Introduction
The flagellated protozoan parasite Trichomonas gallinae is an aetiological agent of avian trichomonosis, ordinarily affecting the upper respiratory and gastrointestinal tract of birds. It is frequently reported in columbids and birds of prey and is also known as canker and frounce. Infected birds generally present with esophageal lesions, lethargy, difficulty in breathing, watery eyes, drooling and wet feathers.
Columbiformes are believed to be the primary reservoir host of this parasite, with Columba livia considered as an efficient transmitter of T. gallinae throughout the world (Stabler, Reference Stabler1954; Forrester and Foster, Reference Forrester and Foster2008). The disease is a conservation concern for endangered columbids such as the pink pigeon (Bunbury et al. Reference Bunbury2007) and migratory columbids such as the Turtle dove have the potential to spread the parasite over long distances (Stockdale et al. Reference Stockdale2015). Several migratory passerine species, which are host to this disease, such as the greenfinch Chloris chloris and chaffinch Fringilla Coelebs have been linked to trichomonosis during their migratory behaviour (Lawson et al. Reference Lawson2011b).
In recent years the genotype, prevalence and host range of Trichomonas gallinae has been subject to significant scrutiny in Europe (Lawson et al. Reference Lawson2006; Robinson et al. Reference Robinson2010; Lawson et al. Reference Lawson2011a, Reference Lawsonb; Chi et al. Reference Chi2013; Ganas et al. Reference Ganas2014; Zu Ermgassen et al. Reference Zu Ermgassen2016) and North America (Anderson et al. Reference Anderson2009; McBurney et al. Reference McBurney2015), however, in many other parts of the world the distribution of genotypes of Trichomonas gallinae remains largely uninvestigated with no major studies reported from Asia and the Indian subcontinent. This is a region where columbid populations such as the blue rock pigeon (Columba livia) occur in sympatric flocks and share roost with other avian species. Notably, the common mynah, Acridotheres tristis, is a passerine species described as the most invasive of all avian species. It occurs in mixed roosts with Columba livia and this close contact suggests that the species may share pathogens. Indeed it has been suggested that the invasive nature of Acridotheres tristis and its ability to adapt to new niches has meant that it is susceptible to a wide variety of parasite infections (Clark et al. Reference Clark2015) and we considered whether it might be susceptible to infection with Trichomonas gallinae and so might possess the potential to act a shuttling vector of avian trichomonas between the main Columba livia reservoir and other ecological niches to which it is able to adapt with increased exposure of infected birds to avian livestock being of particular concern.
The common mynah belongs to the order Passeriformes and like the starlings belong to the family Sturnidae. It is considered omnivorous, and constructs often large but mostly temporary roosts close to human habitation; inhabiting rural and urban gardens, cultivations among the university and college campuses and the road side light vegetation. The mynah has a relatively short home range of about 3–5 kms during its daily diurnal visitations. It feeds intensively on figs and seeds, unripe fruits, insects, small size frogs and snakes but may also take small, juvenile and dead birds on occasion.
Our study was based in the Indian subcontinent where Acridotheres tristis is native, from within a 20 km radius of Faisalabad. Faisalabad is the third most populous city in Pakistan, the second largest in the eastern province of Punjab and its latitude and longitude coordinates are 31.42°, 73.09°. The surrounding countryside, irrigated by the lower Chenab River, produces cotton, wheat, sugarcane, vegetables, fruits and tree plantations dominated by Salmalia malabarica, Terminalia arjuna, Cedrella toona, Dalbergia sissoo, Ficus bengalensis, Eucalyptus species, Mangifera dactylifera. Faisalabad has been classified as a hot desert climate (BWh) by the Köppen–Geiger climate classification system. In this region eight different sites were identified and selected with sympatric flocks of mynah and blue pigeons, i.e., University of Agriculture Faisalabad (UAF), Gatwala Forest plantation (GAT), Postgraduate agricultural research station (PARS), Amipur Canal Rest House (AMI), Satina Canal Rest House (SAT), Burala Canal Rest House (BRU), Tarkhani Canal Rest House (TAR) and Moongi Canal Rest House (MON). These study sites are divided into three categories, i.e., urban (UAF, GAT), semi-urban (PARS, AMI, SAT) and rural (BRU, TAR, MON) (Fig. 1).
Trichomonas gallinae is a frequent infection of common mynah (Acridotheres tristis) across the Faisalabad district. The map shows eight different ecological study sites. Prevalence of infection is indicated as the proportion of birds captured and released at each site. Overall prevalence is also noted. UAF, University of Agriculture Faisalabad; GAT, Gatwala Forest Plantation; PARS, Postgraduate Agricultural Research Station; AMI, Amipur Canal Rest House; SAT, Satina Canal Rest House; BRU, Burala Canal Rest House; TAR, Trkhani Canal Rest House; MON, Moongi Canal Rest House.
Materials and methods
Ethical approval
This work was approved by the Directorate of Graduate Studies and Research Board as permissible by the University of Agriculture, Faisalabad ethics committee. The approval number was 37195–98, dated 31.12.13.
Screening of mynah for Trichomonas gallinae
The mynahs were captured (N = 167), from different locations of Central Punjab with the mist nets. The nets were erected straight into the respective fields, close to the trees viz, Salmalia malabarica, Terminalia arjuna, Cedrella toona, Dalbergia sissoo, Ficus bengalensis, Eucalyptus species, which served as a roost to the majority of birds. The nets were carefully watched and mostly the mynahs were captured during the late evening hours; the time they return to roost. The captured population containing 75 males and 92 females from different locations of Faisalabad district were maintained in an aviary in the department (Zoology, Wildlife and Fisheries). Upon capture, birds were evaluated clinically on the basis of their body weight (g), wing length (mm), tarsus length (mm), tail length (mm), beak length (mm) and head circumference (mm). Birds were then screened for T. gallinae as follows: A sterile calcium-alginate cotton swab tip was inserted gently within the oral cavity of the common mynah to obtain the saliva coated swabs. The swabs were used to inoculate InPouchTM TV culture packs (BioMed Diagnostics, USA) according to the manufacturer's instructions (BioMed Diagnostics, Santa Clara, California, USA). Cultures were incubated (37 °C) to access the growth performance of the parasite (T. gallinae) for a period of 7–10 days. Trichomonosis cases confirmed microscopically from culture were subjected to the DNA extraction and subsequently genotyped.
Genotyping of mynah isolates
Trichomonas gallinae DNA was obtained from the parasite culture using QIAGEN mini kit according to the manufacturers instructions (QIAGEN, Valencia, California). We have previously proposed a simple binomial sequence-based genotyping system for Trichomonas gallinae based on the ITS region and Iron dehydrogenase (FeHyd) gene sequences, which is now widely adopted and undertaken routinely. Genotyping was undertaken essentially as previously described (Chi et al. Reference Chi2013). Briefly, DNA from T. gallinae cultures were subjected to ITS region amplification using TFR1 (TGCTTCAGTTCAGCGGGTCTTCC) and TFR2 (CGGTAGGTGAACCTGCCGTTGG) primers. A fragment of the Fe-hydrogenase gene was also amplified from positive samples TrichhydFOR (GTTTGGGATGGCCTCAGAAT) and TrichhydREV (AGCCGAAGATGTTGTCGAAT) primers. Negative (water) and positive (purified T. gallinae DNA from an infected greenfinch) controls were included in each polymerase chain reaction run. All amplicons were directly sequenced using a commercial service (Source BioScience, Nottingham, UK).
Results
Trichomonas gallinae is a common endemic infection of Acridotheres tristis
Based on 33 culture positives from 167 birds screened, we approximate the regional prevalence of Trichomonas gallinae to be 20%. Of those 33 birds that did culture positive just 11 exhibited markers of poor health/conditions and in just four cases were lesions in the upper digestive tract observable with most infected birds appearing to carry the infection asymptomatically (Table 1). We found infected mynah in each of the study locations (Fig. 1) indicating that the infection is widespread in this region. Interestingly, although at least some mynah were infected in each of the study sites, most of the infections detected were of male birds and the number of cases at BRU and AMI where contact between common mynah and blue pigeon is the most limited also showed the lowest infection rates.
Occurrence of different strains (Trichomonads) as isolated from the available bird species based on FeHyd gene with their GenBank reference
Trichomonas gallinae isolates from Acridotheres tristis are all of the C4 subtype
Genotypic analysis indicated that all the common mynah isolates among the Faisalabad samples shared the same genotype. Of the 33 sequences procured from mynah, all were identified to be T. gallinae (ribo)Type C by the finding that their sequences were identical to the Type C reference sequence EU215362. Similarly, all of the sequences obtained from the FeHyd amplicons were identical to the reference sequence KC529662 An illustrative phylogenetic tree is provided to show the evolutionary relationship of these isolates and other avian isolates which have previously been characterized (Fig. 2). The C4 genotype has previously been identified in UK and USA columbids (AA and KMT, unpublished) but this is the first description of this genotype from Asia/Indian-subcontinent or in a passerine species.
Trichomonas gallinae phylogeny using the neighbour-joining method for the FeHyd region from the sequences described in Table 2. Trichomonas vaginalis is included as an outgroup. The bootstrap consensus tree was constructed using the Tamura–Nei model and 2000 replicates. Tree topology was tested using 719 positions. †Finch Strain ‡Mynah Isolates.
Characteristic lesions (trichomonosis) of common mynah consistent with culture using the ITS region and FeHyd sequence
Discussion
A new genotype of Trichomonas gallinae in passerine birds
Our study reports the highest prevalence for T. gallinae carriage recorded for any passerine species and is the first example of a host species other than columbids in which the parasite is widely carried without apparent pathology. It is striking because all genotyped isolates associated with outbreaks of passerine disease have previously been caused by the A1 genotype which is associated with considerable pathogenicity and mortality, particularly in passerine hosts. In this study C4, a genotype that is less associated with such virulence characteristics than A1, is prevalent in live, asymptomatic birds suggesting that mynah has the potential to be a vector for this parasite between the main columbid reservoir and niches which ordinarily would be isolated from it. It is also interesting that in the UK where an epidemic caused by the A1 genotype finch strain of T. gallinae has been taking place since 2006, starlings (a very common species in the same family as the mynah, the Sturnidae) have not been one of at least 12 passerine species diagnosed with the disease by the Garden Wildlife Health project, a national wild bird disease surveillance programme (B. Lawson, personal communication).
Mynah – as a new reservoir or a dead end host?
On the basis of this study, we conclude that the common mynah has the potential to serve as a reservoir for avian trichomonosis throughout the study sites of Faisalabad, Pakistan and perhaps throughout its entire (tropical and subtropical) range. This finding is particularly concerning because of the recognized ability of mynah to adapt to new niches and particularly ones from which columbids may normally be excluded, extending the potential for exposure of susceptible domestic and wild avifauna to infection. Transmission of influenza from free-living mynah to farmed poultry has previously been demonstrated (Body et al. Reference Body2015) and similarly our observation of mynah infection by a known pathogen of avian livestock will be of particular concern to poultry producers where mynah may gain access to flocks. Nevertheless, the observations in this study do not in any way address transmission to and from the mynah as a host. We cannot yet speculate on whether the infections observed are spillover from sympatric columbids or passed within the species by other mynah. Certainly, mynah feed in sympatric flocks with blue rock pigeons throughout this region and so may be infected from them. It is also not clear whether mynahs pass the infections to partners and young or even whether the infection is normally pathogenic, fatal or resolves. It is also not clear why there is only one subtype discernable, whether susceptibility is limited to this subtype, whether it represents a mynah-adapted strain or whether the pathogenicity of other subtypes means they are quickly eliminated from mynah populations when transmissions do occur. These intriguing questions are though tractable, answering them will be important in gauging the risk posed by mynahs to other susceptible avian populations.
Acknowledgements
We thank Diana Bell, Becki Lawson, Andrew Cunningham and Johanna Nader for helpful and generous discussion and feedback.
Financial support
This study was financially supported by IRSIP project of the Higher Education Commission, Pakistan which included a travel to and support for HF while at the University of East Anglia. AA was supported by an award from the Saudi Arabian Cultural Embassy, London and by the King Saud University in Riyadh, Saudi Arabia.
Ethical approval
This work was approved by the Directorate of Graduate Studies and Research Board as permissible by the University of Agriculture, Faisalabad ethics committee. The approval number was 37195-98, dated 31.12.13.
Conflicts of interest
None.
