Introduction
Schistosomosis, a significant snail-borne blood fluke infection, affects approximately 200 million people and 165 million cattle across tropical and subtropical regions (Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012; Colley et al., Reference Colley, Bustinduy, Secor and King2014; Frahm et al., Reference Frahm, Anisuzzaman, Prodjinotho, Vejzagic, Verschoor and Prazeres da Costa2019; Anisuzzaman and Tsuji, Reference Anisuzzaman and Tsuji2020; Hossain et al., Reference Hossain, Hatta, Labony, Kwofie, Kawada, Tsuji and Alim2023). Within Asia, the species Schistosoma spindale, S. indicum, S. nasalis, and S. japonicum predominantly affect cattle (De Bont and Vercruysse, Reference De Bont and Vercruysse1997; Labony et al., Reference Labony, Hossain, Hatta, Dey, Mohanta, Islam, Shahiduzzaman, Hasan, Alim, Tsuji and Anisuzzaman2022; Anisuzzaman et al., Reference Anisuzzaman, Hossain, Hatta, Labony, Kwofie, Kawada, Tsuji and Alim2023). Particularly in India, S. spindale leads to substantial economic losses in livestock in terms of animal health and productivity due to visceral schistosomosis in ruminants (Sumanth et al., Reference Sumanth, D’Souza and Jagannath2004). Despite its prevalence, infections often remain undetected in field conditions due to factors such as the low fecundity of female schistosomes, the trapping of eggs in tissues, the masking of eggs by mucus, the uneven egg distribution in faeces, and the low egg output during mild infections (Lakshmanan et al., Reference Lakshmanan, Devada, Joseph, Gleeja, Aravindakshan, Himachala and Sankar2018). The infection exacerbates economic burdens by reducing growth, conception, and pregnancy rates in cattle, increasing vulnerability to other diseases and necessitating liver condemnation post-slaughter (McCauley et al., Reference McCauley, Majid and Tayeb1984; De Bont and Vercruysse, Reference De Bont and Vercruysse1997). Given these challenges, there is an urgent need for the development of enhanced and sensitive diagnostic methods that can detect low-intensity infections and facilitate widespread screening (Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012; Xu et al., Reference Xu, Zhang, Lin, Zhang, Xu, Liu, Hu, Qing, Xia and Pan2014). Current diagnostics rely heavily on crude schistosome antigens, like egg and somatic antigens, which often suffer from specificity issues because of cross-reactivity linked to glycoprotein presence (Alarcon de Noya et al., Reference Alarcon, Colmenares, Lanz, Caracciolo, Losada and Noya2000). Consequently, research has shifted towards more reliable alternatives such as purified and recombinant antigens, which demonstrate greater diagnostic efficacy (Doenhoff et al., Reference Doenhoff, Chiodini and Hamilton2004; Li et al., Reference Li, Wang, Fang, Nie, Zhou and Zhao2012). This focus highlights the potential of these innovations to significantly improve disease control strategies.
Approximately 43 tegumental proteins have been identified in schistosomes, most of which show no sequence similarity to proteins from other parasites (Fonseca et al., Reference Fonseca, Carvalho, Alves and DeMelo2012). The distinctiveness of these schistosome proteins, which are primarily located at the tegument—the initial point of contact with the host—plays a crucial role in the survival of the parasite (van Balkom et al., Reference van Balkom, van Gestel, Brouwers, Krijgsveld, Tielens, Heck and Van Hellemond2005; Hellemond et al., Reference Hellemond, Retra, Brouwers, van Balkom, Yazdanbakhsh, Shoemaker and Tielens2006). Additionally, the schistosome tegument is vital for host interaction, signal transduction, nutrition, excretion, osmoregulation, immune evasion, and modulation (Han et al., Reference Han, Brindley, Wang and Chen2009; Mulvenna et al., Reference Mulvenna, Moertel, Jones, Nawaratna, Lovas, Gobert, Colgrave, Jones, Loukas and McManus2010; Fonseca et al., Reference Fonseca, Carvalho, Alves and DeMelo2012; Anisuzzaman et al., Reference Anisuzzaman, Prodjinotho, Bhattacharjee, Verschoor and Prazeres da Costa2021). The antigenic properties of various schistosome tegumental proteins have been confirmed. Recently, a number of recombinant peptide antigens, including rSj23, rSm21.6, rSj29, and rSb22.6, have been developed to diagnose both animal and human schistosomosis (Li et al., Reference Li, Wang, Fang, Nie, Zhou and Zhao2012; Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012; Ren et al., Reference Ren, Liu, Liu, Zhu, Cui, Liu, Gao, Liu, Ji and Shen2017; Lv et al., Reference Lv, Hong, Fu, Lu, Cao, Wang, Zhu, Li, Xu, Jia, Han, Dou, Shen, Zhang, Zai, Feng and Lin2016). The 22.6-kDa tegument protein from S. bovis and S. mansoni has been evaluated and recognised as a promising tool for epidemiological surveillance. This protein has been noted to delay clotting by inhibiting thrombin, thereby altering host haemostasis. It is also unique in that it is non-glycosylated, reducing the likelihood of cross-reactions with related helminths (Pacifico et al., Reference Pacifico, Fonseca, Chiari and Oliveira2006; Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012).
Diagnosis of S. spindale in India has traditionally relied on whole worm antigens and excretory-secretory antigens (Sumanth et al., Reference Sumanth, D’Souza and Jagannath2003; Divya et al., Reference Divya, Lakshmanan and Subramanian2012; Murthy et al., Reference Murthy, D’Souza and Isloor2013; Lakshmanan et al., Reference Lakshmanan, Devada, Joseph and Radhika2016). Given the high prevalence of S. spindale in Indian dairy cattle, there is a need to identify, produce, and characterise a suitable diagnostic protein candidate and analyse its immunogenicity. This study was therefore designed to clone, express, purify, and assess the diagnostic potential of the recombinant 22.6-kDa tegument protein of S. spindale (rSs22.6).
Materials and Methods
Sample collection and RNA isolation
Adult schistosome worms were recovered from the mesentery samples of cattle slaughtered and were morphologically identified as S. spindale as per Kumar (Reference Kumar1999). The worms were washed several times in phosphate-buffered saline and were kept in RNA later solution at -20°C. RNA was isolated from S. spindale worms using TRI reagent (Sigma-Aldrich, Bangalore) according to the standard protocol suggested by the manufacturer. Reverse transcription was performed from total RNA extracted using Revert Aid First strand cDNA synthesis kit (Thermo Scientific, USA).
Amplification and cloning of 22.6-kDa tegument protein coding gene of S. spindale
The sequence of 22.6-kDa tegument protein coding gene of S. spindale (Ss22.6) was not available in GenBank and hence degenerate primers viz. ATGKCAACCGARACGARATTRAG (SS F), TTACTGAGATGGTGTTCTCC (SS R) used by Torre-Escudero et al. (Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012) for amplifying corresponding gene of S. bovis was used. Polymerase chain reaction (PCR) was performed in 25 μL of the reaction mix at an annealing temperature of 50°C for 30 sec. The amplified products were electrophoresed in 2% agarose gel and purified by elution method using GeNei TM Gel Extraction Kit according to the manufacturer’s protocol and was confirmed by dideoxy Sanger’s sequencing at AgriGenome Labs Private Limited, Cochin. The sequences were aligned and blasted using NCBI BLASTn tool for further confirmation.
The eluted product was then cloned into pJET cloning vector using cloneJET cloning kit (Thermo Scientific, USA) following the manufacturer’s instructions where blunt-end ligation was carried out. The transformation was then done in competent E. coli Top10 cells (Sambrook and Russell, Reference Sambrook and Russell2001). Appropriate negative controls with unligated vector were also processed simultaneously. After ascertaining the presence of positive clone by colony PCR using pJET primers, the positive clones were grown in Luria Bertani (LB) tubes containing LB broth with ampicillin (100 mg/ mL). The cloned plasmids were isolated using kit (Thermo Scientific, USA) and sequenced at AgriGenome Labs Private Limited, Cochin. The sequences were aligned using the BioEdit sequence alignment editor and blasted using NCBI BLASTn tool for further confirmation.
In silico analysis of 22.6-kDa tegument protein coding gene of S. spindale
The nucleotide sequences obtained was first subjected to BLAST analysis (http://blast.ncbi.nlm.nih.gov/blast) to ascertain the similarities of Ss22.6 sequences with the nucleotide sequences of the corresponding genes of different schistosomes. ’Translate’ tool (http://web.expasy.org/translate/) was used to translate the rSs22.6 coding genes to predicted amino acid sequences. The predicted protein sequences obtained from translate tool were then aligned with those of other schistosomes using BLASTp to assess interspecies similarity. The protein’s secondary structure and key characteristics were predicted using the self-optimised prediction method (SOPMA), which evaluated the proportions of alpha helices, beta turns, random coils, and extended strands in the rSs22.6 protein.
Parameters such as molecular weight and theoretical isoelectric point (pI) were predicted using the ProtParam tool (http://web.expasy.org/protparam/). The tool predicted the molecular weight of the protein theoretically by adding the average isotopic masses of amino acids in the protein sequence with the average isotopic mass of one molecule of water. The pI was calculated using previously described pK values of the amino acids. The SignalP 5.0 server (http://www.cbs.dtu.dk/services/SignalP/) predicted the presence and location of signal peptide cleavage sites in the amino acid sequences. The TMHMM Server v. 2.0, a membrane protein topology prediction method based on a hidden Markov model, was used to predict transmembrane helices and discriminate between soluble and membrane proteins with high accuracy. The Immune Epitope Database and Analysis Resource tool (www.iedb.org) was employed for linear epitope prediction, listing the possible number and composition of epitopes. The NCBI conserved domain search (https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) identified conserved domains in the rSs22.6 protein sequences, providing insights into the structure, sequence, and function relationships (Marchler-Bauer et al., Reference Marchler-Bauer, Derbyshire, Gonzales, Lu, Chitsaz, Geer, Geer, He, Gwadz, Hurwitz, Lanczycki, Lu, Marchler, Song, Thanki, Wang, Yamashita, Zhang, Zheng and Bryant2015). The tertiary structure was predicted using the SWISS MODEL Prot Param based on amino acid sequences (https://swissmodel.expasy.org/interactive) and the Pymol package was utilised for visualising the three-dimensional models generated (DeLano, Reference DeLano2002). The model developed in SWISS MODEL, available in pdb format, was utilised to predict parameters related to the protein’s geometry and stability. A Ramachandran plot of the predicted protein structure was generated using the PROCHECK tool in SAVES v 6.0 (https://saves.mbi.ucla.edu/). The MolProbity bioinformatics server validated three-dimensional atomic models of macromolecules, providing essential information on the Ramachandran plot and the protein’s geometric parameters such as favourable angles and bonds (http://molprobity.biochem.duke.edu/) offering insights into their conformational stability and overall quality.
A phylogenetic tree was constructed to elucidate evolutionary relationships between various schistosome species, based on multiple sequence alignment. The length of each pair of branches in the tree indicates the distance between sequence pairs, and the units at the bottom specify the number of substitution events. The evolutionary history was inferred using the maximum likelihood method based on the Tamura-Nei model in Mega 5.2 (Tamura and Nei, Reference Tamura and Nei1993; Tamura et al., Reference Tamura, Nei and Kumar2004; Tamura et al., Reference Tamura, Peterson, Peterson, Stecher, Nei and Kumar2011). The tree with the highest log likelihood (-1659.3968) was displayed, showing the percentage of trees in which the associated taxa clustered together, with standard error estimates obtained by a bootstrap procedure (1000 replicates).
Recombinant protein expression and purification
The amplification of the confirmed sequence of Ss22.6 for protein expression was carried out by PCR using primers which was custom designed to introduce a restriction site for BbsI restriction enzyme at its 5′ end. The primer sequences were designed such that BbsI digestion would create a staggered cut compatible with NcoI restriction digestion in the forward primer (5′-AATATTCTTATGAAGACACCATGGCAACCGAGACGAAATTAAGTTCAA-3′) and a staggered cut compatible with XhoI restriction digestion in the reverse primer (5′- TTAAAGTTTTGAAGACACTCGAGCTGAGATGGTGTTCTCCATGCT-3′). Amplification and purification were done per the previous protocol adopted for amplification of Ss22.6. The gel eluted PCR product was digested with the restriction enzyme, Bbs1 (New England BioLabs, USA). The expression vector, pET 28b (Novagen) was digested with the restriction enzymes NcoI and XhoI (Thermo Scientific, USA).
The digested Ss22.6 and the pET28b vector were ligated using T4 DNA Ligase (MBI Fermentas). Transformation was then carried out by mixing 5 μL of ligation reaction mixture with 50 μL of E. coli BL-21 competent cells that was prepared by CaCl2 method (Sambrook and Russell, Reference Sambrook and Russell2001). Colony PCR followed by agarose gel electrophoresis was done to confirm the presence of positive colonies.
The bacterial clones with the insert were grown in LB - Kanamycin (100 mg/ mL) broth overnight at 37°C under constant shaking and 1 mL was inoculated in 50 mL of LB medium and incubated until an OD600 of 0.6 was attained. Recombinant protein (rSs22.6) expression was then optimised with different concentrations (0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM and 1.0 mM) of isopropyl-β-d-thiogalactopyranoside (IPTG) (Sigma-Aldrich) for a period of 1 to 5 h. The induced BL21 cells were pelleted and lysed using cell lytic B-cell reagent (Sigma) according to the manufacturer’s protocol. The lysate was centrifuged, and the supernatant containing the soluble fraction of the expressed recombinant protein was collected for further purification using His-affinity chromatography. The pellet which contained the insoluble fraction of the expressed protein was resuspended in 50 μL of distilled water and kept at -20°C until use. Further, all the four portions (uninduced, induced, induced soluble, and induced insoluble) were analysed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). The supernatant containing the soluble fraction of expressed protein was loaded onto a Ni-NTA agarose column (Qiagen, Germany). The recombinant protein was then eluted under native conditions using a step gradient of increasing imidazole concentrations (20 mM to 250 mM).
Immunodiagnostic analysis of rSs22.6
The purity of the newly expressed rSs22.6 was analysed using SDS-PAGE (Laemmli, Reference Laemmli1970) in a vertical electrophoresis apparatus (Biorad, USA) followed by silver staining using kit (BioLit, Sisco Research Laboratories, Mumbai). The protein concentration of the most pure elute was estimated by spectrophotometer (Nanodrop 2000, Thermo Scientific, USA). Immunoprofiling was conducted using the Western blotting technique as described by Towbin et al. (Reference Towbin, Staehelint and Gordon1979), with slight modifications. Primary antibodies (known schistosome positive and negative bovine serum samples) were used at a dilution of 1:20 in blocking buffer, whereas rabbit anti-bovine IgG HRP conjugate was used as the secondary antibody at a dilution of 1:10,000 with blocking buffer. Sera from animals harbouring adult amphistomes in the rumen were used to verify the specificity of the antigen by Western blotting.
Evaluation of diagnostic potential of rSs22.6 using dot ELISA
Standardisation of rSs22.6 based dot ELISA was carried out using different dilutions of rSs22.6 antigen in carbonate bicarbonate buffer (500 ng/μL, 250 ng/μL, 100 ng/μL) and three different dilutions of bovine sera in blocking buffer (1:20, 1:50, and 1:100). Antibovine IgG-HRP conjugate at a dilution of 1:5000 was used as the secondary antibody and then subjected for chromogenic visualisation. Development of brown-coloured spots indicated a positive reaction. Further, the specificity and sensitivity of the assay were determined using the optimum dilutions of antigen and sera from specificity controls. Known schistosome positive, known schistosome negative, and amphistome positive sera available in the Department of Veterinary Parasitology, CVAS, Mannuthy were utilised as controls. Further field validation was done using the sera from cattle that harboured schistosomes in the mesentery (n = 50), known schistosome-negative animals using the sera from cattle that did not harbour schistosomes in the mesentery (n = 30) and from animals in which rumen harboured adult amphistomes (n = 30).
Results
Amplification of 22.6-kDa tegument protein coding gene of S. spindale
Amplification of the Ss22.6 produced a 541 bp product at an annealing temperature of 50°C. The nucleotide sequence displayed 96% similarity with the corresponding tegument protein coding gene of other schistosomes, as determined by the BLASTn tool (AB114680.1; EU595756.1; AY851615.1; XM_018788634.1). Further cloning of the sequence in pJET 1.2 blunt cloning vector resulted in approximately 10 colonies. Colony PCR and sequencing of these amplicons revealed a product size of 573 bp (Figure 1). BLASTn analysis of these amplicon sequences (accession number MN534767) showed 91 to 96% similarity with the tegument protein coding gene of other schistosomes (EU595756.1; AB114680.1; XM_051209117.1; AY851615.1; XM_018788634.1).
Amplicons of Ss22.6 gene. Agarose (2%) gel electrophoresis of colony PCR products of Ss22.6 gene (573 bp) of S. spindale isolated from bovine mesentery samples. M: 100-bp ladder, L1 and L2 amplicons.
In silico analysis of 22.6-kDa tegument protein coding gene of S. spindale
Nucleotide sequence analysis using BLASTn indicated a maximum similarity of 95.81% with the S. bovis 22.6-kDa protein mRNA and a similarity of about 95% and 91% with S. haematobium and S. mansoni sequences, respectively. Protein sequence prediction tools deduced 190 amino acids and the predicted protein sequence revealed structural similarity to S. bovis, S. mansoni, and S. haematobium 22.6 kDa sequences.(ACC78608.1; XP_018654157.1; XP_051074544.1). The predicted secondary structure showed that among the 190 amino acids majority formed alpha helices (47.89 %) involving 91 amino acids, 17 amino acids (8.95%) involved in the formation of beta turns, and 33 amino acids (17.37%) formed extended strands; the remaining 49 (25.79%) were associated with random coil structures (Figure 2). The molecular weight and pI of the rSs22.6 protein were determined to be 22628.92 Da and 6.76, respectively. The analysis of predicted amino acid composition highlighted lysine as the most common amino acid, constituting 10% of primary structure of the protein, followed by glutamate (9.5%), and isoleucine (7.9%). Histidine was the least prevalent amino acid accounting for 1.1% of the composition. The calculated grand value of hydropathy (GRAVY) score of -0.651 indicated the non-polar nature of the protein. Additionally, both the aliphatic index (71.84) and instability index (36.88) suggested the protein is stable. Subcellular location of rSs22.6 could not be confirmed as signal peptides or transmembrane helices were not detected (Supplementary file 1). Three possible linear antigenic epitopes were predicted out of which, one (having a score >0.8) was recommended by the server. The sequence that had the highest possibility to become a linear antigenic epitope was a 20 amino acid long sequence which obtained a score of 1.00. The protein exhibited two conserved domains, an EF-hand, a calcium binding domain at the N-terminus (residues 12–71) and a dynein light-chain domain at the C-terminus (residues 99–186) (Supplementary file 2). Analysis of the tertiary structure showed the presence of α helices and β sheets, with an EF-hand forming a helix-loop-helix domain (Figure 3). Of the total 168 residues in the selected model on the Ramachandran plot, 156 (92.9 %) were found in the most favoured regions, 10 residues (6.0 %) in additional allowed regions, and two serene residues in generously allowed regions and no residues in the disallowed regions (Figure 4).
Predicted secondary structure of rSs 22.6 protein. The predicted secondary structure of rSs22.6 with 190 amino acids, the majority of which formed alpha helices (47.89%) involving 91 amino acids, 17 amino acids (8.95%) involving in the formation of beta turns, 33 amino acids (17.37%) forming extended strands, and the remaining 49 (25.79%) involving in the formation of random coil structures.
Tertiary structure of rSs22.6 protein. Amino acid sequence and molecular modelling of the 22.6 kDa antigen from Schistosoma spindale (Ss22.6). One EF-hand motif highlighted in gold yellow and the dynein light-chain motif highlighted in olive green.
Ramachandran plot of predicted rSs22.6. Ramachandran plot of the selected model of predicted rSs22.6. Of the total 168 residues, 156 (92.9%) were in the most favoured regions (marked as A, B, L), 10 residues (6.0%) in additional allowed regions (marked as a, b, l, p), and two residues (1.2%) in generously allowed regions (marked as -a, -b, -l, -p) without any residues in the disallowed regions.
Phylogenetic analysis of the 22.6-kDa coding region of the newly expressed protein, using 1000 bootstraps, identified a sister clade to S. haematobium and S. bovis, and distinct from the clade containing S. japonicum. The phylogenetic tree showed robust bootstrap support, with values ranging from 70 to 100 (Figure 5). The distance matrix used to estimate evolutionary divergence between sequences indicated that the analysed sequence of S. spindale was closest to the gene sequence of S. bovis and most distant from S. japonicum.
Phylogenetic analysis of Ss22.6 gene. Phylogenetic tree using maximum likelihood method of S. spindale based on the analysis of 22.6-kDa coding gene sequences of the newly expressed protein. Haemonchus contortus is the outgroup. Bootstrap values (ranging from 70 to 100) are indicated in each node after 1000 replicates. GenBank accession numbers are given in front of each entry.
Expression of 22.6-kDa tegument protein coding gene of S. spindale
Expression of the confirmed sequence in E. coli BL21 cells resulted in the development of about 100 colonies. Colony PCR of these samples revealed a distinct band of approximately 573 bp, indicating the presence of the confirmed sequences after expression. The optimal induction of the rSs22.6 occurred with 0.6 mM IPTG over 4 h and hence the harvesting of the induced recombinant cells was done after 4 h of incubation.
Analysis of the newly expressed protein
The SDS-PAGE analysis confirmed the expression of rSs22.6 in the induced cells, whereas no expression was detected in the uninduced cells. The presence of the protein was detected in both insoluble and soluble fractions after centrifugation of the cell lysate. The soluble fraction was further subjected to purification. The most pure and concentrated fraction of rSs22.6 was observed in the elute with 150-mM concentration of imidazole buffer (Figure 6). A bright single band of approximately 22.6-kDa size without any nonspecific bands in silver-stained gels indicated the high purity of the protein (Figure 6). The concentration of rSs22.6 was estimated to be 2.5 mg/mL. Upon Western blotting with known schistosome positive sera, a single immunogenic band of 22.6-kDa size was observed. The absence of reactivity with known amphistome positive sera and known schistosome negative sera confirmed the specificity of rSs22.6 (Figure 7).
Antigen analysis by SDS PAGE and silver staining. (A) SDS-PAGE analysis of soluble fractions of rSs22.6 protein resolved in 12% gel after Coomassie Brilliant Blue Staining. Presence of the most pure and concentrated fraction of rSs22.6 in the elute with 150-mM concentration of imidazole buffer. M, Broad range protein marker. (B) SDS-PAGE analysis of most pure soluble fraction rSS22.6 protein resolved in 12% gel after silver staining. A bright single band of approximately 22.6-kDa size without any nonspecific bands indicating the high purity of the expressed protein. M, Broad range protein marker; L1, S. spindale sample.
Western blotting and dot ELISA of rSs 22.6 protein. (A) Immunoprofiling of rSs22.6 protein using the western blotting technique. L1, The absence of reactivity with known amphistome positive serum showing the specificity of rSs22.6. Lane M, Broad range protein marker. (B) Immunoprofiling of rSs22.6 protein using the western blotting technique. L2, A single immunogenic band of 22.6-kDa size showing reactivity of the protein with known schistosome positive serum. Lane M, Broad range protein marker. (C) Evaluation of diagnostic potential of rSs22.6 using dot ELISA. Known schistosome positive, known schistosome negative, and amphistome positive sera were utilized as controls. Development of brown-coloured spots in reaction with known schistosome positive serum indicated a positive result whereas absence of development of brown spots in reaction with known schistosome negative and amphistome positive sera samples indicated the absence of cross-reaction and specificity of the protein.
Diagnostic performance of rSS22.6 dot-ELISA
To further validate the diagnostic utility the protein was employed in dot ELISA for antibody detection from field samples. Antigen concentration of 500 ng/μL and sera dilution of 1:100 were found to be optimum for dot-ELISA using rSs22.6. Of the 50 known positive samples, rSs22.6 dot-ELISA revealed positive signals in 45, indicating a sensitivity of 90%. All the known schistosome-negative sera samples (n = 30) collected from cattle that did not harbour schistosomes in the mesentery were detected as negative by rSs22.6 dot-ELISA, indicating a 100% specificity for the diagnostic assay. In addition, rSs22.6 did not show any cross reaction with amphistome positive sera samples (Figure 7).
Discussion
Animal schistosomosis, a highly prevalent blood fluke infection caused by S. spindale, imposes significant financial burden on livestock farmers in India. The lack of sensitive parasitological techniques highlights the urgent need to develop improved diagnostics for this schistosome species. Among an array of immunogenic proteins, 22.6-kDa tegument protein is unique to the genus Schistosoma. Besides its homologues in S. mansoni (Sm22.6), S. japonicum (Sj22.6), and S. bovis (Sb22.6) have been shown to play a crucial role in resistance to reinfection in endemic areas, thus offering promise as an epidemiological tool for monitoring these infections (Dunne et al., Reference Dunne, Webster and Smith1997; Santiago et al., Reference Santiago, Hafalla and Kurtis1998; Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012). Functionally, 22.6-kDa tegument protein was reported to delay clotting by inhibiting thrombin, thus modulating haemostasis of the host. Additionally, the protein’s non-glycosylated nature reduced the likelihood of cross-reactions with related helminths. However, its presence and potential as a recombinant diagnostic antigen had not been previously explored in Indian schistosome species. In this study, the 22.6-kDa tegument protein of S. spindale (Ss22.6) was expressed in a prokaryotic system, characterised, and its diagnostic potential was validated through dot-ELISA for the first time
A 573-bp region corresponding to 22.6-kDa tegument protein coding gene of S. spindale amplified using cDNA of S. spindale was ascertained to be similar to the corresponding gene of other schistosomes. Further, in silico analysis was done to predict the characteristics of protein including pI, amino acid composition, functional properties, structural stability, secretory nature etc. Similarity analysis of nucleotide sequence and the predicted protein sequences of rSs22.6 confirmed the identity of this sequence with that of the related schistosomes viz. S. haematobium, S. bovis, and S. japonicum. Analysis of the secondary structure of rSs22.6 revealed high percentage of alpha helices suggestive of the involvement of hydrogen bonds in folding, stabilisation, and functioning of protein. The pI is an important factor that estimates the protein solubility, its electrophoresis, and electrophoretic separation. Proteins with a pI near the pH of their environment are typically electrically neutral and demonstrate reduced aggregation and precipitation. The pI of the rSs22.6 was determined to be 6.76, suggesting an average protein solubility and electrophoretic separation (Sawal et al., Reference Sawal, Nighat, Safdar and Anees2023). The predicted aliphatic index of rSs22.6 suggested that this protein could remain stable across a wide range of temperatures (Sivakumar et al., Reference Sivakumar and Balaji2018). A GRAVY score of -0.651 indicated the non-polar nature of rSs22.6, suggesting increased hydrophilic interactions (Magdeldin et al., Reference Magdeldin, Yoshida, Li, Maeda, Yokoyama, Enany, Zhang, Xu, Fujinaka, Yaoita, Sasaki and Yamamoto2012). Antigenic epitopes are specific regions on the protein surface preferentially recognized by B-cell antibodies. Predicting these antigenic epitopes provide critical insights for designing vaccine components and immunodiagnostic candidates (Ponomarenko and Regenmortel, Reference Ponomarenko and Regenmortel2009). One potential epitope within the rSs22.6 protein was identified by the server suggesting its suitability as diagnostic/vaccine candidate.
Analysis of the rSs22.6 using Signal P 5.0 indicated the absence of signal peptides. Typically, molecules that possess signal peptides or anchors are either excreted, secreted, membrane-anchored, or may interact directly with the host immune system (Dias et al., Reference Dias, Boroni, Rocha, Dias, Souza, Oliveira, Bitar, Macedo, Machado, Caliari and Franco2014). The lack of a signal peptide in the newly expressed protein implies that it is likely not secreted. Proteins lacking signal peptides might be secreted through alternate pathways like exosome release and direct translocation across the plasma membrane (Samoil et al., Reference Samoil, Dagenais, Ganapathy, Aldridge, Glebov, Jardim and Ribeiro2018). Consistent with this, Zhang et al. (Reference Zhang, Xu, Gan, Zeng and Hu2012) noted the absence of a signal peptide in the SjTP22.4 tegumental protein, suggesting its role as a transmembrane protein at the tegument surface. Analysis using TMHMM Server v. 2.0 confirmed the absence of transmembrane helices in the predicted protein sequence. The absence of a signal peptide and membrane anchoring motifs in rSs22.6 indicated that it might be a soluble cytoplasmic protein as was previously observed in its orthologues of Schistosoma spp., other schistosome tegument protein sequences viz. of Sm21.6 and Sb22.6 (Lopes et al., Reference Lopes, Paiva, Martins, Cardoso, Rajão, Pinho, Caliari, Oliveira, Mello, Leite and Oliveira2009; Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012) and in tegumental calcium-binding proteins in other trematodes (Vichasri-Grams et al., Reference Vichasri-Grams, Subpipattana, Sobhon, Viyanant and Grams2006).
The presence of an EF-hand domain, a calcium-binding domain, and a dynein light-chain domain in the conserved region of rSs22.6 allows for the modulation of protein conformation and activity in response to calcium signalling. Proteins with EF-hand domains are involved in various biological processes, including signal transduction, muscle contraction, and calcium homeostasis. Similarly, dynein light-chain motifs are crucial for protein-protein interactions, facilitating intracellular transport, cytoskeletal organisation, and vesicle trafficking. These motifs can impart specific functional properties to recombinant proteins, such as calcium sensitivity or interactions with cytoskeletal components (O’Connell et al., Reference O’Connell, Bauer, O’Brien, Johnson, Divizio and O’Kane2018; Struk et al., Reference Struk, Boer and Rigden2019). The presence of dynein-related proteins such as Sm21.7 and Sm22.6 primarily localised just beneath the plasma membrane forming a macromolecular complex were documented in tegument extracts (Braschi et al., Reference Braschi, Curwen, Ashton, Verjovski-Almeida and Wilson2006). These proteins provide structural scaffolding for the parasite tegument and play a crucial role in vesicle transport to the plasma membrane surface. Observations of the EF-hand domain and dynein light chain in various protein molecules of other schistosomes (Lopes et al., Reference Lopes, Paiva, Martins, Cardoso, Rajão, Pinho, Caliari, Oliveira, Mello, Leite and Oliveira2009; Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012; Zhang et al., Reference Zhang, Xu, Gan, Zeng and Hu2012) are consistent with those in rSs22.6.
Structural validation of the structure of rSs22.6 predicted using Ramachandran plot illustrated the statistical distribution of ϕ (phi) and ψ (psi) dihedral angles in a protein backbone. These angles, along with the omega angle formed by peptide bonds, characterise each residue in a polypeptide chain. This plot classifies regions into generously allowed, moderately allowed, and disallowed regions. A large number of dihedral angles found in the disallowed regions would indicate structural instability in the model. A good quality theoretically rendered protein structure would be expected to have over 90% of its residues in generously allowed region (Motamedi et al, Reference Motamedi, Alvandi, Fathollahi, Ari, Moradi, Moradi and Abiri2023; Sawal et al, Reference Sawal, Nighat, Safdar and Anees2023). The presence of a high % (92.9%) of amino acid residues in the most favoured regions without any residues in the disallowed region of Ramachandran plots and those geometrical parameters predicted by molprobity revealed that the constructed model of rSS22.6 is a structurally stable good quality model.
The evolutionary history deduced through phylogenetic analysis using the maximum likelihood method showed that a coding region of the rSS22.6 occurred as a sister clade to S. haematobium and S. bovis and was distinct from the clade containing S. japonicum. The phylogenetic analysis of mitochondrial gene sequences from a Kerala isolate of S. spindale had been previously reported to be distantly related to S. japonicum (Lakshmanan, Reference Lakshmanan2014). Barker and Blair (Reference Barker and Blair1996) had documented through phylogenetic analysis that S. spindale may have been brought to India and Southeast Asia from Africa by early humans.
After in silico characterisation of the coding sequences and ascertaining its structural stability, it was cloned initially in a cloning vector and then in expression vector. Although many expression studies opt to clone sequences directly into expression vectors (Peng et al., Reference Peng, Lee, Tsaihong, Cheng and Fan2008; Lopes et al., Reference Lopes, Paiva, Martins, Cardoso, Rajão, Pinho, Caliari, Oliveira, Mello, Leite and Oliveira2009; Zhang et al., Reference Zhang, He, He, Zong and Cai2015a), we cloned the rSs22.6 sequence initially in pJET cloning vector using Top10 E.coli cells (Torre-Escudero et al., Reference Torre-Escudero, Román, Sánchez, Barrera, Siles-Lucas and Oleaga2012; Zhang et al., Reference Zhang, Xu, Gan, Zeng and Hu2012). The robust transcription and translation of E. coli machinery supports the high-level production of heterologous proteins, with the system’s simplicity enabling rapid screening of expression constructs and optimisation of culture conditions (Rosano and Ceccarelli, Reference Rosano and Ceccarelli2014). Despite these benefits, challenges such as protein misfolding, aggregation, and host cell toxicity from overexpression of foreign proteins can affect yield and solubility. Strategies to address these challenges include the use of fusion tags, co-expressing chaperones, optimising culture conditions, and exploring alternative E. coli strains (Baneyx and Mujacic, Reference Baneyx and Mujacic2004). Alternative expression systems such as mammalian vectors (e.g., pCMV-Myc), eukaryotic HeLa cells, and yeast cells (e.g., Pichia pastoris) also provide options, although they come with challenges like instability and protein overexpression (Andrell and Tate, Reference Andrell and Tate2013; Qiu et al., Reference Qiu, Fu, Shi, Hong, Liu and Lin2013; Damasceno et al., Reference Damasceno, Ritter and Batt2017).
The expressed protein was purified using nickel affinity chromatography. The versatility of nickel affinity chromatography allows for the efficient purification of a broad spectrum of recombinant proteins from complex mixtures, including bacterial lysates and cell culture supernatants (Vieira Gomes et al., Reference Vieira Gomes, Souza Dias, Felli Venancio and Vicentini2014). Factors such as resin selection, buffer composition, pH, and the concentration of imidazole in the elution buffer significantly influences the efficiency of purification. Imidazole based elution buffers are widely adopted for purification of soluble fractions (Cai et al., Reference Cai, Bu, Wang, Wang, Zhong and Wang2008; Lopes et al., Reference Lopes, Paiva, Martins, Cardoso, Rajão, Pinho, Caliari, Oliveira, Mello, Leite and Oliveira2009; Qiu et al., Reference Qiu, Fu, Shi, Hong, Liu and Lin2013; Zhang et al., Reference Zhang, He, He, Zong and Cai2015a; Zhang et al., Reference Zhang, Fu, Li, Han, Cao, Han, Liu, Lu, Hong and Lin2015b; Lv et al., Reference Lv, Hong, Fu, Lu, Cao, Wang, Zhu, Li, Xu, Jia, Han, Dou, Shen, Zhang, Zai, Feng and Lin2016). In the present study, 2.5 mg/mL of protein was obtained using induction with 0.6 mM IPTG over 4 h followed by purification with 150 mM of imidazole-based buffer. Purification of proteins in their insoluble form requires denaturing conditions using either urea-based or guanidine hydrochloride-based elution buffers (Bornhorst and Falke, Reference Bornhorst and Falke2000). Besides, the design of the histidine tag, including its length and position within the protein sequence, can affect binding affinity and specificity. Optimisation of cell lysis conditions, including the selection of detergents and protease inhibitors, is also critical for minimising non-specific binding and maximising recovery of the target protein (Shi et al., Reference Shi, Yin, Guo, Guo, Liu and Li2018).
Accurate characterisation of expressed proteins was done by SDS-PAGE and Western blot analysis (Laemmli, Reference Laemmli1970; Towbin et al., Reference Towbin, Staehelint and Gordon1979; Sharma et al., Reference Sharma, Kaur, Goyal, Nisha and Vyas2020). The production of high-quality immunogenic rSs22.6 was indicated by the presence of single specific band by Western blotting using known schistosome positive and the absence of reactivity negative sera. This ensured the repeatability of methodological standardisation and ascertained the immunogenicity of the protein. Cross-reactivity between Schistosoma antigens and other trematode antigens is a significant issue in diagnosing various schistosome infections (Raso et al., Reference Raso, Vounatsou, Singer, N’Goran, Tanner and Utzinger2006; Brooker and Clements, Reference Brooker and Clements2009; Clements et al., Reference Clements, Deville, Ndayishimiye, Brooker and Fenwick2010). Here, the absence of reactivity with sera of amphistome positive animals ascertained the specificity of newly expressed protein. This study forms the first documentation of cloning and expression of 22.6 kDa tegumental protein in S. spindale and its utility as a diagnostic candidate.
For further validation, we utilised this rSs22.6 in a dot ELISA contemplating the possibility of developing a rapid and field-suitable antibody detection method for diagnosing bovine intestinal schistosomosis. A review of the existing literature revealed that recombinant antigens of S. spindale are yet to be employed in a suitable diagnostic assay. Pinto et al. (Reference Pinto, Kanamura, Silva, Rossi, de Andrade Júnior and Amato1995) conducted comparative studies using IgM and IgG dot-ELISA with egg and somatic antigens of S. mansoni and noted significant sensitivity and specificity, recommending dot ELISA for epidemiological studies to identify specific antibodies against schistosomes. Mafuyai et al. (Reference Mafuyai, Uneke, Njoku and Chuga2006) favoured dot ELISA over conventional parasitological methods for epidemiological studies of S. mansoni infection in humans in Nigeria. Similarly, Lakshmanan et al. (Reference Lakshmanan, Devada, Joseph and Radhika2016) endorsed ESA-based IgG dot-ELISA as a specific and sensitive assay for diagnosing S. spindale infections in cattle, suggesting that the use of highly purified antigens could reduce cross-reactivity with other helminths. Dot ELISA employing whole worm antigen has been reported to be less specific in diagnosing visceral schistosomosis in cattle and buffaloes due to potential cross-reactivity (Mott et al., Reference Mott, Dixon, Carter, Garcia, Ishi, Matsuda, Mitchell, Owhashi, Tanaka and Tsang1987; Montenegro et al., Reference Montenegro, Silva, Brito and Caravalho1999; Noya et al., Reference Noya, de Noya, Losada, Colmenares, Guzman, Lorenzo and Bermudez2002; Sudhakar et al., Reference Sudhakar, Murthy and Rajeshwari2017). In the current study, a recombinant form of the S. spindale antigen was used, offering a more purified version that exhibited no cross-reactivity with amphistome-positive sera, thereby potentially enhancing diagnostic accuracy.
Conclusion
This study documents the expression and evaluation of a novel recombinant immunogenic antigen of S. spindale (rSs22.6). The newly expressed protein demonstrated immunodiagnostic properties in both immunoblotting and in silico analyses. The diagnostic potential of rSs22.6 antigen was also effectively validated using dot ELISA, which showed high sensitivity and specificity, highlighting its suitability for diagnosing bovine intestinal schistosomosis under field conditions. Given these attributes, it is reasonable to conclude that rSs22.6 is a promising candidate antigen for the serodiagnosis of bovine intestinal schistosomosis.
Supplementary material
The supplementary material for this article can be found at http://doi.org/10.1017/S0022149X24000695.
Declaration of Competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements
The authors gratefully acknowledge the technical support of Kerala Veterinary and Animal Sciences University, Pookode, Kerala, India, for conducting the research. The authors are also grateful to The Director of CMFRI, Kochi, for permitting the authors to utilise the facilities of the institute. The financial assistance of Kerala State Council for Science Technology and Environment as SRS project granted to the second author (Grant file no. KSCSTE/2270/2018-SRS-LS) is acknowledged.
