Introduction
Nematode larvae of the genera Anisakis, Pseudoterranova and Contracaecum within the family Anisakidae have the potential to infect humans and cause a zoonotic disease termed anisakidosis. The life cycle for the three nematode types in the marine environment comprises the adult worms in marine mammals or fish-eating birds, third-stage infective larvae in first intermediate/transport hosts (invertebrates) and second transport hosts (various fish species). When the final host ingests the fish carrying infective larvae, the worm develops to the adult stage (McClelland, Reference McClelland2002). Humans may obtain infection following ingestion of inadequately processed fish meat (dishes based on raw fish are sushi, sashimi, ceviche, cold smoked fish and lightly marinated fish products) containing infective larvae (Gardiner, Reference Gardiner1990; Ishikura, Reference Ishikura, Otsuru, Kamegai and Hayashi2003). Most anisakidosis cases are caused by species within the genus Anisakis (Ishikura, Reference Ishikura, Otsuru, Kamegai and Hayashi2003), some are caused by Pseudoterranova (Margolis, Reference Margolis1977) and a few are due to Contracaecum (Schaum & Müller, Reference Schaum and Müller1967; Shamsi & Butcher, Reference Shamsi and Butcher2011; Nagasawa, Reference Nagasawa2012; Strøm et al., Reference Strøm, Haarder, Korbut, Mejer, Thamsborg, Kania and Buchmann2015). Whereas Anisakis spp. use cetaceans (whales) as final host, Contracaecum spp. and Pseudoterranova spp. apply various species of pinnipeds (seals) as final hosts, carrying the adult worms in the stomach. The vernacular name ‘seal worm’ is used for Pseudoterranova spp. as it reflects the association with the final host. The third-stage infective larvae often occur in the flesh of Atlantic cod Gadus morhua (Heuch et al., Reference Heuch, Jansen, Hansen, Sterud, MacKenzie, Haugen and Hemmingsen2011), and, therefore, the term ‘cod worm’ is commonly used for this parasite (Hafsteinsson & Rizvi, Reference Hafsteinsson and Rizvi1987; McClelland, Reference McClelland2002), although several other fish species serve as hosts (McClelland & Martell, Reference McClelland and Martell2001; Karpiej et al., Reference Karpiej, Dzido, Rokicki and Kijewska2013; Kuhn et al., Reference Kuhn, Benninghoff, Karl, Landry and Klimpel2013; Timi et al., Reference Timi, Paoletti and Cimmaruta2014). Pseudoterranova spp. nematodes are natural elements in the marine environment and clearly associated with the occurrence of the final hosts (Marcogliese et al., Reference Marcogliese, Boily and Hammill1996; Olafsdottir & Hauksson, Reference Olafsdottir and Hauksson1997, Reference Olafsdottir and Hauksson1998; Hauksson, Reference Hauksson2002). Recently, the seal populations in Danish waters have increased markedly, resulting in the appearance of Pseudoterranova decipiens in local fish products (Perdiguero-Alonso et al., Reference Perdiguero-Alonso, Montero, Raga and Kostadinova2008; Buchmann & Kania, Reference Buchmann and Kania2012; Mehrdana et al., Reference Mehrdana, Bahlool and Skov2014). Anisakidosis cases have been considered rare in Denmark, with only one reported case ascribed to Anisakis sp. following ingestion of lightly salted herring (Andreassen & Jorring, Reference Andreassen and Jorring1970), but with the advent of more exotic dishes based on raw or semi-raw fish products and an increasing abundance of infected marine mammals, the risk of contracting anisakidosis is considered increasing. The present report describes a human case of P. decipiens infection in Denmark, with an unusual localization of the worm larva.
Case report
A 33-year-old man was referred to the out-patient clinic at the Department of Infectious Diseases in April 2020, due to expulsion of a worm from the nose. Four days earlier, he had woken up early due to nasal irritation. Nose blowing resulted in expulsion of an approximately 4 cm white worm with pointed ends, which he brought to the out-patient clinic in a jar. He had a history of rhinitis with nasal running and congestion. This had developed abruptly 1.5 years earlier and did not show any seasonality. Previous investigations of his rhinitis, including skin test and direct fibre-optic laryngoscopy, had not revealed any causative aetiology. He was treated intermittently with the corticosteroid mometasone furoate (Nasonex®) nasal spray. Besides the suspected allergic rhinitis, his medical history was unremarkable, and he received no additional regular medication. At presentation, the patient complained about runny nose and nasal congestion. He had no additional respiratory symptoms, no gastrointestinal symptoms and no dermatologic manifestations at the time of the consultation and at least two years previously. The patient reported occasional intake of raw or uncooked fish (sushi, sashimi, ceviche), but not within the last six months. Exposure also comprised swimming in Danish sea waters (Øresund and Kattegat, north of Zeeland) every summer, last time in July 2019. His travel history was inconspicuous, and he had no close contact to animals. His physical examination was unremarkable. No blood samples were obtained, and no laboratory test results were available from the last seven years. The four-day-old worm larva was dry, with reddish discolouration of the tips. It was placed in isotonic saline and sent to the Department of Clinical Microbiology for further analysis. A tentative diagnosis was Pseudoterranova sp., and the worm was sent for confirmatory testing, as described below. The patient received no treatment. At follow-up after one and two months, the patient had persistent symptoms of rhinitis, but no additional symptoms or signs, and no additional worms had emerged.
Materials and methods
Diagnosis
The live nematode larva recovered by the patient was placed in physiological saline, whereafter it was fixed in ethanol (70%) and subsequently subjected to morphological and molecular diagnosis. The frontal and caudal parts of the larva were excised, cleared in lactic acid and mounted on microscope slides in Aquatex® mounting medium (Merck, Darmstadt, Germany) and studied under a light microscope (Leica, Germany), noting morphological characteristics of caudal and frontal ends (Val'ter et al., Reference Val'ter, Popova and Valovaya1982). Partial molecular characterization was based on polymerase chain reaction (PCR) amplifying the gene locus internal transcribed spacer (ITS) region of ribosomal DNA (rDNA) (from 18S through ITS1, 5.8S, ITS2 to 28S) and the gene locus of the mitochondrial gene mtDNA cox2. DNA was isolated from sections of larvae using a QIAamp® DNA Mini Kit (250) (catalogue number 51306) and used for PCR in a Biometra T3 Thermocycler (Fisher Scientific, Roskilde, Denmark). The reaction mixtures consisted of DNA template (5 μl), one unit of BioTaq DNA polymerase (DNA-Technology, Aarhus, Denmark), 1 mm of each deoxynucleotide triphosphate (dNTP), 1.5 mm magnesium chloride and 1 μM of the two primers. The primers for amplifying the gene locus ITS region of rDNA were forward primer NC5 5′-GTA GGT GAA CCT GCG GAA GGA TCA TT-3′ and reverse primer NC2 5′-TTA GTT TCT TTT CCT CCG CT-3′ (Zhu et al., Reference Zhu, D'Amelio, Palm, Paggi, George-Nascimento and Gasser2002, Reference Zhu, Podolska, Liu, Yu, Chen, Lin, Luo, Song and Lin2007), and for amplification of the mitochondrial gene mtDNA cox2 we used primers 211F (TTTTCTAGTTATATAGATTGRTTT-YAT) and 210R (CACCAACTCTTAAAATTATC) (Nadler & Hudspeth, Reference Nadler and Hudspeth2000). PCR products were examined by electrophoresis in a 1.5% agarose gel with ethidium bromide and purified using the Illustra™ GFX™ PCR DNA Purification Kit (GE Healthcare, Brøndby, Denmark). Sequencing was conducted by Macrogen (Seoul, Korea) and analysed on the CLC Main Workbench v7.9.1 (Qiagen, Aarhus, Denmark) by BLAST® (Bethesda, Maryland, USA).
Results
The worm larva recovered (fig. 1) had a total length of 41 mm and a maximum width of 1 mm. Morphological characteristics (larval sheath, boring tooth, nerve ring, excretory pore anteriorly to nerve ring, intestinal caecum, absence of ventricular appendage, tail spine (mucron) at the caudal end) were noted. Molecular diagnosis was based on PCR, with subsequent sequencing and alignment performed using the recovered ITS region sequences and sequences for the mitochondrial gene locus cox2 with available sequences at GenBank. The ITS and cox2 sequences from the P. decipiens isolate from the patient obtained GenBank accession numbers MT624318 and MT624317, respectively. The highest similarity was found for ITS (100%) with isolates of P. decipiens from the Baltic and the North Sea. Highest similarity (99.83%) for the cox2 sequences were found with a P. decipiens isolate from Germany (River Elbe) (table 1).
Light microscopy of anterior (A) and caudal end (B) of Pseudoterranova decipiens larva recovered from the nose of a human patient.
Comparison (similarity percentages) of sequences encoding rDNA (ITS) GenBank accession number MT624318 and mtDNA (cox2) GenBank accession number MT 624317 in Pseudoterranova decipiens (larva recovered from the nose of a Danish patient) with available GenBank sequences. Sequence lengths, excluding prime binding sites of cox2 and ITS region, are 582 bp and 905 bp, respectively.
Discussion
Several species within the genus Pseudoterranova (P. decipiens, P. krabbei, P. azarasi, P. bulbosa, P. cattani) have been documented (Mattiucci & Nascetti, Reference Mattiucci and Nascetti2008; Timi et al., Reference Timi, Paoletti and Cimmaruta2014), but the larva isolated from a patient in the present study was diagnosed as P. decipiens, as judged from mitochondrial DNA cox2 sequences. The species was originally described by Krabbe (Reference Krabbe1878) based on adult specimens from Icelandic seals (Buchmann, Reference Buchmann2001). Human infections by third-stage larvae of P. decipiens are generally considered less severe than infections by species within the genus Anisakis eliciting anisakiasis associated with severe clinical signs due to intestinal or gastrointestinal penetration (Caramello et al., Reference Caramello, Vitali, Canta, Caldana, Santi, Caputo, Lipani and Balbiano2003; Ishikura, Reference Ishikura, Otsuru, Kamegai and Hayashi2003; Nascetti, Reference Nascetti2011). Pseudoterranova spp. larvae also perform gastrointestinal invasion (Sawada et al., Reference Sawada, Moriyama, Ebina, Sasaki, Yoshida, Tanabe and Chiba1983; Mercado et al., Reference Mercado, Torres, Muñoz and Apt2001; Na et al., Reference Na, Seo, Chai, Lee and Jeon2013; Cavallero et al., Reference Cavallero, Scribano and D'Amelio2016), but they have mainly been reported from the stomach (Margolis, Reference Margolis1977; Pinel et al., Reference Pinel, Beaudevin, Chermette, Grillot and Ambroise-Thomas1996; Koh et al., Reference Koh, Huh and Sohn1999), oesophagus (Torres et al., Reference Torres, Jercic, Weitz, Dobrew and Mercado2007) or throat (Little & Most, Reference Little and Most1973; Chitwood, Reference Chitwood1975; Juels et al., Reference Juels, Butler, Bier and Jackson1975; Lichtenfels & Brancato, Reference Lichtenfels and Brancato1976; Skirnisson, Reference Skirnisson2006). Penetration into and through the host stomach wall (Little & MacPhail, Reference Little and MacPhail1972; Yu et al., Reference Yu, Seo, Kim, Oh and Sohn2001) or even further (Amin et al., Reference Amin, Eidelman, Domke, Bailey and Pfeifer2000) are described, but several cases also show that the worm larva may leave the patient per os (Kliks, Reference Kliks1983; Arizono et al., Reference Arizono, Miura, Yamada, Tegoshi and Onishi2011; Dupouy-Camet et al., Reference Dupouy-Camet, Gay, Bourgau, Nouchi, Leger and Dei-cas2014). A single nasal infection of a French female patient was reported by Brunet et al. (Reference Brunet, Pesson and Royant2017).
During the latest decades, the seal populations in Danish waters have increased considerably (Haarder et al., Reference Haarder, Kania, Galatius and Buchmann2014; Zuo et al., Reference Zuo, Kania, Mehrdana, Marana and Buchmann2018), and with the expanding final host occurrence the infection of cod with P. decipiens has increased markedly from a low level in the 1990s (Myjak et al., Reference Myjak, Szostakowska, Wojciechowski, Pietkiewicz and Rokicki1994) to a higher level in recent years (Skov et al., Reference Skov, Kania, Olsen, Lauridsen and Buchmann2009; Buchmann & Kania, Reference Buchmann and Kania2012; Mehrdana et al., Reference Mehrdana, Bahlool and Skov2014) and, consequently, the risk of human infections with seal worm is likely to increase.
This is the first report of human pseudoterranoviasis in Denmark. The most likely source of the infection was raw or undercooked fish. From a localization in stomach, oesophagus, throat or mouth, the larvae could easily migrate to the nasal cavity. A less likely route – which, at present, is purely theoretical – is capture of newly hatched larvae (body length around 200 μm) in the nasopharynx during swimming/bathing in seawater. Such an infection route remains unconfirmed, but it is noteworthy that the very small larva hatching from the parasite egg is the third stage and, in principle, infective to the final host (Køie et al., Reference Køie, Berland and Burt1995; McClelland, Reference McClelland2002). The length growth of the parasite from 200 μm to 40 mm may take several months (McClelland, Reference McClelland2002). The seals in the Danish and adjacent marine waters carry adult Pseudoterranova nematodes (Lunneryd, Reference Lunneryd1991; Jensen & Idås, Reference Jensen and Idås1992; Jensen et al., Reference Jensen, Andersen and Desclers1994; Aspholm et al., Reference Aspholm, Ugland, Jodestol and Berland1995; Skrzypczak et al., Reference Skrzypczak, Rokicki, Pawliczka, Najda and Dzido2014; Lunneryd et al., Reference Lunneryd, Boström and Aspholm2015; Zuo et al., Reference Zuo, Kania, Mehrdana, Marana and Buchmann2018). In addition, the salinities in Danish waters – although decreasing from 33 to 7 ppt from the North Sea to the southern Baltic – allow P. decipiens egg development and hatching and subsequent survival of larvae for several weeks to months (Measures, Reference Measures1996). Interestingly, none of these suggested exposure routes were immediately preceding the nasal expulsion of the worm larva. To the best of the patient's recall, the exposure had taken place at least six (raw fish consumption) and nine (swimming/bathing) months prior to the emergence of the worm. A prolonged survival time in a patient was previously reported by Brunet et al. (Reference Brunet, Pesson and Royant2017), but the present case suggests that it is possible for a P. decipiens third-stage larva to reside in a patient for more than half a year. The association with symptoms of allergic rhinitis is noteworthy and not reported previously. The symptoms had developed quite abruptly in this previously healthy man without prior history of allergy during childhood and youth. The symptom-provoking agent remains unknown, but it should be mentioned that the association between Anisakis infection and allergy is well documented (Daschner & Pascual, Reference Daschner and Pascual2005; Arcos et al., Reference Arcos, Ciordia and Roberston2014; Carballeda-Sangiao et al., Reference Carballeda-Sangiao, Olivares, Rodriguez-Mahillo, Careche, Tejada, Moneo and González-Muñoz2014; Fæste et al., Reference Fæste, Jonscher, Dooper, Egge-Jacobsen, Moen, Daschner, Egaas and Christians2014). Recent comparative proteomic studies have even shown that similar allergens are present in P. decipiens (Kochanowski et al., Reference Kochanowski, Gonzales-Munoz, Gomez-Morales, Gottstein, Dabrowska, Rozycki, Cencek, Muller and Boubaker2019), with a potential to induce allergy in mice (Ludovisi et al., Reference Ludovisi, Di Felice and Carballeda-Sangiao2017). Future cases should, therefore, apply serological (IgE and IgG) and specificity tests for further elucidation of the aetiology. The reported case frames the risk of human infections with anisakid nematode larvae and the need for preventive measures before consumption of wild captured marine fish products (EFSA, 2010). Sufficient heat treatment or prior freezing are measures recommended for inactivation of larvae in the products before consumption.
Financial support
This research received no specific grant from any funding agency, commercial or not-for-profit sectors.
Conflicts of interest
None.
Ethical standards
Consent for publishing the case was obtained from the patient.
Open access
