Introduction
Plant-parasitic nematodes (PPNs) of the family Longidoridae pose a persistent and significant threat to global agriculture. This family, belonging to the order Dorylaimida, comprises obligate ectoparasites that are among the most economically important nematode groups in agriculture (Coomans Reference Coomans1996; Jairajpuri and Ahmad Reference Jairajpuri and Ahmad1992). Their economic importance stems not only from direct root damage but also from their role as vectors of nepoviruses, which can cause devastating crop losses (Decraemer and Bert Reference Decraemer and Bert2025; Taylor and Brown Reference Taylor and Brown1997). However, this vector capacity is confirmed for only a small proportion of species within the genus. For instance, key vector species such as Longidorus elongatus, L. attenuatus, and L. apulus are among approximately 11 species (about 6.9%) documented to transmit specific nepoviruses like tomato black ring virus and raspberry ringspot virus (Brown et al Reference Brown, Lamberti, Taylor and Trudgill1988; Decraemer and Bert Reference Decraemer and Bert2025; Taylor and Brown Reference Taylor and Brown1997 ).
Among longidorids, the genus Longidorus (needle nematodes) is a highly diverse and cosmopolitan group, with over 190 species described worldwide (Cai et al Reference Cai, Gu, Ye, Ma and Liu2024; Clavero-Camacho et al Reference Clavero-Camacho, Liébanas, Escuer, Cantalapiedra-Navarrete, Archidona-Yuste, Castillo and Palomares-Rius2021). These nematodes complete their life cycle in the rhizosphere, using their long stylet to feed on root tips, which can lead to gall formation and arrested root growth (Taylor and Brown Reference Taylor and Brown1997). The disparity between the large number of described species and the relatively few known virus vectors poses a major challenge for accurate species identification. This challenge is compounded by morphological convergence and the frequent occurrence of cryptic species, which make accurate identification based on morphology alone particularly difficult (Archidona-Yuste et al Reference Archidona-Yuste, Cantalapiedra-Navarrete, Castillo and Palomares-Rius2019; Gutiérrez-Gutiérrez et al Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013).
Correctly identifying species is therefore crucial, not just for scientific reasons, but for practical nematode management and accurate pest risk assessment. This is especially important for distinguishing virus-transmitting species like L. elongatus and L. attenuatus from closely related non-vector taxa (Brown et al Reference Brown, Lamberti, Taylor and Trudgill1988). These difficulties are often exacerbated by high phenotypic plasticity, leading to wide morphometric variation within a single species, and by the common occurrence of only juvenile stages in soil samples, which lack definitive adult characters. To overcome these limitations, modern nematode taxonomy increasingly relies on an integrative approach that combines detailed morphological analyses with molecular characterisation (Palomares-Rius et al Reference Palomares-Rius, Cantalapiedra-Navarrete and Castillo2014). In particular, DNA barcoding and phylogenetic analysis using multiple genetic markers have become indispensable tools for refining species delimitation and validating morphological diagnoses (Banihashemian et al Reference Banihashemian, Jamali, Golmohammadi and Ghasemnejad2023). This combined approach has been very successful for defining species boundaries, untangling species complexes, and finding hidden diversity. It relies heavily on analysing specific DNA regions, such as ribosomal genes (D2–D3 of 28S, ITS1, 18S) and the mitochondrial COI gene (Cai et al Reference Cai, Archidona-Yuste, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2020a; Gutiérrez-Gutiérrez et al Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013).
Iran is an important area for studying Longidorus diversity, with a rich fauna of more than 20 recorded species and continuous reports of new species from different environments (Asgari et al Reference Asgari, Eskandari, Castillo and Palomares-Rius2022 , Reference Asgari, Eskandari, Castillo and Palomares-Rius2023; Fekrat et al Reference Fekrat, Ghaderi, Pourjam, Castillo and Pedram2024; Jahanshahi Afshar Reference Jahanshahi Afshar2025; Monemi et al Reference Monemi, Behdani, Mahdikhani-Moghadam, Amirzadi, Atighi, Ye, Jahanshahi Afshar and Pedram2024 ). However, despite this progress, the nematode biodiversity in many natural areas, like the regions of northern Iran, is still not well known. In a survey conducted in 2025, we examined the soil around native plants in Guilan province and found Longidorus populations living on the roots of Astragalus spp. These nematodes showed a combination of morphological features that were different from all other known species in the genus.
Based on this discovery, we hypothesised that these populations represent a previously undescribed species. To test this hypothesis and to precisely define its taxonomic status, we conducted an integrative taxonomic study with the following objectives: (i) to provide a comprehensive morphological and morphometric characterisation of the populations; (ii) to obtain and analyse sequence data from four genomic loci (LSU D2–D3, SSU, ITS1, COI); and (iii) to reconstruct a robust multilocus phylogeny to determine its evolutionary relationships within Longidorus. Herein, we describe these nematodes as Longidorus parasabalanicus sp. nov., thereby contributing to a more accurate inventory of biodiversity and to a refined taxonomic framework for the identification of these economically important pathogens.
Materials and methods
Nematode sampling and extraction
During the summer of 2025, 30 soil samples were collected from the rhizosphere of different plants in various natural habitats of Guilan province, northern Iran. Samples were taken around the plant roots at a depth of 5–30 cm. Nematodes were extracted using the tray method (Whitehead and Hemming Reference Whitehead and Hemming1965) and the magnesium sulphate (MgSO4) centrifugal flotation method (Coolen Reference Coolen, Lamberti and Taylor1979), and a modification of Cobb’s decanting and sieving method (Flegg Reference Flegg1967).
Morphological characterisation and morphometrics
For microscopic examination, nematode specimens were hand-picked from the suspension under a stereomicroscope (Nikon, SMZ800), heat-killed using a fixative solution (4:1:1, formaldehyde: propionic acid: glycerin), and processed to anhydrous glycerin according to the method of De Grisse (Reference De Grisse1969). Finally, permanent slides were prepared by mounting the specimens and sealing them with paraffin wax rings. Morphological observations, measurements, and line drawings were obtained using a drawing tube attached to a Leitz Dialux 22 light microscope. Digital photomicrographs were captured with an Olympus DP23 digital camera (Olympus, Tokyo, Japan) mounted on a Nikon Eclipse NiU light microscope (Nikon, Tokyo, Japan) equipped with differential interference contrast (DIC). Final illustrations were digitally prepared using CorelDRAW software (v. 16, Corel Corp., Canada) or Adobe® Photoshop® CS (Adobe Systems, San Jose, CA, USA). Morphological comparisons were performed using the polytomous identification keys for Longidorus species (Chen et al Reference Chen, Hooper, Loof and Xu1997; Loof and Chen Reference Loof and Chen1999) and by comparison with the descriptions of all other characterised species available to date. The position of pharyngeal gland nuclei was calculated according to Loof and Coomans (Reference Loof and Coomans1972) and the juvenile developmental stages were identified according to Robbins et al (Reference Robbins, Brown, Halbrendt and Vrain1995). All measurements were recorded in micrometres (μm), except for body length, which was expressed in millimetres (mm), and standard morphometric ratios.
Molecular characterisation
Morphological observations and molecular analyses were conducted in parallel to ensure accurate species identification through an integrative taxonomic approach. For the molecular phylogenetic studies, two live nematode specimens were individually selected. DNA was extracted using the modified Chelex method (Rashidifard et al Reference Rashidifard, Marais, Daneel, Mienie and Fourie2019). Each nematode was transferred to an Eppendorf tube containing 20 μL of nuclease-free water, 25 μL of Chelex (5%, w/v), and 5 μL of proteinase K (20 mg/mL). The microtubes were incubated at 56°C for 2 h, then at 95°C for 10 min, and the obtained solutions were used as DNA templates. Five μL of each extracted DNA sample was added to the polymerase chain reaction (PCR) mixture in a 0.2 mL Eppendorf tube containing 15 μL of 2× Master mix (Ampliqon, Odense, Denmark), 1 μL of each primer (10 pmol/μL), and 8 μL of ddH2O, to a final volume of 30 μL.
The D2–D3 expansion segments of the 28S rDNA (LSU) were amplified using forward D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCGGAAGGAACCAGCTACTA–3′) primers (De Ley et al Reference De Ley, Felix, Frisse, Nadler, Sternberg and Thomas1999). The partial 18S rDNA (SSU) was amplified as two overlapping fragments, using forward 988F (5′–CTCAAAGATTAAGCCATGC–3′) and reverse 1912R (5′–TTTACGGTCAGAACTAGGG–3′) primers for the first fragment, and forward 1813F (5′–CTGCGTGAGAGGTGAAAT–3′) and reverse 2646R (5′–GCTACCTTGTTACGACTTTT–3′) primers for the second fragment (Holterman et al Reference Holterman, van der Wurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006). The internal transcribed spacer region separating the 18S rDNA and 5.8S rDNA (ITS1) was amplified using forward primer 18S (5′–TTGATTACGTCCCTGCCCTTT–3′) (Vrain et al Reference Vrain, Wakarchuk, Levesque and Hamilton1992) and reverse primer rDNA1 (5′–ACGAGCCGAGTGATCCACCG–3′) (Gutiérrez-Gutiérrez et al Reference Gutiérrez-Gutiérrez, Palomares-Rius, Cantalapiedra-Navarrete, Landa, Esmenjaud and Castillo2010). The partial cytochrome c oxidase subunit I of the mtDNA (COI) was amplified using forward primer JB3 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) and reverse primer JB5 (5′–AGCACCTAAACTTAAAACATAATGAAAATG–3′) (Bowles et al Reference Bowles, Blair and McManus1992). PCR reactions were carried out in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK). The PCR cycle conditions were as follows: initial denaturation cycle at 94°C for 15 min, followed by 35 cycles of denaturation at 94°C for 45 s; annealing cycle at 56°C (LSU), 55°C (ITS1), or 54°C (SSU and COI) for 45 s; extension cycle at 72°C for 1 min, and finally elongation cycle at 72°C for 5 min. After DNA amplification, the quality of PCR was checked by electrophoresis of 4 μL of the PCR products on a 1% agarose gel containing SYBR Green I. Products were visualised and photographed under ultraviolet light. The length and concentration of each PCR product were measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR products were purified and sequenced directly in both directions using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences were submitted to the GenBank database under these accession numbers: partial 18S rDNA (PX766315); D2–D3 expansion segments of the 28S rDNA (PX703671–PX703672); ITS1 region (PX776836); and COI (PX801049).
Phylogenetic analyses
The newly generated sequences (LSU, SSU, COI, and ITS1) were subjected to BLASTn homology searches against the GenBank database to identify closely related species. Phylogenetic trees were reconstructed for each gene using sequences from various Longidorus species retrieved from GenBank, together with the sequences obtained in this study. Outgroup taxa for the individual datasets were selected according to established phylogenetic trees in previous studies (Archidona-Yuste et al Reference Archidona-Yuste, Cantalapiedra-Navarrete, Castillo and Palomares-Rius2019; Asgari et al Reference Asgari, Eskandari, Castillo and Palomares-Rius2022, Reference Asgari, Eskandari, Castillo and Palomares-Rius2023; Cai et al Reference Cai, Archidona-Yuste, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2020a, Reference Cai, Prior, Lawson, Cantalapiedra-Navarrete, Palomares-Rius, Castillo and Archidona-Yusteb; Gutiérrez-Gutiérrez et al Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013; He et al Reference He, Subbotin, Rubtsova, Lamberti, Brown and Moens2005; Holterman et al Reference Holterman, van der Wurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006; Palomares-Rius et al Reference Palomares-Rius, Subbotin, Landa, Vovlas and Castillo2008; Salazar-García et al Reference Salazar-García, Palomares-Rius, Bajoub, Ajal, Ouled-Bouallala, Cantalapiedra-Navarrete, Castillo and Archidona-Yuste2025). Multiple sequence alignments for each gene were made using the FFT-NS-2 algorithm of MAFFT v. 7.450 (Katoh et al Reference Katoh, Rozewicki and Yamada2019) (http://mafft.cbrc.jp/alignment/server/). The BioEdit program v. 7.2.5 (Hall Reference Hall1999) was used for sequence alignment visualisation and the manual editing and trimming of the poorly aligned positions using a light filtering strategy (up to 20% of alignment positions). The best-fit model of DNA evolution, including base frequency, the proportion of invariable sites, and the gamma distribution shape parameters and substitution rates for each of the four datasets, was obtained by jModelTest version 2.1.7 (Darriba et al Reference Darriba, Taboada, Doallo and Posada2012) using the Akaike information criterion (AIC) and used in the phylogenetic analyses. A general time-reversible model incorporating a proportion of invariable sites and a gamma-distributed rate variation among sites (GTR + I + G) was used in phylogenetic analyses of LSU D2–D3, SSU, and COI datasets, whereas a general time-reversible model, with the addition of a gamma-distributed rate variation among sites (GTR + G), was used in phylogenetic analyses of the ITS1 dataset. Phylogenetic analyses of the sequence datasets were performed based on Bayesian inference (BI) using MrBayes 3.1.2 (Ronquist and Huelsenbeck Reference Ronquist and Huelsenbeck2003) by selecting a random starting tree and running the chains for 10×106 generations (SSU, ITS1, and COI) and 5×106 generations (LSU D2–D3). The Markov chains were sampled at intervals of 100 generations, with 25% of the converged runs regarded as ‘burn-in’. A 50% majority rule consensus tree was generated, and posterior probabilities (PP) were calculated for each clade using the Markov chain Monte Carlo (MCMC) method within a Bayesian framework (Larget and Simon Reference Larget and Simon1999). Trees from all analyses were visualised using FigTree software version 1.4.4 (Rambaut Reference Rambaut2018) and were digitally drawn in CorelDRAW software version 16.
Results
Thirty soil samples were examined during the survey. Only one sample (3.3%), collected from the rhizosphere of Astragalus spp. in Deylaman, Guilan Province, was positive for Longidorus. The remaining samples contained other plant-parasitic nematodes, predominantly species of Xiphinema, which were outside the scope of the present study. Based on the integration of morphological, morphometric, and molecular data, this population is herein described as Longidorus parasabalanicus sp. nov.
Longidorus parasabalanicus sp. nov.
ZooBank: urn:lsid:zoobank.org:pub:5FECDDDC-F0C9-4789-BEC0-432679DD86B9
Description
Line drawings of Longidorus parasabalanicus sp. nov. A–B: Female anterior region. C: Female reproductive system. D–E: Female posterior body region. F: Anterior end showing amphidial fovea. G: Female whole body. H: Male whole body. I: Male posterior body region. J: J1 tail. K: J2 tail. L: J3 tail. M: J4 tail. (Scale bars: A–E, E–K, I = 20 μm; F, J–M = 10 μm; G–H: 200 μm).
Figure 1. Long description
A multi-panel line drawing of nematode morphology.
* Panel A and B: Female anterior regions showing the long, needle-like odontostyle and the basal bulb of the esophagus.
* Panel C: Female reproductive system illustrating the vulva opening and the tubular uterus with internal cellular structures.
* Panel D and E: Female posterior body regions showing a rounded, bluntly conoid tail shape with visible cuticle layers.
* Panel F: High-magnification view of the anterior end highlighting the stirrup-shaped amphidial fovea.
* Panel G and H: Whole-body silhouettes of a female and male respectively, both showing a C-shaped or spiral curvature.
* Panel I: Male posterior region featuring the spicules and ventromedian supplements.
* Panels J, K, L, and M: Tail morphologies for juvenile stages J 1, J 2, J 3, and J 4. The J 1 tail in panel J is the most elongated and pointed, while subsequent stages K through M show a progressive shortening and rounding of the tail tip.
Scale bars are provided for each panel: 20 micrometers for A through E and I; 10 micrometers for F and J through M; and 200 micrometers for the whole-body views G and H.
Photomicrographs of Longidorus parasabalanicus sp. nov. A: Female entire body. B, C, H: Anterior body region. D, E: Pharyngeal region. F: Pharyngeal expansion. G: Male entire body. I: Vagina and uterus. J: Uterus and oviduct junction. K: Testes junction (showing in detail the sperm cells). L: Lateral chord. M: Vagina. N: Female posterior body region. O, S: Female tail. P: Male posterior body region. Q: Lateral guiding piece. R: Male tail and spicule. (Scale bars: A, G = 200 μm; B, F, H, J, M, L, O, Q, R, S = 10 μm; C–E, I, K, N, P = 20 μm).
Figure 2. Long description
A collection of 19 light microscopy panels labeled A through S.
* Panels A and G show the entire bodies of a female and male nematode respectively, both exhibiting a spiral or C-shaped posture. Scale bars are 200 micrometers.
* Panels B, C, D, and H provide close-ups of the anterior body region, highlighting the lip region and the odontostyle.
* Panels E and F show the pharyngeal region and pharyngeal expansion, revealing the muscular bulb structure.
* Panels I, J, and M focus on the female reproductive system, showing the vagina, uterus, and the junction between the uterus and oviduct.
* Panel K displays the testes junction in a male, with visible granular sperm cells.
* Panel L shows the lateral chord.
* Panels N, O, and S illustrate the female posterior region and tail, which is rounded and short.
* Panels P, Q, and R show the male posterior region, including the curved spicule, the lateral guiding piece, and the tail shape.
Scale bars for B, F, H, J, L, M, N, O, Q, R, and S represent 10 micrometers. Scale bars for C, D, I, K, N, and P represent 20 micrometers.
Photomicrographs of Longidorus parasabalanicus sp. nov. A–D: Tails of J1, J2, J3, and J4. (Scale bars: A–D = 5 μm).
Relationship between body length and functional and replacement odontostyle length in all developmental stages and mature adults of Longidorus parasabalanicus sp. nov.
Figure 4. Long description
A line graph with a horizontal x-axis representing Body length in m m, ranging from 0 to 6, and a vertical y-axis representing Odontostyle in micrometers, ranging from 0 to 100. A legend at the bottom identifies blue triangles as Functional Odontostyle and red circles as Replacement Odontostyle.
Data is grouped into five distinct clusters enclosed in dashed boxes, moving from left to right:
* J 1: Located between 1.2 and 1.5 m m on the x-axis. Functional odontostyles are clustered around 45 to 50 micrometers, while replacement odontostyles are slightly higher at 50 to 55 micrometers.
* J 2: Located between 1.6 and 2.1 m m. Functional odontostyles range from 50 to 58 micrometers. Replacement odontostyles range from 58 to 75 micrometers.
* J 3: Located between 2.3 and 2.9 m m. Functional odontostyles range from 58 to 65 micrometers. Replacement odontostyles range from 68 to 78 micrometers.
* J 4: Located between 3.1 and 4.0 m m. Functional odontostyles are between 68 and 75 micrometers. Replacement odontostyles are between 78 and 85 micrometers.
* Adults: Located between 4.0 and 5.3 m m. This group contains only functional odontostyles, which form a dense horizontal cluster between 75 and 85 micrometers.
The overall trend shows a stepwise linear increase in both functional and replacement odontostyle lengths as the body length increases through the juvenile stages, with the replacement odontostyle of one stage roughly matching the functional odontostyle of the subsequent stage.
Morphometrics of Longidorus parasabalanicus sp. nov. All measurements are in μm (except L, in mm), and in the form: mean ± S.D. (range)
Table 1. Long description
A collection of 11 anatomical line drawings labeled A through K.
* Panel A: Anterior region of a female showing the lip region, odontostyle, and guiding ring.
* Panel B: Detail of the female lip region showing the amphidial pouch.
* Panel C: Female pharyngeal bulb showing the arrangement of esophageal glands.
* Panel D: Female mid-body section showing the vulva and symmetrical genital branches.
* Panel E: Female tail region showing a rounded, hemispherical shape and the rectum.
* Panel F: Male tail region showing the spicules, gubernaculum, and ventromedian supplements.
* Panel G: Male posterior region showing the arrangement of the copulatory apparatus.
* Panels H, I, J, and K: Tail shapes of juvenile stages J 1, J 2, J 3, and J 4 respectively, showing the progression from a more elongate-conoid shape in J 1 to a rounded shape in J 4.
Abbreviations: a = body length/greatest body diameter; b = body length/distance from anterior end to pharyngo-intestinal junction; c = body length/tail length; c’ = tail length/tail diameter at anus or cloaca; L = overall body length; m = length of conus as percentage of total stylet length; n = number of specimens on which measurements are based; T = distance from cloacal aperture to anterior end of testis expressed as percentage (%) of the body length; V = distance from body anterior end to vulva expressed as percentage (%) of the body length.
Female. Body moderately slender, gradually narrowing towards both ends, assuming a G shape when relaxed. Cuticle finely striated under a light microscope, 3–4 μm thick at guiding ring level, 2.5–3.5 μm at mid-body, 3.5–5.0 μm at the anterior lip of the anus, and 14.0–19.0 μm at the tail end (the hyaline part of tail tip), and marked by very fine superficial transverse striae mainly in tail region. Lateral chords 14.0–21.0 μm wide at mid-body, occupying 24–32% of the corresponding body width. Lip region anteriorly flattened, laterally rounded, 12.5–14.0 μm wide and 3.0–4.0 μm high, either continuous with the body contour or slightly offset by a shallow depression. Amphidial pouches pocket-shaped without lobes at base. Guiding ring located 2.3 ± 0.2 (2.0–2.5) times lip region diameter from anterior end. Odontostyle long and narrow, approximately 1.3–1.6 times as long as odontophore; odontophore weakly developed, with slight basal muscular swellings. Nerve ring surrounding the slender portion of the pharynx behind the odontophore base, located at 161–185 μm from anterior end. Pharynx dorylaimoid, anterior slender part flexible, posteriorly expanding to a muscular terminal pharyngeal bulb occupying about 23.5 ± 1.3 (21.9–26.3)% of the total pharynx (neck region). The dorsal gland nucleus (DN) is smaller, at 20.0–30.9%, and the two ventrosublateral nuclei (SVN) are at about the same level and at 46.5–61.9% of the pharyngeal bulb length. Glandularium 98.8 ± 5.7 (90–108.0) μm long. Cardia conoid to rounded, 7.0–9.0 μm long. Intestine simple. The reproductive system didelphic–amphidelphic, with both branches almost equally developed, each branch 320–600 μm long, with reflexed ovaries very variable in length, anterior ovary (58–150 μm long) and posterior ovary (54–134 μm long). Oviducts slightly longer than ovaries, consisting of a distal, slender section made of prismatic cells and a well-developed pars dilatate with a distinct lumen and usually sperm cells. Uterus is an apparently simple tube-like structure, quite variable in length; anterior uteri are 156–327 μm long and posterior uteri are 140–289 μm long and usually contain abundant sperm cells. A narrowed region surrounded by a muscular ring (sphincter) separates the oviduct and uterus. Vulva appearing as a transverse slit positioned around the middle of the body. Vagina is oriented perpendicular to the body axis and measures 36–46 μm long, or ca 66% of the corresponding body width, and is surrounded by well-developed muscles; pars proximalis vaginae measures 18–26 μm long, and pars distalis 12–21 μm long. Prerectum is variable in length, being 5.2–9.8 times longer than the anal body width, and the rectum is simple, 0.5–0.8 times as long as tail length. Tail short, conoid, dorsally convex, ventrally almost straight or slightly concave with rounded terminus, with distinct radial lines in hyaline region, and presenting two pairs of caudal pores.
Male. Common and functional, equal to females in number. General morphology similar to female except for reproductive structures. Genital system diorchic, with opposed testes, containing multiple rows of different stages of spermatogonia. Spicules arcuate, robust, about 1.5 times longer than tail length, lateral guiding pieces more or less straight. Adanal supplements paired, preceded anteriorly by a row of 8–10 irregularly spaced ventromedian supplements. Tail bluntly conoid, dorsally convex and ventrally concave, terminus widely rounded, and with distinct radial lines in hyaline region. Tail length almost equivalent to cloacal body width.
Juveniles. Morphologically similar to adults, but smaller. The four juvenile stages were distinguished based on body length and the relative length of the functional and replacement odontostyle (Figure 4). The first-stage juvenile (J1) has a relatively long, conoid tail, a c′ ratio between 2.6 and 3.0, and a functional odontostyle of 46–49 μm, which is 42% shorter than that of the adult (Figure 4). In J1, the tip of the replacement odontostyle is located near the base of the functional odontostyle. In contrast, in the three subsequent juvenile stages, the replacement odontostyle is positioned further away from the functional odontostyle.
Diagnosis and relationships
Longidorus parasabalanicus sp. nov. is characterised by a moderately long body, 4.0–5.1 mm; lip region anteriorly flattened, laterally rounded and separated from body contour by a shallow depression, 12.5–14.5 μm wide; amphidial fovea pocket-shaped, not bilobed and extending approximately halfway between the oral aperture and the guiding ring; moderately long odontostyle (75.0–84.0 μm), with guiding ring located at 27.0–33.0 μm from anterior end; vulva located at 50–56% of body length; female tail short and bluntly conoid (41.0–47.0 μm long, c = 89–113, c′ = 0.9–1.2), dorsally convex and ventrally almost straight to slightly concave, ending in a rounded terminus. Males with long spicules (68.0–80.0 μm) and 8–10 ventromedian supplements. The polytomous identification codes of the new species according to Chen et al (Reference Chen, Hooper, Loof and Xu1997) and Peneva et al (Reference Peneva, Lazarova, De Luca and Brown2013) are as follows: A23–B2-C3(2)-D3–E1-F2–G1(2)-H12–I2-J1–K6 (the value in parentheses is an exception).
Based on a combination of key morphological characters, including body size, odontostyle length, position of the guiding ring, lip region morphology, amphidial fovea structure, tail shape, and male characters, the new species is most closely related to Longidorus sabalanicus Asgari et al., Reference Asgari, Eskandari, Castillo and Palomares-Rius2022. Together with L. tabrizicus Niknam et al., Reference Niknam, Pedram, Ghahremani Nejad, Ye, Robbins and Tanha Maafi2010 and L. paratabrizicus Monemi et al., Reference Monemi, Behdani, Mahdikhani-Moghadam, Amirzadi, Atighi, Ye, Jahanshahi Afshar and Pedram2024, it forms a well-defined morphological species complex characterised by high similarity and partial overlap in diagnostic traits. Within this complex, L. parasabalanicus sp. nov. can be distinguished from its congeners by a consistent combination of morphometric and morphological characters. It is distinguished from L. sabalanicus by having longer spicules (68–80 vs. 60–68.5 μm), a smaller body in juvenile stages J1–J3 (1.2–1.4, 1.6–1.9 and 2.3–2.8 vs. 1.8, 2.2–2.8 and 3.2 mm, respectively), differences in the length of the functional odontostyle in juvenile stages J1–J3 (46–49, 51–57 and 57–66 μm vs. 54–60, 56–65 and 64–69 μm, respectively), differences in the length of the replacement odontostyle in juvenile stages J1–J3 (51–56, 55–66 and 66–77 μm vs. 63–67, 66–76 and 74–77 μm, respectively), and a different tail shape in J1 (slender conical, without a digitate or subdigitate terminus vs convex-conoid to conical with a distinctly digitate or subdigitate terminus). From L. tabrizicus it differs by having a longer odontostyle and odontophore (75.0–84.0 vs. 61.5–70.0 μm, and 50–58 vs. 43–54 μm, respectively), lower a ratio (59–89 vs. 81–135), longer spicules (68–80 vs. 36–49 μm), and higher oral aperture-guiding ring distance (27–33 vs. 19–27 μm). From L. paratabrizicus it differs by having a longer odontostyle (75–84 vs. 67–75), lower a ratio (59–89 vs. 124.5–167.7), lower female c ratio (89–113 vs. 129.7–146.7), longer spicules (68–80 vs. 37–46 μm), and higher oral aperture-guiding ring distance (27–33 vs. 20–24 μm).
The new species shows morphological affinities with a limited number of other Longidorus species, particularly L. behshahrensis Bakhshi Amrei et al., Reference Bakhshi Amrei, Peneva, Rakhshandehroo and Pedram2020, L. elongatus (de Man, Reference De Man1876) Micoletzky, Reference Micoletzky1922, L. breviannulatus Norton & Hoffmann Reference Norton and Hoffmann1975, and L. rotundicaudatus Jacobs & Heyns, Reference Jacobs and Heyns1987, whereas more distant relationships are observed with other members of the genus. However, detailed comparison with these taxa reveals clear morphological differences, supporting its separation from all known congeners. From L. behshahrensis, it can be mainly differentiated by a shorter body (4.0–5.1 vs. 6.8–8.4 mm), lower a and c ratios (59–89 vs. 97.2–157.9, and 89–113 vs. 132.1–205.4, respectively), and a wider lip region (12.5–14.5 vs. 9–10 μm). From L. elongatus, the new species differs mainly by having a slightly smaller body (4.0–5.1 vs. 4.5–6.4 mm), a different amphidial fovea shape (not bilobed vs slightly bilobed at base), and a shorter odontostyle (75–84 vs. 81–102 μm). From L. breviannulatus, it differs in having a different amphidial fovea shape (pocket-shaped, not bilobed vs symmetrically bilobed at base), higher oral aperture-guiding ring distance (27–33 vs 21–26 μm), a narrower lip region (12.0–14.5 vs. 16.0–20.0 μm) and a more posteriorly located vulva (50–56 vs. 43–50). It differs from L. rotundicaudatus by having a different amphidial fovea shape (not bilobed vs bilobed at base), lower oral aperture-guiding ring distance (27–33 vs 33–38 μm), lower a and c ratios (59–89 vs. 91–115, and 85–113 vs. 140–197, respectively), longer tail (41–56 vs. 23–37 μm) and longer spicules (68–80 vs. 49 μm).
Etymology
The specific epithet refers to the close relationship of the new species with Longidorus sabalanicus Asgari et al., Reference Asgari, Eskandari, Castillo and Palomares-Rius2022, based on both morphological similarities and phylogenetic placement in LSU and SSU rDNA trees (based on currently available data).
Type host and locality
The type population was collected from the rhizosphere of Astragalus spp. naturally growing in mountains of Deylaman, South Siahkal, Guilan province, northern Iran, coordinates: 36°55′03.1″N 49°54′59.0″E; altitude: 2000 m a.s.l.
Type material
Female holotype, four female paratypes, four male paratypes, and fifty-seven juvenile paratypes were deposited in the nematode collection at Citrus and Subtropical Fruits Research Center, Horticultural Science Research Institute, Mazandaran, Iran. Two female paratypes and two male paratypes were deposited in the nematode collection at Faculty of Agriculture, University of Zanjan, Zanjan, Iran. Four female paratypes and three male paratypes were deposited in the nematode collection of the Rey Juan Carlos University, Campus de Móstoles, Madrid, Spain.
Molecular characterisation and phylogenetic analyses
The amplification of D2–D3 expansion segments of 28S rDNA (~797 bp), ITS1 (~800 bp), partial 18S rDNA (~1737 bp), and mitochondrial COI (~399 bp) of L. parasabalanicus sp. nov. yielded single, clear PCR products. The newly obtained sequences were deposited in the GenBank database under these accession numbers: PX766315 (18S), PX703671–PX703672 (28S D2–D3), PX776836 (ITS1), and PX801049 (COI).
D2–D3 sequences obtained from two separate individuals were identical. BLAST analysis showed that the closest matches were all four currently available D2–D3 sequences of L. sabalanicus (MZ474667–MZ474670), with sequence identities of up to 95–96%. Pairwise comparison of the aligned D2–D3 sequences nevertheless revealed several fixed nucleotide differences between L. parasabalanicus sp. nov. and L. sabalanicus, supporting their recognition as separate species. Lower similarity values were observed with other Longidorus species, including L. soosanae (ON122993; 90%), L. elongatus (MN123748–MN123756; 90%), L. uroshis (EF538754; 89%), and L. intermedius (AY593058; 89%). Pairwise sequence divergence between L. parasabalanicus sp. nov. and these latter species ranged from 47 to 83 nucleotide substitutions and from 6 to 16 indels.
The partial 18S rDNA sequence of L. parasabalanicus sp. nov. showed high identity (98–99%) with several Longidorus species. The highest similarity was observed with L. sabalanicus (MZ474674; 99%), followed by L. elongatus (EU503141, AY687992; 98%), L. piceicola (AY687993; 98%), L. uroshis (EF538760; 98%), and L. attenuatus (MK301124–MK301125; 98%). These comparisons revealed 12–42 nucleotide differences and 10–12 indels.
A single COI sequence was obtained for L. parasabalanicus sp. nov. This sequence showed relatively low similarity with available Longidorus COI sequences, with identity values ranging from 76 to 79%. The highest similarity was recorded with L. tabernensis (MK937587, MK937588, MT040268; 79%), followed by L. distinctus (MW699614; 78%), L. iliturgiensis (MH454065; 78%), L. vineacola (KY816706; 78%), L. pini (MH454070; 77%), L. cretensis (KY816670; 77%), and L. helveticus (JN627416; 76%). Sequence divergence comprised 72–104 nucleotide differences and 2–4 indels.
An ITS1 sequence was also obtained for Longidorus parasabalanicus sp. nov. BLAST analysis showed the highest similarity with L. sabalanicus (MZ474672–MZ474673), with 77% sequence identity and 92% query coverage. Other Longidorus species showed only partial and poorly aligned ITS1 regions, resulting in substantially lower identity values (<46%), reflecting limited availability of homologous sequences and high variability of this marker within the genus. Due to the incomplete and poorly comparable nature of ITS1 alignments across available Longidorus species, this marker was not included in phylogenetic analyses.
The phylogenetic relationships between the newly identified needle nematode population and other Longidorus species were inferred using Bayesian inference based on the D2–D3 expansion segments of 28S rDNA, the partial 18S rDNA, and COI gene sequences. The resulting trees are presented in Figures 5, 6, and 7, respectively.
Phylogenetic relationships of Longidorus parasabalanicus sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from D2 and D3 expansion domains of 28S rRNA sequence alignment under the general time-reversible model of sequence evolution with correction for invariable sites and a gamma-shaped distribution (GTR + I + G). Posterior probabilities >0.50 are given for appropriate clades. Newly obtained sequences in this study are shown in bold. Scale bar = expected changes per site.
Figure 5. Long description
A rectangular cladogram showing evolutionary relationships. The tree is rooted on the left with outgroups Xiphinema index, Xiphinema cretense, and Tylencholaimus mirabilis at the bottom. Branch nodes are labeled with posterior probability values ranging from 0.50 to 1.00.
At the top of the tree, a large cluster includes species such as Longidorus iranicus, Longidorus moesicus, and Longidorus pauli.
In the upper-middle section, a specific clade is highlighted with a light red rectangular background. This clade contains the newly described species Longidorus parasabalanicus species novum, represented by bolded sequences P X 7 0 3 6 7 1 and P X 7 0 3 6 7 2. This species is shown as a sister taxon to a group containing Longidorus behshahrensis and Longidorus sabalanicus. Other species within this red-shaded clade include Longidorus piceicola, Longidorus intermedius, and Longidorus elongatus.
Below the highlighted section, the tree continues with clades containing Longidorus distinctus, Longidorus americanus, and Longidorus africanus.
The bottom section of the tree includes Longidorus pisi, Longidorus pinus, and Longidorus hangzhouensis.
A scale bar at the bottom indicates 0.04 expected changes per site.
Phylogenetic relationships of Longidorus parasabalanicus sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from 18S rRNA sequence alignment under the GTR + I + G model. Posterior probabilities >0.50 are given for appropriate clades. Newly obtained sequences in this study are shown in bold. Scale bar = expected changes per site.
Figure 6. Long description
A phylogenetic tree diagram based on 1 8 S r R N A sequence alignment. The tree originates from a root on the left with an outgroup consisting of Xiphinema rivesi (H M 9 2 1 3 4 4), Tylencholaimus mirabilis (E F 2 0 7 2 5 3), and Xiphinema index (H M 9 2 1 3 4 2).
Moving from top to bottom along the right-hand terminal branches:
* The uppermost clade includes species such as Longidorus silvestris, L. lusitanicus, and L. magnus, with posterior probabilities ranging from 0.51 to 1.00.
* A large central cluster contains L. americanus, L. crassus, and L. moesicus.
* Highlighted in bold and orange shading is the new sequence: P X 7 6 6 3 1 5 Longidorus parasabalanicus sp. nov., which is sister to M Z 4 7 4 6 7 4 Longidorus sabalanicus with a posterior probability of 0.99.
* Below this, a diverse group includes L. tabrizicus, L. rubi, L. elongatus, and L. attenuatus.
* The lower portion of the tree features clades containing L. jonesi, L. litchii, L. cheni, and L. asiaticus.
* The basal-most clades within the genus include L. ferrisi, L. africanus, L. macrosoma, and L. pisi.
Numerical values at the nodes represent posterior probabilities, with many nodes showing high support of 0.90 to 1.00. A scale bar at the bottom indicates 0.007 expected changes per site.
Phylogenetic relationships of Longidorus parasabalanicus sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from the partial COI mtDNA gene sequence alignment under the GTR + I + G model. Posterior probabilities >0.50 are given for appropriate clades. Newly obtained sequences in this study are shown in bold. Scale bar = expected changes per site.
Figure 7. Long description
A Bayesian consensus tree with a root at the bottom left labeled Xiphinema index (H M 9 2 1 3 8 8). The tree branches into several major clades of the genus Longidorus.
* The top major clade includes species such as L. fasciatus, L. pacensis, and L. baeticus, with posterior probabilities ranging from 0.57 to 1.00 at various nodes.
* A middle section contains a cluster of L. maginicus sequences (O L 4 7 1 0 4 6 through O L 4 7 1 0 4 8) and several unnamed Longidorus species.
* The target species, Longidorus parasabalanicus sp. nov. (P X 8 0 1 0 4 9), is highlighted in a bold orange box in the lower-middle section of the tree. It is positioned as a sister taxon to L. iliturgiensis (M H 4 5 4 0 6 5) and L. aetnaeus (K Y 8 1 6 6 5 6).
* The bottom clades include L. africanus, L. jonesi, and L. helveticus, ending with Xiphinema adenohysterum (K Y 8 1 6 5 8 9) near the base.
* Numerical values at nodes represent posterior probabilities, such as 0.95, 0.77, and 0.54.
* A scale bar at the bottom indicates 0.5 expected changes per site.
The D2–D3 alignment (649 bp) included 125 Longidorus sequences and three outgroup taxa: Tylencholaimus mirabilis (Bütschli Reference Bütschli1873) de Man, Reference De Man1876 (AY593027), Xiphinema index Thorne & Allen, Reference Thorne and Allen1950 (HM921400), and Xiphinema cretense Tzortzakakis et al., Reference Tzortzakakis, Archidona-Yuste, Cantalapiedra-Navarrete, Nasiou, Lazanaki, Kabourakis, Palomares-Rius and Castillo2014 (KJ802879). Two new sequences from this study were incorporated (Figure 5). In the resulting 50% majority-rule consensus tree, L. parasabalanicus sp. nov. was placed within the main Clade I sensu Subbotin et al (2014). L. parasabalanicus sp. nov. (PX703671–PX703672) and L. sabalanicus (MZ474667–MZ474670) formed a highly supported clade (PP = 1.00). This lineage was sister to L. behshahrensis (MK810742–MK810743), also with strong support (PP = 1.00). Together, these taxa clustered within a larger highly supported clade (PP = 1.00) comprising L. piceicola (KY086070), L. intermedius (KT308868), L. artemisiae (KF242313), L. uroshis (EF538754), L. carpathicus (AF480072), L. hyrcanus (OL739253), L. zanjanensis (OR509846), L. elongatus (AF480078), and L. soosanae (ON122994). The relationships among these main subclades were strongly supported (PP = 0.98).
The partial 18S rRNA gene alignment included 89 Longidorus sequences, spanning 1177 bp, and three outgroup taxa: Tylencholaimus mirabilis (EF207253), Xiphinema rivesi (HM921344), and Xiphinema index (HM921342) (Figure 6). L. parasabalanicus sp. nov. (PX766315) clustered with L. sabalanicus (MZ474674) in a highly supported clade (PP = 0.99). These two species are related to Longidorus sp. (EU503142), L. iliturgiensis (MH430002), and L. tabernensis (MK941261), which clustered together in a moderately supported subclade (PP = 0.90). Nevertheless, L. parasabalanicus sp. nov. remained clearly distinct from other Longidorus species.
Finally, phylogenetic analysis of the mitochondrial COI gene was based on 64 sequences and a 281 bp alignment, with Xiphinema adenohystherum (KY816589) and Xiphinema index (HM921388) as outgroups. The resulting COI tree revealed several poorly resolved clades (Figure 7). L. parasabalanicus sp. nov. (PX801049) formed a distinct lineage within a moderately supported subclade (PP = 0.77), clearly separated from other Longidorus species.
Discussion
The present study provides an integrative taxonomic characterisation of Longidorus parasabalanicus sp. nov., a new species associated with Astragalus spp. in northern Iran. This finding contributes to a better understanding of species diversity and phylogenetic relationships within the genus Longidorus. The combined use of detailed morphological observations and multilocus molecular markers proved essential for accurate species delimitation in this taxonomically challenging group.
Morphologically, the new species is most similar to L. sabalanicus and, together with L. tabrizicus and L. paratabrizicus, appears to form a closely related species complex characterised by high similarity and partial overlap in diagnostic characters. Within this complex, L. parasabalanicus sp. nov. can be distinguished by a combination of subtle but consistent morphological and morphometric features. However, some of these differences, particularly those observed in adults (e.g., spicule length and minor morphometric variation), could easily be interpreted as intraspecific variability in the absence of molecular data.
Juvenile morphology, especially that of the first-stage juvenile (J1), provides more reliable diagnostic traits. The distinct tail morphology of J1 in L. parasabalanicus sp. nov., compared to the digitate or subdigitate tail in L. sabalanicus, represents a key distinguishing feature. Additionally, differences in body length and in the length of functional and replacement odontostyles across juvenile stages further support species separation. These findings reinforce the critical importance of juvenile morphology, particularly J1, in the identification of closely related species of Dorylaimida, as previously emphasised by Hunt (Reference Hunt1993) and subsequent studies.
The close morphological similarity between L. parasabalanicus sp. nov. and L. sabalanicus, combined with their clear molecular divergence, provides strong evidence of cryptic speciation. Similar patterns have been documented in several longidorid species complexes, highlighting the widespread occurrence of morphologically conserved but genetically distinct lineages within the family. The increasing recognition of such complexes (e.g., L. vineacola, L. baeticus, L. oleae, and L. iliturgiensis species groups) underlines the limitations of morphology-based taxonomy when used in isolation and emphasises the need for integrative approaches.
Molecular analyses in this study further support the distinct status of the new species. The D2–D3 expansion segments of 28S rDNA and partial 18S rDNA provided consistent phylogenetic signals, placing L. parasabalanicus sp. nov. in a well-supported clade with L. sabalanicus, while clearly separating it from other congeners. In contrast, the mitochondrial COI gene showed higher variability and lower similarity values, confirming its usefulness for detecting genetic divergence, although its phylogenetic resolution within Longidorus remains limited. The ITS1 region, despite showing some similarity to L. sabalanicus, could not be reliably aligned across taxa and therefore was not suitable for phylogenetic reconstruction, a limitation previously reported for this marker in longidorids.
These results are consistent with previous studies (Archidona-Yuste et al Reference Archidona-Yuste, Cantalapiedra-Navarrete, Castillo and Palomares-Rius2019; Cai et al Reference Cai, Archidona-Yuste, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2020a, Reference Cai, Gu, Ye, Ma and Liu2024; Salazar-García et al Reference Salazar-García, Palomares-Rius, Bajoub, Ajal, Ouled-Bouallala, Cantalapiedra-Navarrete, Castillo and Archidona-Yuste2025) indicating that ribosomal markers, particularly D2–D3 of 28S rDNA, are among the most reliable tools for species identification and phylogenetic inference in Longidoridae, whereas 18S rDNA is more conserved and less informative at the species level. The integration of multiple molecular markers, combined with detailed morphological analysis, remains the most robust framework for resolving species boundaries and uncovering hidden diversity in this group.
The discovery of L. parasabalanicus sp. nov. further expands the known diversity of Longidorus in Iran, a region increasingly recognised as a hotspot for longidorid diversity. The presence of closely related and potentially cryptic species in natural habitats, such as the mountainous ecosystems of Guilan province, suggests that the actual diversity of the genus is still underestimated. Continued integrative surveys are therefore essential to improve our understanding of species richness, distribution, and evolutionary relationships within this economically important group of PPNs.
In conclusion, the present study highlights the importance of combining morphological, morphometric, and molecular data for accurate species delimitation in Longidorus. The molecular markers generated here provide reliable tools for the identification of L. parasabalanicus sp. nov., facilitating future studies on its distribution, ecology, and potential economic impact.
Financial support
There are no projects associated with this research.
Competing interests
None.
Ethical standards
The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of laboratory animals.
