Hostname: page-component-74656f9884-8r8nv Total loading time: 0 Render date: 2026-11-07T23:54:58.554Z Has data issue: false hasContentIssue false
  • English
  • Français

Characterization of novel low-molecular-weight glutenin subunit genes from the diploid wild wheat relative Aegilops umbellulata

Published online by Cambridge University Press:  12 May 2022

Wenyang Wang ,
Wenjun Ji ,
Lihua Feng ,
Shunzong Ning ,
Zhongwei Yuan ,
Ming Hao ,
Lianquan Zhang Open the ORCID record for Lianquan Zhang [Opens in a new window] ,
Zehong Yan ,
Bihua Wu  and
Dengcai Liu
...Show all authors
Wenyang Wang
Affiliation:
State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Wenjiang 611130, China Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Wenjun Ji
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Lihua Feng
Affiliation:
College of Agronomy, Sichuan Agricultural University, Wenjiang 611130, China
Shunzong Ning
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Zhongwei Yuan
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Ming Hao
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Lianquan Zhang
Affiliation:
State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Wenjiang 611130, China Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Zehong Yan
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Bihua Wu
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Dengcai Liu
Affiliation:
State Key Laboratory of Crop Gene Exploration and Utilization in Southwest China, Sichuan Agricultural University, Wenjiang 611130, China Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
Lin Huang*
Affiliation:
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, China
*
Author for correspondence: Lin Huang, E-mail: lhuang@sicau.edu.cn
Rights & Permissions [Opens in a new window]

Abstract

Low molecular weight glutenin subunits (LWM-GSs) play a crucial role in determining wheat flour processing quality. In this work, 35 novel LMW-GS genes (32 active and three pseudogenes) from three Aegilops umbellulata (2n = 2x = 14, UU) accessions were amplified by allelic-specific PCR. We found that all LMW-GS genes had the same primary structure shared by other known LMW-GSs. Thirty-two active genes encode 31 typical LMW-m-type subunits. The MZ424050 possessed nine cysteine residues with an extra cysteine residue located in the last amino acid residue of the conserved C-terminal III, which could benefit the formation of larger glutenin polymers, and therefore may have positive effects on dough properties. We have found extensive variations which were mainly resulted from single-nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) among the LMW-GS genes in Ae. umbellulata. Our results demonstrated that Ae. umbellulata is an important source of LMW-GS variants and the potential value of the novel LMW-GS alleles for wheat quality improvement.

Keywords

Aegilops umbellulataLMW-GSU genomewheat quality improvement

Information

Type
Research Article
Information
Plant Genetic Resources , Volume 20 , Issue 1 , February 2022 , pp. 1 - 6
Copyright
Copyright © The Author(s), 2022. Published by Cambridge University Press on behalf of NIAB

Introduction

Low molecular weight glutenin subunits (LWM-GSs) account for approximately 40% of total proteins in wheat grain and primarily determine dough extensibility and strength, thus playing a pivotal role in wheat flour processing quality (Lee et al., Reference Lee, Beom, Altenbach, Lim, Kim, Kang, Yoon, Gupta, Kim, Ahn and Kim2016; Li et al., Reference Li, Liu, Song, Zhang, Li and Gao2016; Xiang et al., Reference Xiang, Huang, Gong, Liu, Wang, Jin, He, He, Jiang, Zheng, Liu and Wu2019). The LMW-GSs encoding genes are located at loci of Glu-A3, Glu-B3 and Glu-D3 on the short arms of wheat chromosomes 1A, 1B and 1D, respectively (D'Ovidio and Masci, Reference D'Ovidio and Masci2004). The copy numbers of LMW-GS genes in bread wheat are varied from 10–20 to 30–40 (Harberd et al., Reference Harberd, Bartels and Thompson1985; Lee et al., Reference Lee, Beom, Altenbach, Lim, Kim, Kang, Yoon, Gupta, Kim, Ahn and Kim2016). The copy numbers of active LMW-GS genes in single accession were estimated to be 9 to 13 (Zhang et al., Reference Zhang, Liu, Zhang, Jiang, Luo, Yang, Sun, Tong, Cui and Zhang2013). Based on the first amino acid residue at the N-terminal domain of the mature protein, the LMW-GSs genes are traditionally categorized into LMW-methionine (m), LMW-serine (s) and LMW-isoleucine (i) types (D'Ovidio and Masci, Reference D'Ovidio and Masci2004). A fourth type of LMW-GS gene, LMW-leucine (l), was characterized from Aegilops comosa (Wang et al., Reference Wang, Gao, Wang, Zhang, Li, Zhang, Xie, Yan, Belgard and Ma2011b; Huang et al., Reference Huang, He, Jin, Wang, He, Feng, Liu and Wu2018).

Aegilops umbellulata Zhuk. (2n = 2x = 14, UU) is a wild diploid relative of cultivated wheat that harbours great variability in such valuable traits as disease resistance (Gill et al., Reference Gill, Sharma, Raupp, Browder, Heachett, Harvey, Moseman and Waines1985; Chhuneja et al., Reference Chhuneja, Kaur, Goel, Aghaee-Sarbaezeh, Parashar and Dhaliwal2008; Edae et al., Reference Edae, Olivera, Jin, Poland and Rouse2016) and grain quality-related traits (Law and Payne, Reference Law and Payne1983; Dai et al., Reference Dai, Zhao, Xue, Jia, Liu, Pu, Zheng and Yan2015; Wang et al., Reference Wang, Wang, Zhen, Li and Yan2018). Ae. umbellulata has crossability with tetraploid wheat, and therefore agronomic desirable traits from Ae. umbellulata can be introgressed into common wheat using synthetic wheat hexaploids with the AABBUU genome as bridges (Bansal et al., Reference Bansal, Kaur, Dhaliwal, Bains, Bariana, Chhuneja and Bansal2017; Song et al., Reference Song, Dai, Jia, Zhao, Kang, Liu, Wei, Zheng and Yan2019). PmY39 for powdery mildew resistance (Zhu et al., Reference Zhu, Zhou, Kong, Dong and Jia2006) and Lr9 for leaf rust resistance (Schachermayr et al., Reference Schachermayr, Siedler, Gale, Winzeller, Winzeller and Keller1994) were successfully transferred from Ae. umbellulata to wheat cultivars. The introgression of 1U genome of Ae. umbellulata into hexaploid wheat showed significantly improved dough rheological properties and bread-making quality (Wang et al., Reference Wang, Wang, Zhen, Li and Yan2018).

A pair of HMW-GS and their coding genes at Glu-U1 locus was characterized and cloned (Liu et al., Reference Liu, Zhang, Wan, Liu and Wang2002). Some Glu-U1 genes were transferred from Ae. umbellulata to the Chinese Spring wheat variety (Islam-Faridi, Reference Islam-Faridi1988). Characterization of LMW-GS genes from Ae. umbellulata was reported by limited studies (Li et al., Reference Li, Wang, Wang, Gao, Xie, Hsam, Zeller and Yan2010; Wang et al., Reference Wang, Li, Wang, Wang, Li, Zhang, Guo, Zeller, Hsam and Yan2011a). The numbers of LMW-GS genes reported in these studies varied from 1 to 5. In the present study, we isolated 35 novel LMW-GS genes (11–14 copies per accession) from three Ae. umbellulata accessions and their molecular characterization was investigated.

Materials and methods

Plant materials

Ae. umbellulata (2n = 2x = 14, UU) accessions (Fig. 1) numbered PI 554,396, AS3 and AS4 were used in this study. PI 554,396 was kindly provided by the National Plant Germplasm System of the USDA-ARS, USA. AS3 and AS4 were originally provided by Dr Sadao Sakamoto, Plant Germ-plasm Institute, Kyoto University, Kyoto, Japan. All these materials were kept at the Triticeae Research Institute, Sichuan Agricultural University, Chengdu, China.

Fig. 1.

Morphology of Aegilops umbellulata spike. (a), spike; (b), spikelets; (c), seeds.

DNA extraction, PCR amplification and sequencing

Genomic DNA was extracted from seedling leaves of Ae. umbellulata accessions using the cetyltrimethylammonium bromide (CTAB) method (Rogers and Bendich, Reference Rogers and Bendich1985) with slight modification. One pair of allele-specific PCR (AS-PCR) primers (LMW-1: ATCATCACAAGCACAAGCATC and LMW-2: TTCTTATCAGTAGGCACCAAC) (Wang et al., Reference Wang, Gao, Wang, Zhang, Li, Zhang, Xie, Yan, Belgard and Ma2011b) was used to amplify LMW-GS genes. The PCR amplification was performed using the Veriti™ 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City, CA, USA) in a 40 μl reaction volume as described by Huang et al. (Reference Huang, He, Jin, Wang, He, Feng, Liu and Wu2018). PCR products were separated using 1.5% agarose gel electrophoresis, stained with GelRed Nucleic Acid Gel Stain (Biotium, Hayward, CA, USA). These fragments were purified by using Sureclean (Bioline Reagents, London), ligated to pMD19-T vector (Takara, Dalian, China) and used to transform Escherichia coli DH5α cells. The positive clones were sequenced by Sangon Biotechnology Company (Shanghai, China). To avoid possible error, the final sequence of each LMW-GS gene was determined from the sequencing results of at least three independent clones.

Sequence analysis of LMW-GS genes

The assembly of LMW-GS sequences was completed using Lasergene software (DNASTAR; http://www.dnastar.com/). The sequence alignment of LMW-GS genes was performed with BioEdit (Hall, Reference Hall2007). The phylogenetic tree was constructed using the neighbour-joining method in the MEGA 6.0 software (Tamura et al., Reference Tamura, Stecher, Peterson, Filipski and Kumar2013). Bootstrap values were calculated from 1000 replications.

Results

Cloning and characterization of LMW-GS genes

PCR products from three Ae. umbellulata accessions are shown in Fig. 2. A single candidate amplification product with approximately 900 bp was obtained using AS-PCR primers LMW-1/LMW2. After sequencing, a total of 35 LMW-GS sequences were obtained (online Supplementary Table S1). GenBank database comparison showed that these genes were different from reported LMW-GS genes in Ae. umbellulata (Li et al., Reference Li, Wang, Wang, Gao, Xie, Hsam, Zeller and Yan2010; Wang et al., Reference Wang, Li, Wang, Wang, Li, Zhang, Guo, Zeller, Hsam and Yan2011a) and other Triticum species; thus, all these 35 genes were novel and were deposited in GenBank with the accession numbers (MZ424047-MZ424081).

Fig. 2.

PCR amplification of LMW-GS genes from Aegilops umbellulata accessions by the AS-PCR primers LMW-1/LMW2. Lanes 1, 2 and 3 PCR products were amplified from PI 554,396, AS3 and AS4, respectively. M, DL2000 DNA marker.

In total, 14, 12 and 11 LMW-GS genes were revealed by sequencing of 42, 24 and 22 clones from PI554396, AS3 and AS4, respectively. MZ424067, which present in three Ae. umbellulata accessions, was found to be the most common LMW-GS gene (>54%). MZ424080 and MZ424081 in PI554396 and MZ424079 in AS3 are pseudogenes, the remaining 32 genes are complete active genes. The ORFs of the 32 active LMW-GS genes varied from 885 to 888 bp, which encoding 31 different LMW-GSs with 294 to 295 amino acid residues. The coding regions of these LMW-GS genes were all terminated by double stop codons.

Amino acid sequence alignment indicated that all subunits shared four main structural domains, including a signal peptide, an N-terminal region, a repetitive domain and a C-terminal domain with three sub-regions (C-terminal I, II and III). Since the first amino acid residue of the mature protein was methionine, the 31 LMW-GS were regarded as typical LMW-m-type subunits (Fig. 3). All LMW-m-type proteins begin with METSCIPGL except MZ424060 begin with METSCILGL. As typical for LMW-GS genes, 30 subunits had eight highly conserved cysteine residues, while MZ424050 containing nine cysteine residues with an extra cysteine residue located at the last amino acid residue of the conserved C-terminal III domain in LMW-m subunit (online Supplementary Table S1).

Fig. 3.

Multiple alignments of the deduced amino acid sequences of LMW glutenin genes. Signal, signal peptide. The mature protein sequences were divided into: N-terminal domain; repetitive domain; C-terminal domains (I–III). Magenta shows the first amino acid residue of the mature proteins. Grey shading indicates the cysteine residues. Identical sequences and deletions were presented by dots and dashes, respectively.

Sequence variations of the LMW-GS genes

Multiple sequence alignment of the LMW-GS sequences was performed to identify the presence of single-nucleotide polymorphisms (SNPs) and insertions and deletions (InDels). As compared to the predominant MZ424067 in three Ae. umbellulata accessions, a total of 55 SNPs were detected at different positions (Table 1). One-base deletion (C) was found at the position 226 in MZ424081 and a three-base deletion (ACA) at 306–308 were detected in MZ424048 and MZ424074.

Table 1.

SNPs and InDels identified among 35 LMW-GS genes from Ae. umbellulata

Phylogenetic analysis of LMW-GS genes

To further investigate the phylogenetic relationships among the LMW-GS genes at the Glu-3 loci, a phylogenetic tree was constructed based on 35 LMW-GS genes in this study and other 17 LMW-GS genes retrieved from GenBank. The results are shown in Fig. 4.

Fig. 4.

Phylogenetic relationships of the 35 newly isolated and LMW-GS sequences retrieved from GenBank. The nucleotide sequences were specified by their corresponding GenBank accession numbers. The LMW-GS gene types and species are indicated. Bold, the 35 LMW-GSs identified in this study.

The phylogenetic tree was divided into three clear branches, with alleles of LMW-m-type genes at the top, LMW-s-type genes at the middle and LMW-i-type genes at the bottom. The 35 LMW-GS genes obtained in the current study were located in the LMW-m-type branch, which clustered with two published LMW-m-type genes EU571725 and EF649991 from Ae. umbellulata, further confirming that they are LMW-m-type genes.

Discussion

The LMW-GS genes are widely presented in genomes of wheat and related cereals (Ikeda et al., Reference Ikeda, Nagamine, Fukuoka and Yano2002; Henkrar et al., Reference Henkrar, El-Haddoury, Iraqi, Bendaou and Udupa2017; Huang et al., Reference Huang, He, Jin, Wang, He, Feng, Liu and Wu2018; Xiang et al., Reference Xiang, Huang, Gong, Liu, Wang, Jin, He, He, Jiang, Zheng, Liu and Wu2019). In the current study, we have isolated 32 novel active LMW-GS genes and three pseudogenes from the Ae. umbellulata genome using AS-PCR primers. We have found extensive allelic variations at Glu-3U that were mainly resulted from SNPs and InDels presented in the LMW-GS genes. A phylogenetic tree was constructed to understand the phylogenetic relationships within these LMW-GS genes.

To date, a few LMW-GS genes have been cloned from Ae. umbellulata accessions. For example, one LMW-GS gene EU571725 from Ae. umbellulata accession PI222762 (Li et al., Reference Li, Wang, Wang, Gao, Xie, Hsam, Zeller and Yan2010); five genes GQ980034, GQ980035, GQ870240-GQ870242 from PI573516 (Wang et al., Reference Wang, Li, Wang, Wang, Li, Zhang, Guo, Zeller, Hsam and Yan2011a). Previous studies showed that the copies of Glu-3 genes in common wheat are varied from 10–20 to 30–40 (Harberd et al., Reference Harberd, Bartels and Thompson1985; Lee et al., Reference Lee, Beom, Altenbach, Lim, Kim, Kang, Yoon, Gupta, Kim, Ahn and Kim2016) and active LMW-GS genes in single accession were estimated to be 9 to 13 (Zhang et al., Reference Zhang, Liu, Zhang, Jiang, Luo, Yang, Sun, Tong, Cui and Zhang2013). Wang et al. (Reference Wang, Wang, Zhen, Li and Yan2018) identified 10 abundant 1U-encoded LMW-GS subunits in CNU609 derived from crosses between Chinese Spring and the wheat-Ae. umbellulata 1U(1B) substitution line and cloned two Glu-U3-encoded LMW-m subunit genes. In the present study, we have isolated 14 (12 active), 12 (11 active) and 11 (11 active) LMW-GS genes from three Ae. umbellulata accessions, respectively. These results suggest that almost all active genes at Glu-3U loci were cloned and the Ae. umbellulata genome may have the similar Glu-3 gene copies to those of wheat.

Previous studies have shown that the cysteine residues were involved in the formation of inter- and intra-molecular disulphide bonds, and any modification in the number or location of cysteine residues could lead to functional variations (D'Ovidio and Masci, Reference D'Ovidio and Masci2004). The most mature Glu-3 proteins contain eight highly conserved cysteine residues. The first and seventh cysteine residues are involved in inter-molecular disulphide bonds, while the remaining six cysteine residues are participated in forming intra-molecular disulphide bonds. In this study, 30 subunits had eight cysteine residues, and the position of these cysteine residues was similar to that of the typical LMW-m-type subunits, whereas MZ424050 subunit had nine cysteine residues with an extra cysteine residue located in the conserved C-terminal III domain. The GQ870241 subunit from U genome with an extra cysteine residue at the C-terminal III was predicted to have positive effects on dough properties. The same number of cysteine residues was found in a LMW-m-type subunit AY263369, which was likely associated with good bread-making quality (Zhao et al., Reference Zhao, Wang, Guo, Hu and Sun2004; Xu et al., Reference Xu, Wang, Shen, Zhao, Sun, Zhao and Guo2006). It has been suggested that the extra cysteine residue might benefit the formation of larger glutenin polymers and contributed to superior gluten quality (Lan et al., Reference Lan, Feng, Xu, Zhao and Wang2013). Therefore, the MZ424050 subunit could contribute to good dough properties and may be new candidate gene for wheat quality improvement.

In the present study, all LMW-GS proteins belonged to typical LMW-m-type subunits. Wang et al. (Reference Wang, Li, Wang, Wang, Li, Zhang, Guo, Zeller, Hsam and Yan2011a) identified a LMW-i-type gene (GQ870242) from Ae. umbellulata PI573516, while this gene is not active due to the presence of premature stop codon in the ORFs. To our best knowledge, the active LMW-GS genes cloned in Ae. umbellulata so far all belonged to LMW-m-type subunits. We have found considerable SNPs variations at the Glu-3U loci, which could be produced by unequal crossing over, point mutations and illegitimate recombination (Anderson and Greene, Reference Anderson and Greene1989; An et al., Reference An, Zhang, Yan, Li, Zhang, Wang, Pei, Tian, Wang, Hsam and Zeller2006; Zhang et al., Reference Zhang, Li, Yan, Zheng, An, Xiao, Wang, Wang, Hsam and Zeller2006; Li et al., Reference Li, Ma, Gao, Zhang, Wang, Ji, Wang, Appels and Yan2008). The extensive allelic variations at Glu-3U could facilitate the development of genome-specific molecular markers and marker-assisted selection (MAS) in wheat quality breeding. The novel LMW-GS genes could be served as valuable genetic sources for wheat quality improvement.

Supplementary material

The supplementary material for this article can be found at https://doi.org/10.1017/S1479262122000016

Acknowledgements

This work was financially supported by grants from the National Natural Science Foundation of China (31901493), the Science & Technology Department of Sichuan Province (2021YJ0505 and 2021YFH0110).

Footnotes

*

Wenyang Wang and Wenjun Ji have contributed equally to this work.

References

An, X, Zhang, Q, Yan, Y, Li, Q, Zhang, Y, Wang, A, Pei, Y, Tian, J, Wang, H, Hsam, SLK and Zeller, FJ (2006) Cloning and molecular characterization of three novel LMW-i glutenin subunit genes from cultivated einkorn (Triticum monococcum L.). Theoretical and Applied Genetics 113, 383–395.10.1007/s00122-006-0299-xCrossRefGoogle Scholar
Anderson, OD and Greene, FC (1989) The characterization and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theoretical and Applied Genetics 77, 689–700.CrossRefGoogle Scholar
Bansal, M, Kaur, S, Dhaliwal, HS, Bains, NS, Bariana, HS, Chhuneja, P and Bansal, UK (2017) Mapping of Aegilops umbellulata-derived leaf rust and stripe rust resistance loci in wheat. Plant Pathology 66, 38–44.CrossRefGoogle Scholar
Chhuneja, P, Kaur, S, Goel, RK, Aghaee-Sarbaezeh, M, Parashar, M and Dhaliwal, HS (2008) Transfer of leaf rust and stripe rust resistance from Aegilops umbellulata Zhuk. to bread wheat (Triticum aestivum L.). Genetic Resources and Crop Evolution 55, 849–859.CrossRefGoogle Scholar
Dai, SF, Zhao, L, Xue, XF, Jia, YN, Liu, DC, Pu, ZJ, Zheng, YL and Yan, ZH (2015) Analysis of high-molecular-weight glutenin subunits in five amphidiploids and their parental diploid species Aegilops umbellulata and Aegilops uniaristata. Plant Genetic Resources 13, 186–189.CrossRefGoogle Scholar
D'Ovidio, R and Masci, S (2004) The low-molecular-weight glutenin subunits of wheat gluten. Journal of Cereal Science 39, 321–339.CrossRefGoogle Scholar
Edae, EA, Olivera, PD, Jin, Y, Poland, JA and Rouse, MN (2016) Genotype-by-sequencing facilitates genetic mapping of a stem rust resistance locus in Aegilops umbellulata, a wild relative of cultivated wheat. BMC Genomics 17, 1039.CrossRefGoogle ScholarPubMed
Gill, BS, Sharma, C, Raupp, WJ, Browder, LE, Heachett, JH, Harvey, TL, Moseman, JG and Waines, JG (1985) Evaluation of Aegilops species for resistance to wheat powdery mildew, wheat leaf rust, Hessian fly, and greenbug. Plant Disease 69, 314–316.Google Scholar
Hall, T (2007) BioEdit, Version 7.0.9. Carlsbad, CA: Computer Program and Documentation, lbis Biosciences.Google Scholar
Harberd, NP, Bartels, D and Thompson, RDM (1985) Analysis of the gliadin multigene loci in bread wheat using nullisomic-tetrasomic lines. Molecular Genetics and Genomics 198, 234–242.CrossRefGoogle Scholar
Henkrar, F, El-Haddoury, J, Iraqi, D, Bendaou, N and Udupa, SM (2017) Allelic variation at high-molecular weight and low-molecular weight glutenin subunit genes in Moroccan bread wheat and durum wheat cultivars. 3 Biotech 7, 287.CrossRefGoogle ScholarPubMed
Huang, L, He, Y, Jin, YR, Wang, F, He, JS, Feng, LH, Liu, DC and Wu, BH (2018) Characterization of novel LMW glutenin subunit genes at the Glu-M3 locus from Aegilops comosa. 3 Biotech 8, 379.CrossRefGoogle ScholarPubMed
Ikeda, TM, Nagamine, T, Fukuoka, H and Yano, H (2002) Identification of new low-molecular-weight glutenin subunit genes in wheat. Theoretical and Applied Genetics 104, 680–687.CrossRefGoogle ScholarPubMed
Islam-Faridi, MN (1988) Genetical Studies of Grain Protein and Developmental Characters in Wheat (PhD Thesis). University of Cambridge, Cambridge.Google Scholar
Lan, QX, Feng, B, Xu, ZB, Zhao, GJ and Wang, T (2013) Molecular cloning and characterization of five novel low molecular weight glutenin subunit genes from Tibetan wheat landraces (Triticum aestivum L.). Genetic Resources and Crop Evolution 60, 799–806.CrossRefGoogle Scholar
Law, CN and Payne, PI (1983) Genetical aspects of breeding for improved grain protein content and type in wheat. Journal of Cereal Science 1, 79–93.CrossRefGoogle Scholar
Lee, JY, Beom, HR, Altenbach, SB, Lim, SH, Kim, YT, Kang, CS, Yoon, UH, Gupta, R, Kim, ST, Ahn, SN and Kim, YM (2016) Comprehensive identification of LMW-GS genes and their protein products in a common wheat variety. Functional & Integrative Genomics 16, 269–279.CrossRefGoogle Scholar
Li, XH, Ma, W, Gao, LY, Zhang, YZ, Wang, AL, Ji, KM, Wang, K, Appels, R and Yan, Y (2008) A novel chimeric LMW-GS gene from the wild relatives of wheat Ae. kotschyi and Ae. juvenalis: evolution at the Glu-3 loci. Genetics 180, 93–101.10.1534/genetics.108.092403CrossRefGoogle ScholarPubMed
Li, XH, Wang, K, Wang, SL, Gao, LY, Xie, XX, Hsam, SLK, Zeller, FJ and Yan, YM (2010) Molecular characterization and comparative transcriptional analysis of LMW-m-type genes from wheat (Triticum aestivum L.) and Aegilops species. Theoretical and Applied Genetics 121, 845–856.CrossRefGoogle ScholarPubMed
Li, XJ, Liu, TH, Song, LJ, Zhang, H, Li, LQ and Gao, X (2016) Influence of high-molecular-weight glutenin subunit composition at Glu-A1 and Glu-D1 loci on secondary and micro structures of gluten in wheat (Triticum aestivum L.). Food Chemistry 213, 728–734.CrossRefGoogle Scholar
Liu, ZJ, Zhang, XM, Wan, YF, Liu, KF and Wang, DW (2002) Characterization of high-molecular-weight glutenin subunits and their coding genes from Aegilops umbellulata. Acta Botanica Sinica 44, 809–814.Google Scholar
Rogers, SO and Bendich, AJ (1985) Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Molecular Biology 5, 69–76.CrossRefGoogle ScholarPubMed
Schachermayr, GM, Siedler, H, Gale, MD, Winzeller, H, Winzeller, M and Keller, B (1994) Identification and localization of molecular markers linked to the Lr9 leaf rust resistance gene of wheat. Theoretical and Applied Genetics 88, 110–115.CrossRefGoogle Scholar
Song, ZP, Dai, SF, Jia, YN, Zhao, L, Kang, LZ, Liu, DC, Wei, YM, Zheng, YL and Yan, ZH (2019) Development and characterization of Triticum turgidum–Aegilops umbellulata amphidiploids. Plant Genetic Resources 17, 24–32.CrossRefGoogle Scholar
Tamura, K, Stecher, G, Peterson, D, Filipski, A and Kumar, S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30, 2725–2729.CrossRefGoogle ScholarPubMed
Wang, SL, Li, XH, Wang, K, Wang, XZ, Li, SS, Zhang, YZ, Guo, GF, Zeller, FJ, Hsam, SLK and Yan, YM (2011 a) Phylogenetic analysis of C, M, N and U genomes and their relationships with Triticum and other related genomes as revealed by LMW-GS genes at Glu-3 loci. Genome 54, 273–284.CrossRefGoogle ScholarPubMed
Wang, K, Gao, L, Wang, S, Zhang, Y, Li, X, Zhang, M, Xie, Z, Yan, Y, Belgard, M and Ma, W (2011 b) Phylogenetic relationship of a new class of LMW-GS genes in the M genome of Aegilops comosa. Theoretical and Applied Genetics 122, 1411–1425.10.1007/s00122-011-1541-8CrossRefGoogle Scholar
Wang, J, Wang, C, Zhen, S, Li, X and Yan, Y (2018) Low-molecular-weight glutenin subunits from the 1U genome of Aegilops umbellulata confer superior dough rheological properties and improve bread making quality of bread wheat. Journal of the Science of Food and Agriculture 98, 2156–2167.CrossRefGoogle Scholar
Xiang, L, Huang, L, Gong, FY, Liu, J, Wang, YF, Jin, YR, He, Y, He, JS, Jiang, QT, Zheng, YL, Liu, DC and Wu, BH (2019) Enriching LMW-GS alleles and strengthening gluten properties of common wheat through wide hybridization with wild emmer. 3 Biotech 9, 355.CrossRefGoogle ScholarPubMed
Xu, H, Wang, RJ, Shen, X, Zhao, YL, Sun, GL, Zhao, HX and Guo, AG (2006) Functional properties of a new low-molecular-weight glutenin subunit gene from a bread wheat cultivar. Theoretical and Applied Genetics 113, 1295–1303.10.1007/s00122-006-0383-2CrossRefGoogle ScholarPubMed
Zhang, Y, Li, Q, Yan, Y, Zheng, J, An, X, Xiao, Y, Wang, A, Wang, H, Hsam, SLK and Zeller, FJ (2006) Molecular characterization and phylogenetic analysis of a novel glutenin gene (Dy10.1t) from Aegilops tauschii. Genome 49, 735–745.CrossRefGoogle ScholarPubMed
Zhang, XF, Liu, DC, Zhang, JH, Jiang, W, Luo, GB, Yang, WL, Sun, JZ, Tong, YP, Cui, DQ and Zhang, AM (2013) Novel insights into the composition, variation, organization, and expression of the low-molecular-weight glutenin subunit gene family in common wheat. Journal of Experimental Botany 64, 2027–2040.CrossRefGoogle ScholarPubMed
Zhao, H, Wang, R, Guo, A, Hu, S and Sun, G (2004) Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat. Hereditas 141, 193–198.10.1111/j.1601-5223.2004.01852.xCrossRefGoogle ScholarPubMed
Zhu, ZD, Zhou, RH, Kong, XY, Dong, YC and Jia, JZ (2006) Microsatellite marker identification of a Triticum aestivum-Aegilops umbellulata substitution line with powdery mildew resistance. Euphytica 150, 149–153.CrossRefGoogle Scholar
Figure 0

Fig. 1. Morphology of Aegilops umbellulata spike. (a), spike; (b), spikelets; (c), seeds.

Figure 1

Fig. 2. PCR amplification of LMW-GS genes from Aegilops umbellulata accessions by the AS-PCR primers LMW-1/LMW2. Lanes 1, 2 and 3 PCR products were amplified from PI 554,396, AS3 and AS4, respectively. M, DL2000 DNA marker.

Figure 2

Fig. 3. Multiple alignments of the deduced amino acid sequences of LMW glutenin genes. Signal, signal peptide. The mature protein sequences were divided into: N-terminal domain; repetitive domain; C-terminal domains (I–III). Magenta shows the first amino acid residue of the mature proteins. Grey shading indicates the cysteine residues. Identical sequences and deletions were presented by dots and dashes, respectively.

Figure 3

Table 1. SNPs and InDels identified among 35 LMW-GS genes from Ae. umbellulata

Figure 4

Fig. 4. Phylogenetic relationships of the 35 newly isolated and LMW-GS sequences retrieved from GenBank. The nucleotide sequences were specified by their corresponding GenBank accession numbers. The LMW-GS gene types and species are indicated. Bold, the 35 LMW-GSs identified in this study.

Supplementary material: File

Wang et al. supplementary material

Wang et al. supplementary material

Download Wang et al. supplementary material(File)
File 13.6 KB