). Longitudinal grooves were well visible in old degenerating externae (Figure 1D, E). Two small circular mantle pores (near 350 μm in diameter) without muscle sphincters were located at the anterior part of the dorsal surface facing the host (Figures 1E, 3B). Virgin specimens had no mantle pores, mature externae with developing embryos in mantle cavity had something like plugs in mantle pores, mature externae with embryos and larvae in mantle cavity and old specimens with hatched cyprids had open mantle pores. A slightly visible groove passed from the stalk to the mantle pores. Wavy internal cuticle was densely covered with rough papillae of 0.05–0.2 μm in height (Figure 3C). Retinacula were not found.
SEM showing cuticle structure of the externa of Sylon hippolytes. Smooth external surface (A); mantle pores and ovary at the internal surface (B); rough papillae at the internal surface (C). mp, mantle pore; ov, ovary.
A rounded visceral sac was attached to the internal dorsal surface between mantle pores (Figure 3B). Receptacles were absent. In the virgin externa (2.0/1.5 mm), the mantle cavity was empty. Ovarian tubules were closely filled with vitellogenic oocytes with a diameter of 50–60 μm (Figure 4A). In the pre-ovigerous externa (3.2/3.0 mm), vitellogenic oocytes were 70–80 μm in size, the second generation of oocytes was not observed (Figure 4B). In this stage, oocytes were surrounded by numerous spermatogenic cells (Figure 4C). In the ovigerous externa (9.0/4.0 mm), spent ovary was small and almost empty, with some residual oocytes (Figure 4F). Regeneration of the ovary was not observed. Residual spermatogenic cells were not found in the ovary. In the ovigerous externa as well as in the immature one, a single colleteric gland was located in the posterior part of the visceral mass (Figure 4D–F). Mantle cavity was filled with developing embryos and early larvae of 100–120 μm in length (Figure 4G). Male sex cells in the mantle cavity were not found. Sylon hippolytes undoubtedly produces only one larval generation.
Longitudinal sections of the externa of Sylon hippolytes. Virgin externa (A); pre-ovigerous externa (B); spermatogenic cells in the ovary of pre-ovigerous externa (C); colleteric gland in virgin externa (D); colleteric gland in pre-ovigerous externa (E); ovary and colleteric gland in ovigerous externa (F); larvae in ovigerous externa (G). cg, colleteric gland; m, mantle; mc, mantle cavity; ov, ovary; sc, spermatogenic cells.
Short description of the larva
The cypris larvae were 156.3 ± 5.6 µm in length. The carapace surface was smooth and covered with rare long setae (Figure 5A). The frontolateral horn glands and the frontal filaments were lacking. Five pairs of lattice organs (LO, two anterior and three posterior) were placed on the dorsal carapace surface, along hinge line (Figure 5B, C). All LO looked like porefields without terminal pores. Lattice organs 1 and 3–5 were ovoid, but slightly elongated (Figure 5D–G). LO2 were extremely elongated and directed towards the lateral edge of the carapace (Figure 5B). The large pores were located near LO1, LO2 and LO4 (Figure 5B–D, F).
Carapace of cypris larvae of Sylon hippolytes. Lateral view (A); anterior lattice organs (B); posterior lattice organs (C); LO1 (D); LO3 (E); LO4 (F); LO5 (G). po, pore; 1–5, lattice organs.
The antennule of cypris larva consisted of four segments (Figure 6A). A postaxial sensory seta and a breakage zone on the second segment were lacking. The third segment formed an attachment disc, covered with cuticular villi (Figure 6B). The perimeter of the disc was bordered with a small cuticular skirt (Figure 6C). A spinous process was located at the front margin (Figure 6B, D). An axial seta was placed in the middle of the attachment disk (Figure 6C). The large male aesthetasc and subterminal aesthetasc were absent. The fourth segment terminated into two long filamentous processes, united in the proximal part (Figure 6A, inset).
Antennule of cypris larvae of Sylon hippolytes. Antennule (A); attachment disc (B); third segment (C); spinous process (D). as, axial sensory seta; fp, filamentous process; sk, skirt; sp, spinous process; 2–4, antennular segments.
Discussion
Parasite
Phylogenetic reconstruction confirmed the belonging of our specimens to the monophyletic clade of S. hippolytes with genetic distances between subclades from 6.96 to 8.4% which showed the high intraspecific variability. Previously published data showed that typical genetic distances between different rhizocephalan species ranged from 10 to 38% COI (Noever et al., Reference Noever, Olson and Glenner2016; Korn et al., Reference Korn, Golubinskaya, Rees, Glenner and Høeg2020b, Reference Korn, Golubinskaya, Rees, Glenner and Høeg2021, Reference Korn, Golubinskaya, Sharina, Noever and Glenner2024; Golubinskaya et al., Reference Golubinskaya, Korn, Sharina and Miroliubov2021a, Reference Golubinskaya, Korn, Sharina and Selin2021b). Minimal distance (10% COI) was found between Peltogaster reticulata Shiino, 1943 and P. postica Yoshida & Osawa, 2011 (Korn et al., Reference Korn, Golubinskaya and Sharina2020a); however, these species are distinguished by the structure of the external cuticle and the arrangement of the colleteric glands (Yoshida et al., Reference Yoshida, Osawa, Hirose and Hirose2011). Two pairs of cryptic species, Briarosaccus regalis Noever, Olson & Glenner, 2016 and B. auratum Noever, Olson & Glenner, 2016 (Noever et al., Reference Noever, Olson and Glenner2016), B. tenellus Boschma, 1970 and B. hoegi (Korn et al., Reference Korn, Golubinskaya, Sharina, Noever and Glenner2024) had genetic distances 11.6 and 14.6%, respectively.
Current data has not confirmed yet that S. hippolytes comprises several cryptic species. High values of intraspecific distances in S. hippolytes from different areas may point to cryptic speciation within this rhizocephalan (Lefébure et al., Reference Lefébure, Douady, Gouy and Gibert2006; Costa et al., Reference Costa, deWaard, Boutillier, Ratnasingham, Dooh, Hajibabaei and Hebert2007; Radulovici et al., Reference Radulovici, Sainte-Marie and Dufresne2009; Bartilotti et al., Reference Bartilotti, Salabert and Dos Santos2016). However, only a small number of populations of S. hippolytes have been analyzed genetically. More extensive sampling across its geographic range is required to conclude about the entire species complex.
Usually, S. hippolytes is attached to the abdomen of the host shrimp, while in Dichelopandalus bonnieri Caullery, 1896, it was atypically found in the right branchial cavity (Lange and Båmstedt, Reference Lange and Båmstedt1999). The morphology of S. hippolytes parasitized Spirontocaris liljeborgii (Danielssen, 1859) from Norway was described by Lützen (Reference Lützen1981) and Høeg and Lützen (Reference Høeg and Lützen1985). We have not found significant differences of our material with the exception of that the oviducal gland of S. hippolytes from S. liljeborgii was totally degenerated in the ovigerous externa (Lützen, Reference Lützen1981). We have found the oviducal glands in all examined specimens of Sylon parasitizing Heptacarpus.
In the fertilized externa, a cluster of cuboidal cells is observed at the point of attachment of the ovary to mantle wall. Boschma (Reference Boshma1928) and Lützen (Reference Lützen1981) designated this structure as the “ganglion.” However, Bower and Boutillier (Reference Bower, Boutillier, Perkins and Cheng1990) believed that the similarity between the cuboidal cells within this structure and the spermatogonia is noteworthy. The solution to this issue is possible only with the use of ultrastructural methods.
Cuticle of S. hippolytes was never described as well as the cuticle of other akentrogonid-type rhizocephalans. It seems simpler in structure compared to that of kentrogonid-type species. We have not found retinacula at the inner cuticular surface.
Except for Mycetomorpha vancouverensis Potts, 1912, aesthetascs have been secondarily lost in cyprids of akentrogonid-type rhizocephalans, and there are no other morphological means for separating the male and female settling stage. In cyprids of S. hippolytes, M. vancouverensis, Clistosaccus paguri, and Thompsonia sp. the long and slender antennules are probably used in penetration without formation of a kentrogon (Glenner et al., Reference Glenner, Høeg, Klysner and Brodin Larsen1989).
It is known that the outline of the body, general morphology and the detailed antennular structure of S. hippolytes are almost identical to those of C. paguri (Glenner et al., Reference Glenner, Høeg, Klysner and Brodin Larsen1989, Reference Glenner, Høeg, Stenderup and Rybakov2010; Jensen et al., Reference Jensen, Høeg, Bower and Rybakov1994a). Cyprids found in mantle cavity of S. hippolytes from the Kuril Islands differ slightly from cyprids of C. paguri. In C. paguri, LO1 and LO3–LO5 are ovoid (Jensen et al., Reference Jensen, Moyse, Høeg and Al-Yahya1994b), but in S. hippolytes, they are more elongated. In C. paguri, small pores of an individual porefield are arranged in concentric rings (Jensen et al., Reference Jensen, Moyse, Høeg and Al-Yahya1994b), while in S. hippolytes, they form transversal or longitudinal lines. The presence of spinous process at the attachment disc of S. hippolytes has previously been questioned (Glenner et al., Reference Glenner, Høeg, Klysner and Brodin Larsen1989), but later this structure was clearly visualized (Glenner et al., Reference Glenner, Høeg, Stenderup and Rybakov2010). Authors also believed that long setae at the attachment disc of S. hippolytes are more likely the cuticular villi (Glenner et al., Reference Glenner, Høeg, Stenderup and Rybakov2010). In our material, axial seta is considerably longer than cuticular villi and looks like the same setae in the cyprids of Peltogaster reticulata, P. lineata Shiino, 1943, and Briarosaccus hoegi (Golubinskaya et al., Reference Golubinskaya, Korn, Sharina and Miroliubov2021a; Korn et al., Reference Korn, Golubinskaya and Sharina2020a, Reference Korn, Golubinskaya, Sharina, Noever and Glenner2024).
In total, we have not found the differences between our and previously descriptions of S. hippolytes larvae. Thus, the larval investigations also revealed that rhizocephalan from the Kuril Islands is most likely not a new species.
Host
Sylon hippolytes is distributed mainly in North Atlantic and North Pacific, found also in the northern Japan. Oslofjord (southern Norway) is a type locality of this species (Lützen, Reference Lützen1981). Depth amplitude is 9–875 m (Høeg and Lützen, Reference Høeg and Lützen1985; Høeg and Rybakov, Reference Høeg and Rybakov1992). Until now, 23 hosts of S. hippolytes belonging to three families were known (Table 1). In the Russian Far East, only Pandalus borealis Krøyer, 1838 parasitized by S. hippolytes was found in the northern part of the Sea of Okhotsk (Poltev and Luchenkov, Reference Poltev and Luchenkov2020).
Hosts of Sylon hippolytes
According to morphological characters, found shrimps belong to the genus Heptacarpus (Caridea: Thoridae). Only one species from this genus parasitized by S. hippolytes was known today. It is H. brevirostris (Dana, 1852) from British Columbia (Butler, Reference Butler1980).
The examined shrimps are similar to the deep-sea H. maxillipes (Rathbun, 1902) by colour and the structure of appendages (Komai, Reference Komai1993; Komai and Ivanov, Reference Komai and Ivanov2008; Komai and Komatsu, Reference Komai, Komatsu and Fujita2009). Unfortunately, there is insufficient genetic data on species of the genus Heptacarpus. Of the 35 known species, COI sequences of only 11 species are deposited in GenBank. COI sequences of H. maxillipes are also missing. Therefore, we tentatively identified examined host as H. maxillipes. It is a bathyal species, occurring along the Kuril and Aleutian Islands and also along Pacific coast of the northern Japan, at the depth of 280–1580 m (Komai, Reference Komai1993; Komai and Komatsu, Reference Komai, Komatsu and Fujita2009). Heptacarpus maxillipes was recorded from the Aleutian Islands at depths from 418 to 1144 m by Rathbun (Reference Rathbun1904), and subsequently from the Pacific side of Kuril Islands at depths from 280 to 1580 m by Birshtein and Zarenkov (Reference Birshtein and Zarenkov1970). It was in this area that we found infected shrimps.
The phylogenetic tree for the S. hippolytes hosts showed the absence of monophyly for many of genera. These results correspond with previously published data, demonstrated paraphyly in some families (for example, Hippolytidae – Li et al., Reference Li, De Grave, Chan, Lei and Chu2011; Sun et al., Reference Sun, Liu, Chen, Li, Ye and Xu2024), and genera (for example, Eualus – Costa et al., Reference Costa, deWaard, Boutillier, Ratnasingham, Dooh, Hajibabaei and Hebert2007; De Grave et al., Reference De Grave, Li, Tsang, Chu and Chan2014; Bartilotti et al., Reference Bartilotti, Salabert and Dos Santos2016). On the phylogenetic tree for the host genera, the genus Heptacarpus is also not monophyletic, but the distance between our H. maxillipes and congeneric H. tenuissimus, corresponds to intragenic distances for the family Thoridae (Wang et al., Reference Wang, Zhongli and Sun2023) and other Decapoda (Brandão et al., Reference Brandão, Freire and Burton2016). Further molecular examination of numerous shrimps of the genus Heptacarpus is necessary to identify the host without a doubt.
Rhizocephalans are known as parasitic castrators of brachyuran crabs and usually prevent hosts from reproduction (Høeg, Reference Høeg1995). At the same time, it was shown that within the akentrogonid-type rhizocephalans host control may be at times somewhat relaxed. Such hosts can continue to reproduce with a reduced clutch size (Korn et al., Reference Korn, Golubinskaya, Rees, Glenner and Høeg2020b). Shrimps parasitized by Sylon as a rule are sterilized. It was shown that different female hosts of S. hippolytes are never ovigerous (Butler, Reference Butler1980). However, nine ovigerous females of Pandalus platyceros infected by S. hippolytes at all stages of development were found (Lützen, Reference Lützen1981). Only one female of Dichelopandalus bonnieri carrying numerous own embryos was parasitized by Sylon (Høeg and Lützen, Reference Høeg and Lützen1985). In our material, no one infected H. maxillipes female had the own eggs.
Most research on rhizocephalan effects on hosts focuses on brachyurans and less often on anomurans, with relatively little study on shrimp hosts. In most cases, host feminization by rhizocephalans has been studied in decapods with gonochoric sexual development. At the same time, some shrimps, particularly of the genus Pandalus, are protandrous hermaphrodites, developing first into males and transitioning to females through development (Yoshioka et al., Reference Yoshioka, Brown, Treneman, Schram and Galloway2024). Therefore, it is much more difficult to obtain data on the sex ratio in the population and morphological changes in parasitized shrimps.
Through histological studies, Lützen (Reference Lützen1981) and Bower and Boutillier (Reference Bower, Boutillier, Perkins and Cheng1990) described sterilization in the shrimps Spirontocaris liljeborgii and Pandalus platyceros, infected by S. hippolytes, with both finding impacted oocyte development and altered secondary sex characters. Lützen (Reference Lützen1981) observed two infected males of S. liljeborgii with morphologies of pleopod 1 between those of normal male and ovigerous female shrimp. However, an analysis of infected and uninfected shrimps did not reveal a clear connection between infection and host size. Yoshioka et al., (Reference Yoshioka, Brown, Treneman, Schram and Galloway2024) reported that infected P. danae Stimpson, 1857 develop transitional or female sex characters at smaller sizes. Infection by Sylon was also associated with greater probability of epibiosis.
The broadened abdomen in brachyuran females provides better protection for parasitic externa compared to the narrow abdomen in male hosts, and, therefore, most rhizocephalans prefer female crabs, although other variants also exist (Golubinskaya et al., Reference Golubinskaya, Korn and Selin2022). For caridean hosts, such dependence is not obvious. The majority of examined Pandalus borealis and Spirontocaris liljeborgii parasitized by S. hippolytes were females (Lützen, Reference Lützen1981; Lützen and Nagasawa, Reference Lützen and Nagasawa1992; Poltev and Luchenkov, Reference Poltev and Luchenkov2020). However, from 575 examined P. danae, 72.8% were males, 13.0% transitional specimens, and 13.4% females (Yoshioka et al., Reference Yoshioka, Brown, Treneman, Schram and Galloway2024). In our material, from ten infected Heptacarpus specimens only one male was found.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0025315425100982.
Author contributions
ASM collected the material. SNS performed the molecular analysis. OMK and DDG studied morphological characters and wrote the draft manuscript. DDG performed all illustrations. All authors read and approved the manuscript.
Competing interest
The authors declare none.
Ethical standards
All applicable international, national, and/or institutional guidelines for the care and use of animals were followed by the authors.
Data availability
The datasets generated during and/or analyzed during the current study are available from the corresponding author on request.
