Introduction
The South American tomato leaf miner Tuta absoluta is an invasive, devastating pest in Europe, Africa, and Asia (Acharya et al., Reference Acharya, Barman, Sharma, Kafle, Kim and Lee2023; Vivekanandhan et al., Reference Vivekanandhan, Swathy, Sarayut and Patcharin2024). It is a polyphagous insect pest, and considerably damages economically important Solanaceae crops such as potato, tomato, tobacco, eggplant, and sweet pepper in greenhouses and open fields on a global scale (Desneux et al., Reference Desneux, Luna, Guillemaud and Urbaneja2011; Brévault et al., Reference Brévault, Sylla, Diatte, Bernadas and Diarra2014; Mohamed et al., Reference Mohamed, Mahmoud, Elhaj, Mohamed and Ekesi2015; Abbes et al., Reference Abbes, Harbi, Elimem, Hafsi and Chermiti2016; Vivekanandhan et al., Reference Vivekanandhan, Swathy, Sarayut and Patcharin2024).
To mitigate the impact of T. absoluta, several management strategies have been implemented, including cultural practices (Acharya et al., Reference Acharya, Barman, Sharma, Kafle, Kim and Lee2023), mechanical methods (Adhikari et al., Reference Adhikari, Subedi, Gautam, Pandit and Sharma2019), physical methods (Adhikari et al., Reference Adhikari, Subedi, Gautam, Pandit and Sharma2019; Acharya et al., Reference Acharya, Barman, Sharma, Kafle, Kim and Lee2023), and biological control strategies (Ballal et al., Reference Ballal, Gupta, Mohan, Lalitha and Verghese2016; Kamali et al., Reference Kamali, Karimi and Koppenhöfer2018). Nevertheless, the application of synthetic pesticides is a routine control method (Zibaee et al., Reference Zibaee, Mahmood, Esmaeily, Bandani and Kristensen2018; Acharya et al., Reference Acharya, Barman, Sharma, Kafle, Kim and Lee2023). The widespread use of insecticides has led to high resistance of T. absoluta to abamectin, organophosphate, and pyrethroid insecticide products (Zibaee et al., Reference Zibaee, Mahmood, Esmaeily, Bandani and Kristensen2018). Application of chemical pesticides against this pest has also resulted in significant environmental harm, including contamination of soil and water, and negative effects on non-target species such as beneficial insects, birds, and aquatic organisms (Vivekanandhan et al., Reference Vivekanandhan, Swathy, Sarayut and Patcharin2024).
Due to the problems associated with insecticides, new strategies have been reported to enhance pest control. Among them, RNA interference (RNAi), an endogenous eukaryotic viral defence mechanism triggered by double-stranded RNA (dsRNA), is being developed as an alternative approach for pest management (Askew et al., Reference Askew, Edwards and Gatehouse2024; Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025), owing to its high specificity and low environmental impact (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025).
Successful application of RNAi in pest management depends mainly on two key factors: a proper delivery method and a suitable target gene (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025). T. absoluta is relatively sensitive to RNAi (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020; Rahmani and Bandani, Reference Rahmani and Bandani2021; Askew et al., Reference Askew, Edwards and Gatehouse2024). To date, oral administration, microinjection, and larva soaking have been employed in T. absoluta. For instance, ingestion of dsRNA absorbed by plant leaves using a leaflet delivery system or through root uptake has been applied to determine RNAi efficacy. The tested genes include ryanodine receptor (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019; Askew et al., Reference Askew, Edwards and Gatehouse2024, Reference Askew, Gatehouse and Edwards2025), Krüppel-homologue 1 (Wang et al., Reference Wang, Bi, Tang, Zhang, Huang, Wan, Lü and Liu2023), voltage-gated sodium channel (Nav), NADPH-cytochrome P450 reductase (CPR) gene (Li et al., Reference Li, Huang, Li, Edwards and Gatehouse2024), and three transient receptor potential channel genes (Wang et al., Reference Wang, Lin, Ji, Bi, Liu, Zhang, Wan and Lü2021). Consumption of leaves immersed or sprayed with synthesised dsRNAs has been reported to knock down DNA methylase 1 (Tang et al., Reference Tang, Zhang, Zhu, Bi, Wang, Ji, Ji, Ma, Huang, Zhang, Yang, Wan, Lü and Liu2024), v-ATPase subunit A (Camargo et al., Reference Camargo, Barbosa, Possignolo, Peres, Lam, Lima and Marques-Souza2016; Rahmani and Bandani, Reference Rahmani and Bandani2021), arginine kinase (ArgK) (Camargo et al., Reference Camargo, Barbosa, Possignolo, Peres, Lam, Lima and Marques-Souza2016), CYP9A306, and CYB5R (Ullah et al., Reference Ullah, Guru-Pirasanna, Gul, Panda, Murtaza, Zhang, Huang, Li, Desneux and Lu2025) genes. Similarly, oral administration of six dsRNAs generated by the Escherichia coli expression system can silence corresponding gene juvenile hormone inducible protein, juvenile hormone epoxide hydrolase, ecdysteroid 25-hydroxylase, chitin synthase a, carboxylesterase, and ArgK (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020). Moreover, microinjection of dsRNA targeting RyR, acetylcholinesterase (AChE), and nicotinic acetylcholine receptor alpha 6 (nAChR6) at the larval stage (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019), as well as chitin deacetylase 1 (CDA1) (Zhou et al., Reference Zhou, Zhang, Xu, Liu, Liu, Ma and Yang2024), has been documented. Injection of dsRNA during the pupal period has been reported to have a successful knockdown of chromatin-remodelling ATPase genes ISWI and BRM (Ji et al., Reference Ji, Wu, Bi, Wang, Zhang, Wan, Lü and Liu2022), and methoprene-tolerant (Zhang et al., Reference Zhang, Xu, Liu, Ma, Liu and Yang2024). In addition, dsCDA1 has been used to directly soak the third instar larvae (Zhou et al., Reference Zhou, Zhang, Xu, Liu, Liu, Ma and Yang2024). However, the RNAi efficacies of these dsRNA delivery methods have not been compared in T. absoluta.
It is well known that intrinsic molecular characteristics directly affect RNAi efficiency (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025). Thus, selecting a suitable target gene is critical for achieving effective RNAi. Generally, effective RNAi targets are characterised by 1) a low mRNA stability and a high turnover rate of the gene products (Guo et al., Reference Guo, Wang, Sinakevitch, Lei and Smith2018), 2) low gene expression levels (Asokan et al., Reference Asokan, Chandra, Manamohan and Kumar2013; Camargo Rde et al., Reference Camargo Rde, Herai, Santos, Bento, Lima, Marques-Souza and Figueira2015), and 3) no compensatory genes producing functionally redundant gene products (Peng, Reference Peng2019). A subset of housekeeping genes meets the three characteristics.
In the current study, we focused on the two issues in T. absoluta. Firstly, we randomly selected three housekeeping genes (TaArgK, TaRpL10, and TaRpS11) encoding ArgK, ribosomal protein L10 (RpL10), and ribosomal protein S11 (RpS11), and tested their RNAi efficacies. Secondly, we compared the RNAi efficacies of two dsRNA delivery methods. Finally, we propose that bacterially-expressed dsRpS11 and dsArgK may be used for the large-scale practical implementation to control T. absoluta.
Materials and methods
Insect
T. absoluta population was originally collected from Solanum lycopersicum L. in Aral Shehri city, Xinjiang Uygur Autonomous Region, China, in 2024. The population was routinely maintained in an insectary at 26 ± 1°C under a 16 h:8 h light-dark photoperiod and 50–60% relative humidity using detached leaves of potatoes or tomatoes growing in insecticide-free soil as food. The adults were fed with a 15% honey solution.
Selection of candidate genes for RNAi
A subset of housekeeping genes meets three characteristics of effective RNAi targets, i.e. 1) a low mRNA stability and a high turnover rate, 2) low gene expression levels, and 3) no compensatory genes. We randomly selected three housekeeping genes (TaArgK, TaRpL10, and TaRpS11).
The spatiotemporal expression profiles of TaArgK, TaRpL10, and TaRpS11 were determined. For temporal expression pattern measurement, the larvae from the eggs (2-day-old), neonates (2-day-old), second through the fourth larval instars, pupae (recently formed), and adults (newly emerged) were collected, and the total RNA samples were obtained for temporal expression analysis. Likewise, for spatial expression analysis, the head, fat body, epidermis, foregut, midgut, hindgut, and Malpighian tubules of the 2-day-old fourth instar larvae were dissected, and total RNA specimens were extracted for analysis of the tissue expression patterns. Each sample contained 20–30 individuals and was repeated three times.
Preparation of dsRNAs
Bacterially-expressed dsRNAs
Three highly efficient and specific siRNA fragments originated from TaArgK, TaRpL10, and TaRpS11 were selected using the siRNA online design website (http://sidirect2.rnai.jp/). Then, three pairs of primers were designed using the software Primer Premier 5.0 to amplify a cDNA including the siRNA fragments (Table S1). The targeted region was further BLAST (BLASTN) searched against T. absoluta transcriptome data (Yan et al., Reference Yan, Zhang, Xu, Wang and Yang2021) to identify any possible off-target sequences that had an identical match of 20 bp or more. As a control, a cDNA fragment was derived from enhanced green fluorescent protein (egfp) in Aequorea victoria, and the primers were designed.
To construct a dsRNA-expressing vector, the four fragments were respectively cloned using primer pairs in Table S1 into the L4440 plasmid (plasmid #1654; Addgene; Cambridge, MA, USA). E. coli HT115 (DE3) competent cells lacking RNase III were prepared using standard CaCl2 methodology. The ligation reactions were used to transform competent E. coli HT115 (DE3) cells by electroporation. Individual colonies of HT115 (DE3) were inoculated into Luria broth (LB) medium supplemented with 50 μg/mL kanamycin and 12.5 μg/mL tetracycline and cultured with shaking (250 rev/min) at 37°C overnight. The final OD600 value reached 1.0–1.2. Cells were induced to express dsRNA by adding 0.4 mmol/L isopropyl-β-D-thiogalactopyranoside and incubating for an additional 14 h at 37°C. The expressed dsRNA was extracted and confirmed by electrophoresis on 1% agarose gel (data not shown).
In order to obtain a five-fold concentrated dsRNA suspension, a total of 40 mL solution including bacterial cells was centrifuged at 5 000 × g for 10 min, and resuspended in 8 mL of 0.05 mol/L phosphate-buffered saline (PBS, pH 7.4).
In vitro preparation of dsRNAs
The above four fragments (dsArgK, dsRpL10, dsRpS11, and dsegfp) were respectively amplified by PCR using specific primers (Table S1) conjugated with the T7 RNA polymerase promoter (TAATACGACTCACTATAGGG). The dsRNAs were synthesised using the MEGAscript T7 High Yield Transcription Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The quality of the synthesised dsRNA was evaluated via agarose gel electrophoresis. DsRNA content (at a concentration of 5–8 μg/μL) was determined with the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The dsRNAs were kept at −80°C until use.
Quantification of dsRNA
The contents in bacterially-expressed dsRNA were estimated. The artificially synthesised dsegfp was diluted into a series of concentrations and was electrophoresed via agarose gel electrophoresis. The grey values of each band were determined by the ImageJ software. The standard curve was established between the grey value and dsRNA concentrations (Figure S1). To determine the content of a bacterially-expressed dsRNA, the suspension of the HT115 (DE3) clone expressing dsRNA was pre-treated with an ultrasonic wave, and extracted with STE buffer and a mixture of phenol, chloroform, and isopentanol (25:24:1). The resultant solution was electrophoresed, and the dsRNA content was evaluated by the corresponding grey value based on the established standard curve.
The total and consumed areas (cm2) of potato/tomato foliage were also tested using ImageJ software.
The volume of dsRNA solution attached to potato/tomato foliage was estimated as follows. A millilitre of the solution was used to immerse the potato/tomato foliage, which was first measured for its area. After 5 sec, the foliage was removed, and the remaining volume was detected.
The dsRNA amount ingested by a larva per day was calculated following the formula:
Ingested dsRNA = Consumed foliage area (cm2) × Attached dsRNA volume (μL/cm2) × Bacterially-expressed dsRNA concentration (μg/μL)
Comparison of RNAi efficacies of two delivery methods
Oral administration of bacterially-expressed dsRNAs
Three biologically independent experiments were carried out to determine RNAi efficiency of bacterium-derived dsArgK, dsRpL10, and dsRpS11, using bacterium-derived dsegfp as a control. In order to measure whether the plant leaves affect RNAi effectiveness, the suspension of the HT115 (DE3) clone expressed target dsRNA, or dsegfp (control), was used to dip fresh potato (for dsArgK and dsRpL10) or tomato (for dsRpS11) foliage for 5 s. The treated leaves were dried for 2 h under airflow on filter paper, and then placed in Petri dishes (5.0 cm in diameter and 1.5 cm in height). The healthy and active newly-moulted third instar larvae with uniform size and colour were selected and starved for 4 h before bioassay. Ten larvae in each replicate were transferred to each dish containing treated foliage.
Each treatment was replicated 12 (for dsArgK) or 15 (for dsRpL10 and dsRpS11) times. After treatment, the Petri dishes were kept in the laboratory. The plant leaves were replaced with corresponding freshly treated ones every day. Given that tomato is the preferred host and the larvae may consume more leaves and consequently ingest more dsRNA, 9 (for dsArgK) or 12 (for dsRpL10 and dsRpS11) replicates (10 × 9 or 10 × 12 larvae) were used to extract total RNA after 24, 48, and 72 hours (for dsArgK) or 24, 48 72, and 96 hours (for dsRpL10 and dsRpS11) post treatment to test RNAi efficacy, another three replicates (10 × 3 larvae) were used to observe defective phenotypes during a 2-week trial period.
Injection of in vitro prepared dsRNAs
Three biologically independent experiments were performed using newly moulted third instar larvae. The larvae were confined in a Petri dish (5.0 cm in diameter and 1.5 cm in height) and pretreated with CO2 for 5 min. Each larva was then stuck on a glass slide along the dorsal line, ventral face upward. Microinjection was performed using a Micro4 microinjector (Molecular Devices) at the metathorax or abdomen segment I. A total of 0.1 μL dsRNA solution was injected into each larva.
For each experiment, a group of 10 injected individuals was set as a replicate. Each treatment had 12 or 15 replicates. Nine (for dsArgK) or twelve (for dsRpL10 and dsRpS11) replicates were harvested for qRT-PCR to test RNAi efficacy. The other three replicates were used to phenotypic observations over a 2-week period.
Real-time quantitative PCR (qRT-PCR)
The RNA was extracted using the SV Total RNA Isolation System Kit (Promega, USA) and was subjected to DNase I to remove any residual DNA according to the manufacturer’s instructions. Quantitative mRNA measurements were performed by qRT-PCR in technical triplicate using two internal control genes (TaEF1α and TaRpL28, the primers listed in Table S3) according to the published results (Yan et al., Reference Yan, Zhang, Xu, Wang and Yang2021). Data were analysed by the 2−ΔΔCT method (Livak and Schmittgen, Reference Livak and Schmittgen2001), using the geometric mean of the two internal control genes for normalisation.
Data analysis
SPSS for Windows (Chicago, IL, USA) was used for statistical analyses. Results were presented as mean ± standard error (SE). The difference between dsegfp- and dsRNA-treated larvae was compared using a t-test; differences with a P-value <0.05 were considered significant.
Results
Expression profiles of TaArgK, TaRpl10, and TaRps11
In T. absoluta, three housekeeping genes, arginine kinase (TaArgK, MZ054821), ribosomal protein L10 (TaRpL10, MZ054827), and ribosomal protein S11 (TaRpS11, MZ054830) were selected (Yan et al., Reference Yan, Zhang, Xu, Wang and Yang2021). The expression levels were examined using qRT-PCR (fig. 1).
Temporal (A–C) and tissue (D–F) expression profiles of TaArgK, TaRpL10, and TaRpS11 in Tuta absoluta.
Figure 1 Long description
A set of six bar charts showing relative expression level of TaArgK, TaRpL10 and TaRpS11 across developmental stage time points and tissue categories. See long description.","Long_Description":"The image A showing a bar chart titled “TaArgK”. The vertical axis label is “Relative expression level” with tick labels 0.0, 0.5, 1.0, 1.5, 2.0. The horizontal axis categories are E, N, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 4d, P, A, with group labels “2nd instar”, “3rd instar”, “4th instar”. Bars rise from E to N and reach the highest bars around the early 2nd instar day labels near the 1.5 to 2.0 range, then decrease across later categories, with the lowest bars near the end categories around the 1.0 range. Each bar has a vertical line above it and small point markers above the line. The image B showing a bar chart titled “TaRpL10”. The vertical axis label is “Relative expression level” with tick labels 0.0, 0.5, 1.0, 1.5, 2.0. The horizontal axis categories are E, N, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 4d, P, A, with group labels “2nd instar”, “3rd instar”, “4th instar”. Most bars cluster between about 1.0 and 1.5. A higher section appears around the 4th instar day labels, with bars approaching the 1.5 to 2.0 range, followed by lower bars at P and A near the 1.0 range. Each bar has a vertical line above it and small point markers above the line. The image C showing a bar chart titled “TaRpS11”. The vertical axis label is “Relative expression level” with tick labels 0.0, 1.0, 2.0, 3.0, 4.0. The horizontal axis categories are E, N, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 0d, 1d, 2d, 3d, 4d, P, A, with group labels “2nd instar”, “3rd instar”, “4th instar”. Bars increase from E and N into the instar day categories, with several bars in the middle categories reaching around the 2.0 to 3.0 range. Later categories trend downward, with P and A lower than the mid-series bars. Each bar has a vertical line above it and small point markers above the line. The image D showing a bar chart titled “TaArgK”. The vertical axis label is “Relative expression level” with tick labels 0.0, 0.3, 0.6, 0.9, 1.2, 1.5. The horizontal axis categories are H, FG, MG, HG, FB, EP, HE. The highest bars are around FG, MG and HG near the 1.2 to 1.5 range. Lower bars appear at EP and HE near the 0.9 to 1.2 range. Each bar has a vertical line above it and small point markers above the line. The image E showing a bar chart titled “TaRpL10”. The vertical axis label is “Relative expression level” with tick labels 0.0, 0.5, 1.0, 1.5, 2.0. The horizontal axis categories are H, FG, MG, HG, FB, EP, HE. Bars rise from H and FG to MG and HG, with the highest bars near MG and HG around the 1.5 to 2.0 range. Bars at FB, EP and HE are lower, around the 1.0 to 1.5 range. Each bar has a vertical line above it and small point markers above the line. The image F showing a bar chart titled “TaRpS11”. The vertical axis label is “Relative expression level” with tick labels 0.0, 0.5, 1.0, 1.5, 2.0. The horizontal axis categories are H, FG, MG, HG, FB, EP, HE. Bars are highest around FG and MG near the 1.5 to 2.0 range. A lower bar appears at FB near the 1.0 range, with EP and HE between about 1.0 and 1.5. Each bar has a vertical line above it and small point markers above the line. Across the six bar charts, images A to C use the E, N, day-labeled categories and the “2nd instar”, “3rd instar”, “4th instar” group labels, while images D to F use the tissue category labels H, FG, MG, HG, FB, EP, HE. All charts use “Relative expression level” on the vertical axis and show bars with vertical lines and point markers above each bar.
According to the temporal expression profiles, the mRNA levels of TaArgK, TaRpL10, and TaRpS11 were detectable throughout the whole development excursion, egg to adult stage. During larval development, the ratio of the highest to lowest levels was less than 3, indicating stable expression of the three genes (fig. 1A–1C).
The tissue expression patterns of TaArgK, TaRpL10, and TaRpS11 were also determined in the 2-day-old fourth-instar larvae. The mRNA levels of the three genes were measurable in the head, foregut, midgut, hindgut, fat body, epidermis, and hemolymph. They were evenly transcribed in these tissues (fig. 1D–1F).
Based on these results, stable expression of TaArgK, TaRpL10, and TaRpS11 throughout the developmental stages and among various tissues is consistent with a common notion that they are housekeeping genes.
Quantification of dsRNA
In order to compare RNAi efficacies between different delivery methods, the total dsRNA amounts delivered into the larval body were first estimated between oral administration of bacterially-expressed and microinjection of in vitro biosynthesised dsRNAs (fig. 2).
Quantification of dsRNA introduced into the Tuta absoluta by oral administration (A–D) and microinjection (E, F).
Figure 2 Long description
Panel A shows a bar graph with water volume in microliters per square centimeter on the y-axis, comparing Potato and Tomato. Potato is approximately 10, while Tomato is around 6. Panel B displays a scatter plot of consumed diet in square centimeters per larva, with Potato and Tomato showing similar spread. Panel C presents a bar graph of bacterially-expressed dsRNA in micrograms, comparing 1.0 times and 5.0 times doses. The 5.0 times dose is significantly higher, around 1.4 to 1.5 micrograms, compared to approximately 0.2 micrograms at 1.0 times. Panel D features a line graph of accumulated dsRNA in micrograms per larva over 24, 48 and 72 hours. The solid line represents Tomato and the dashed line represents Potato. Tomato rises to about 16 to 17 micrograms, while Potato reaches around 9 to 10 micrograms by 72 hours. Panel E shows a bar graph of synthesized dsRNA in micrograms, with a single bar around 8 micrograms. Panel F displays a bar graph of control dsRNA in micrograms per larva, with a single bar around 0.8 micrograms. The panels collectively illustrate the relationship between intake measures, dsRNA dose and time, affecting accumulated dsRNA and control or synthesized amounts.
Given that the fresh potato foliage was used in two experiments using dsegfp and dsArgK, and dsegfp and dsRpL10 pairs, and that tomato leaves were used in dsegfp and dsRpS11 treatment, we first measured the amount of dsRNA solution attached to the foliar surface. The measurement showed that the amounts were 10.32 and 6.36 μL/cm2 for potato and tomato foliage, respectively (fig. 2A).
The consumed foliage areas by a third-instar larva per day were tested. The areas were 0.37 and 0.34 cm2 for potato and tomato leaves (fig. 2B). We also estimated the concentration of bacterially-expressed dsRNA; the average concentration was 0.3 μg/μL (fig. 2C).
Taken together, we can calculate the dsRNA contents were 5.55, 11.1, and 16.65, and 3.06, 6.12, and 9.18 μg, after the third instar larvae ingested potato and tomato foliage for 24, 48, and 72 hours (fig. 2D).
Moreover, we also evaluated the dsRNA content delivered into the third instar larvae by microinjection. The average dsRNA concentration was 7.12 μg/μL (fig. 2E), and a microinjection of 0.1 μL introduced a total of 0.71 μg of dsRNA into the larva (fig. 2F).
Comparison of RNAi efficacies of two delivery methods
Ingestion of bacterially-expressed dsArgK
TaArgK mRNA levels were measured 24, 48, and 72 hours after ingestion. The results showed that the mRNA levels of this gene were significantly decreased by 17.8%, 32.1%, and 42.2%, respectively (P < 0.01 for 24 and 72 hours, P < 0.05 for 48 hours) (fig. 3A).
RNAi effectiveness targeting TaArgK in Tuta absoluta.
Figure 3 Long description
The composite figure contains five panels labeled A through E, showing the effects of dsArgK treatment compared to dsegfp control on gene expression, larval mortality, adult eclosion and larval appearance. Image A shows a bar graph with the x-axis labeled hours after exposure to dsRNA-treated leaf, with time points at 24, 48 and 72 hours. The y-axis is labeled relative expression level, ranging from 0 to 1. At 24 hours, dsArgK bars show a reduced expression level compared to dsegfp, marked with double asterisk indicating P less than 0.01. At 48 hours, dsArgK bars show further reduced expression, marked with single asterisk indicating P less than 0.05. At 72 hours, dsArgK bars show the lowest expression level among the three time points, again marked with double asterisk indicating P less than 0.01. Image B shows a single larva labeled dsegfp with a scale bar of 200 micrometers. The larva appears intact and fully formed. Image C shows four larvae labeled dsArgK, each with a scale bar of 200 micrometers. The larvae appear smaller and show visible abnormalities compared to the dsegfp larva in image B. Image D shows a bar graph with the x-axis labeled dsegfp and dsArgK. The y-axis is labeled larva mortality left parenthesis percent right parenthesis. The dsArgK bar is notably taller than the dsegfp bar, marked with a single asterisk. Image E shows a bar graph with the x-axis labeled dsegfp and dsArgK. The y-axis is labeled adult eclosion left parenthesis percent right parenthesis, ranging from 0 to 100. The dsegfp bar reaches close to 100 percent while the dsArgK bar is markedly lower, marked with a single asterisk.
Consumption of dsArgK affected larval survival. The dsegfp-ingested control larvae had a deep brown head and a highly pigmented and hardened pronotum. The meso and metathoraces, and abdomen segments are soft and light yellow in colour (fig. 3B). Conversely, the body colour of 19.1% of TaArgK RNAi larvae became whitish. They gradually dried and wrinkled, and ultimately died, with the mortality of dsArgK-ingested larvae significantly higher than that of dsegfp-ingested control (P < 0.05) (fig. 3C, 3D).
Moreover, TaArgK RNAi also negatively affected pupation and adult eclosion. When the dsegfp-ingested control larvae pupated and emerged, 33.6% of the TaArgK RNAi specimens failed to emerge as adults. Compared to the dsegfp-ingested control treatment, the adult eclosion rate was significantly reduced (P < 0.05) (fig. 3E).
Ingestion of bacterially-expressed dsRpL10
Ingestion of dsRpL10 resulted in obvious RNAi efficacy (fig. 4). Feeding dsRpL10-immersed foliage reduced its target mRNA level by 55.4%, 37.6%, 33.7%, and 37.6%, respectively, after the larvae ingested the leaves for 24, 48, 72, and 96 hours. Significant differences were found between the dsegfp- and dsRpL10-ingested groups (P < 0.0001 for 24 hours, P < 0.05 for 48 hours, and P < 0.01 for 72 and 96 hours) (fig. 4A).
RNAi effectiveness targeting TaRpL10 in Tuta absoluta.
Figure 4 Long description
The image A showing a bar chart with the y-axis label “Relative expression level” and tick labels 0, 0.5, 1.0 and 1.5. The x-axis label is “Hours after exposed to dsRNA-treated leaf” with tick labels 24, 48, 72 and 96. A legend shows “dsegfp” and “dsRpL10”. At 24 hours, the dsegfp bar is at 1.0 and the dsRpL10 bar is at 0.446. At 48 hours, the dsegfp bar is at 1.0 and the dsRpL10 bar is at 0.624. At 72 hours, the dsegfp bar is at 1.0 and the dsRpL10 bar is at 0.663. At 96 hours, the dsegfp bar is at 1.0 and the dsRpL10 bar is at 0.624. Significance markers above the groups read “asterisk asterisk asterisk asterisk” over 24, “asterisk” over 48, “asterisk asterisk” over 72 and “asterisk asterisk” over 96. Red points are plotted over each bar. The image B showing a specimen labeled “dsegfp” above the image. A scale bar below reads “500 micrometer”. The image C showing two specimens with the label “dsRpL10” above the image. A scale bar below reads “500 micrometer”. The image D showing a bar chart with the y-axis label “Larval mortality (percent)” and tick labels 0, 2, 4, 6, 8 and 10. The x-axis has two category labels: “dsegfp” and “dsRpL10”. The dsegfp bar is at 0.8 and the dsRpL10 bar is at 8.0. A significance marker above the bars reads “asterisk asterisk”. Red points are plotted over each bar. The image E showing a bar chart with the y-axis label “Adult eclosion (percent)” and tick labels 0, 20, 40, 60, 80 and 100. The x-axis has two category labels: “dsegfp” and “dsRpL10”. The dsegfp bar is at 90 and the dsRpL10 bar is at 75. A significance marker above the bars reads “asterisk”. Red points are plotted over each bar.
Feeding the dsRpL10-immersed foliage affected larval growth. Compared to the dsegfp-ingested group, the dsRpL10-ingested larvae had a smaller body size (fig. 4B versus fig. 4C).
Moreover, ingesting dsegfp- and dsRpL10-dipped foliage led to 0.9% and 7.9% larval lethality (P < 0.01) (fig. 4D). Finally, 90.5% and 72.8% individuals in the dsegfp- and dsRpL10-consumed groups eclosed as adults, respectively (fig. 4E). Significant differences were noted between the dsegfp- and dsRpL10-ingested groups (P < 0.05) (fig. 4D, 4E).
Ingestion of bacterially-expressed dsRpS11
Similarly, ingestion of dsRNA targeting TaRpS11 lowered its target mRNA level. After the larvae fed the dsRNA-treated leaves for 24, 48, 72, and 96 hours, TaRpS11 mRNA levels were respectively declined by 39.4%, 45.5%, 77.8%, and 82.8%, significantly lower than those in the control group (P < 0.01, 0.001, and 0.0001 for 24, 48, and 72/96 hours) (fig. 5A).
RNAi effectiveness targeting TaRpS11 in Tuta absoluta.
Figure 5 Long description
"The composite figure contains six panels labeled A through F. Panel A is a bar graph. The x-axis is labeled 'Hours after exposed to dsRNA-treated leaf' with values at 24, 48, 72 and 96 hours. The y-axis is labeled 'Relative expression level' with values ranging from 0 to 1. Two groups are compared at each time point: dsegfp and dsRpS11. The dsegfp bars remain near 1.0 across all time points. The dsRpS11 bars show lower values, approximately 0.6 at 24 hours, approximately 0.55 at 48 hours, approximately 0.2 at 72 hours and approximately 0.2 at 96 hours. Red data points are plotted on each bar, representing individual replicates. Asterisks above the dsRpS11 bars indicate significant differences, with two asterisks at 24 hours, three asterisks at 48 hours and four asterisks at 72 and 96 hours. Panels B, C and D show representative photographs of larvae. Panel B is labeled dsegfp. Panels C and D are labeled dsRpS11. Each image includes a scale marker reading 500 micrometers. Panel E is a bar graph comparing larval mortality between dsegfp and dsRpS11. The x-axis shows the two groups and the y-axis is labeled 'Larva mortality left parenthesis percent right parenthesis'. The dsegfp bar is near 0 to 2 percent and the dsRpS11 bar reaches approximately 18 to 20 percent. Red data points are visible. Three asterisks indicate significant difference. Panel F is a bar graph comparing adult eclosion. The x-axis shows dsegfp and dsRpS11 and the y-axis is labeled 'Adult eclosion left parenthesis percent right parenthesis'. The dsegfp bar is near 95 to 100 percent and the dsRpS11 bar is approximately 40 to 60 percent. Red data points are visible. Two.
Consumption of dsRpS11 affected larval survival. In contrast to light yellow dsegfp-injected control larvae (fig. 5B), the body colour of 17.4% of TaRpS11 RNAi larvae became whitish (fig. 5C). They gradually dried and wrinkled, and ultimately died, with the mortality of dsRpS11-ingested larvae significantly higher than that of dsegfp-ingested control (P < 0.001) (fig. 5D, 5E).
Likewise, TaRpS11 RNAi also negatively influenced pupation and adult emergence. The emergence percentages of the control and TaRpS11 RNAi groups were 100.0% and 55.0%, respectively, with the former significantly higher than the latter (P < 0.01) (fig. 5F).
Administration of dsRNA by microinjection
Using newly moulted third instar T. absoluta larvae, three biologically independent experiments were carried out by microinjection. The RNAi efficacy of dsegfp and dsArgK, dsegfp and dsRpL10, and dsegfp and dsRpS11 was compared (fig. 6).
Microinjection of dsArgK, dsRpL10, or dsRpS11 fails to cause RNAi efficacy in Tuta absoluta.
Figure 6 Long description
The image contains twelve bar charts labeled A through L, grouped by three dsRNA treatment comparisons. Each group covers four outcome measures: relative expression level over time, larval weight over time, larval mortality percent and adult eclosion percent. Two bar styles appear in each chart: one representing dsegfp and one representing the target dsRNA. Significance is marked either as ns indicating no significant difference, or an asterisk indicating a significant difference. Charts A through D cover the dsArgK treatment group. Chart A plots relative expression level on the y-axis against hours after dsRNA injection on the x-axis at 24, 48 and 72 hours. Both dsegfp and dsArgK remain near 1.0 across all timepoints, with ns markers at each. Chart B plots larval weight in milligrams on the y-axis against 24, 48 and 72 hours on the x-axis. Both groups show similar weight values near 1.0 to 2.0 milligrams across timepoints, all marked ns. Chart C shows larval mortality percent comparing dsegfp and dsArgK as a single paired comparison. Both values remain near 0 percent, marked ns. Chart D shows adult eclosion percent for dsegfp and dsArgK. Both values appear near 80 to 90 percent, marked ns. Charts E through H cover the dsRpL10 treatment group. Chart E plots relative expression level against 24, 48, 72 and 96 hours. Both dsegfp and dsRpL10 remain near 1.0 across all timepoints, all marked ns. Chart F plots larval weight in milligrams against 24, 48, 72 and 96 hours. Both groups show similar weights near 1.0 to 2.5 milligrams, all marked ns. Chart G shows larval mortality percent for dsegfp and dsRpL10. The dsRpL10 group shows a notably higher mortality value, approximately 5 to 8 percent compared to near 0 percent for dsegfp, marked with an asterisk indicating a significant difference. Chart H shows adult eclosion percent for dsegfp and dsRpL10. Both values appear near 80 to 90 percent, marked ns. Charts I through L cover the dsRpS11 treatment group. Chart I plots relative expression level against 24, 48, 72 and 96 hours. Both dsegfp and dsRpS11 remain near 1.0 across all timepoints, all marked ns. Chart J plots larval weight in milligrams against 24, 48, 72 and 96 hours. Both groups show similar weights near 1.0 to 2.5 milligrams, all marked ns. Chart K shows larval mortality percent for dsegfp and dsRpS11. Both values remain near 0 percent, marked ns. Chart L shows adult eclosion percent for dsegfp and dsRpS11. The dsRpS11 group shows a notably lower eclosion value, approximately 60 to 70 percent compared to approximately 85 to 90 percent for dsegfp, marked with an asterisk indicating a significant difference.
The target mRNA levels between control and treatment were compared 24, 48, and 72 hours (for dsegfp and dsArgK pair), or 24, 48, 72, and 96 hours (for dsegfp and dsRpL10, and dsegfp and dsRpS11 pairs) after dsRNA injection. To our surprise, no significant reduction of target mRNA contents was discovered (P > 0.05) (fig. 6A, 6E, 6I).
The larval weights (fig. 6B, 6F, 6J), mortalities (fig. 6C, 6G, 6K) and adult emergence percentages (fig. 6D, 6H, 6L) were observed over a 2-week period in the three biologically independent experiments. Significant differences were uncovered in the larval lethality between dsegfp and dsRpL10 treatment (P < 0.05) (fig. 6G), and in the adult emergence percentage between dsegfp and dsRpS11 treatment (P < 0.05) (fig. 6L).
Discussions
In the current paper, our results revealed that RNAi was achievable in T. absoluta, similar to the previously documented results (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020; Askew et al., Reference Askew, Edwards and Gatehouse2024).
Oral administration of bacterially-expressed dsRNA
It is well known that the E. coli HT115 (DE3) strain, which lacks RNase III activity, has been extensively used (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020) to scalably, safely, and cost-efficiently produce dsRNA for research and for large-scale agricultural implementation (Zhang et al., Reference Zhang, Khan, Heckel and Bock2017; Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025). Therefore, we determined the RNAi efficacy of oral administration of E. coli-generated dsRNA in the present paper.
Our results revealed that oral administration of dsRNA targeting TaArgK, TaRpL10, and TaRpS11 by the third-instar larvae significantly reduced corresponding mRNA levels, caused larval lethality and impaired adult emergence in T. absoluta (figs 2–4). In accordance with our results, six dsRNAs generated by the E. coli expression system can successfully silence juvenile hormone inducible protein, juvenile hormone epoxide hydrolase, ecdysteroid 25-hydroxylase, chitin synthase a, carboxylesterase, and ArgK. The oral administration increases larval mortality and seriously impacts larval development in T. absoluta (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020).
Spray-induced gene silencing (SIGS) is one of the most prominent field-compatible approaches. The effectiveness of this method has been demonstrated in several studies. For example, dsRNA spraying to Hordeum vulgare reduces gene expression by 60% in Sitobion avenae, demonstrating phloem-mediated uptake and systemic transport (Biedenkopf et al., Reference Biedenkopf, Will, Knauer, Jelonek, Furch, Busche and Koch2020). Similar results were reported in Fraxinus pennsylvanica, where foliar-applied dsRNA targeting Agrilus planipennis triggers RNAi; the effects last up to 21 days (Pampolini and Rieske, Reference Pampolini and Rieske2023). Other successful applications include the control of Brassicogethes aeneus in Brassica napus and the protection of stored Oryza sativa grains from Rhyzopertha dominica (Willow et al., Reference Willow, Soonvald, Sulg, Kaasik, Silva, Taning, Christiaens, Smagghe and Veromann2020; Chen et al., Reference Chen, Xu, Chen, Tang and Wang2025). In 2021, CalanthaTM (Ledprona) has been approved by the EPA to control Leptinotarsa decemlineata (Rodrigues et al., Reference Rodrigues, Mishra, Sridharan, Barnes, Alyokhin, Tuttle, Kokulapalan, Garby, Skizim, Tang, Manley, Aulisa, Flannagan, Cobb and Narva2021). Additionally, other sprayable RNAi products are still under development, including those targeting the canola flea beetle, diamondback moth, and Colorado potato beetle (Lu et al., Reference Lu, Deng, Zhu, Wu, Zhong, Wen and Yu2023).
Our results (this study) and those previously reported (Bento et al., Reference Bento, Marques, Campana, Demétrio, Leandro, Parra and Figueira2020) give a possibility that bacterially-expressed dsRNA can be used via SIGS method in the field to protect growing crops against T. absoluta.
RNAi efficacy varies in a gene-dependent manner
In this study, the average reduction of target mRNA by ingestion of E. coli generated dsArgK, dsRpL10, or dsRpS11 was 30.7%, 41.1%, and 61.4%, respectively, in T. absoluta (figs. 3–5). RNAi efficacy, ranked from the highest to the lowest, was dsRpS11, dsRpL10, and dsArgK, with the highest being two-fold more than the lowest. Consistently, RNAi efficacy also differs among genes in other Lepidopterans, as well as Orthopterans, Hemipteran, and Coleopteran (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025). For instance, of 24 genes examined by RNAi in Cylas puncticollis, silencing 12 genes induces almost 100% morality at 14 days post-injection (Prentice et al., Reference Prentice, Christiaens, Pertry, Bailey, Niblett, Ghislain, Gheysen and Smagghe2017). In T. castaneum, only 11 highly efficient RNAi targets are documented among 111 non-sensory G protein-coupled receptors (GPCRs). RNAi of eight GPCR genes causes >90% mortality, with dopamine-2-like receptor and latrophilin receptor being best (Bai et al., Reference Bai, Zhu, Shah and Palli2011).
In the current article, we found that ingestion of E. coli generated dsArgK, dsRpL10, or dsRpS11 caused 19.1%, 7.9%, and 17.4% of larval lethality, and reduced adult emergence by 33.6%, 27.2%, and 45.0%, respectively (figs. 3–5). As for the RNAi target genes, they should be lethal to T. absoluta upon silencing. Therefore, TaRpS11 is the best RNAi target gene, followed by TaArgK. Consistently, some genes are better RNAi targets than others in Coleoptera, Lepidoptera, Hemiptera, and Orthoptera (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025).
Ribosomes are the complex molecular machines that synthesise proteins, a key process of gene expression in all organisms (Polymenis, Reference Polymenis2020). The cellular ribosome level is limited by any ribosome protein having the minimal concentration (Marygold et al., Reference Marygold, Roote, Reuter, Lambertsson, Ashburner, Millburn, Harrison, Yu, Kenmochi, Kaufman, Leevers and Cook2007). Therefore, when ribosome proteins are mutated individually, they often lead to distinct and intriguing phenotypes, including specific human pathologies (Polymenis, Reference Polymenis2020). Among the three genes targeted in this survey, however, dsRpS11 had the highest RNAi efficacy and lethal effectiveness, while dsRpL10 had the second RNAi efficacy and the lowest lethal effectiveness. Given that functionally redundant proteins can decrease lethal effectiveness (Peng, Reference Peng2019), are any compensatory RpL10 genes present in T. absoluta? Actually, of the 79 different Drosophila melanogaster ribosome proteins, 9 are encoded by two distinct genes. Six of these gene pairs (RpS5a/b, RpS10a/b, RpS14a/b, RpS15a/b, RpS19a/b, RpS28a/b) encode proteins of the small ribosomal subunit, and the other three (RpL10a/b, RpL34a/b, RpL37a/b) encode large subunit proteins (Marygold et al., Reference Marygold, Roote, Reuter, Lambertsson, Ashburner, Millburn, Harrison, Yu, Kenmochi, Kaufman, Leevers and Cook2007). TaRpS11 is not among the six small ribosomal protein gene pairs, whereas TaRpL10 has paired DmRpL10 partners: RpL10a/b (Marygold et al., Reference Marygold, Roote, Reuter, Lambertsson, Ashburner, Millburn, Harrison, Yu, Kenmochi, Kaufman, Leevers and Cook2007). Is the presence of compensatory RpL10 genes conserved among insects? Further research will shed light on this issue.
Intriguingly, the TaArgK RNAi larvae had more remaining mRNA contents, and at the same time, the highest larval lethality after dsRNA treatment in T. absoluta. It appears that RNAi-caused mRNA degradation is not always consistent with the severity of defective phenotypes. Therefore, an amenable target gene for RNAi-based pest control should meet at least two criteria: easily-degradable mRNA and high lethality. The two criteria are consistent with the common features of effective RNAi targets: a low mRNA stability and a high turnover rate of the gene products (Guo et al., Reference Guo, Wang, Sinakevitch, Lei and Smith2018). TaArgK might have a high mRNA stability and protein turnover rate. Ingestion of dsArgK thus degrades relatively low target mRNA and causes relatively high defective phenotypes in T. absoluta.
Microinjection of dsRNA
In vitro synthesis can produce high-purity dsRNA suitable for controlled laboratory experiments and gene function studies (Mendoza-Alatorre et al., Reference Mendoza-Alatorre, Julian-Chávez, Solano-Ornelas, Siqueiros-Cendón, Torres-Castillo, Sinagawa-García, Abraham-Juárez, González-Barriga, Rascón-Cruz, Siañez-Estrada and Espinoza-Sánchez2025). In the present paper, we tested the RNAi efficacy by microinjection of dsRNA into the third-instar larvae. Our findings revealed that the microinjection neither caused a significant reduction of target mRNA contents nor decreased larval weights, larval survival, and adult emergence percentages in T. absoluta (fig. 6). Conversely, microinjection of 2 and 5 µg of dsRNA targeting AChE, nAChR6, or RyR reduces the gene expression in a range of 62.7–75.4%, inducing a maximum mortality rate of 92.59% in T. absoluta (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019).
In order to clarify the different RNA efficacy in this study and that previously reported (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019), we quantified the dsRNA amount introduced by a microinjection. In our rearing protocol, the average weight of newly-moulted third-instar larvae was 1.3 mg (fig. 6). The maximum volume was 0.1 μL using microinjection. Therefore, we only delivered 0.71 μg dsRNA into a larva (fig. 6), less than 2 and 5 µg of dsRNA targeting AChE, nAChR6, or RyR (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019). In contrast, ingestion of E. coli generated dsArgK, dsRpL10, or dsRpS11 for 24 hours obtained 5.55 and 3.06 μg dsRNA on potato and tomato foliage (fig. 6), similar to the dose reported previously (Majidiani et al., Reference Majidiani, Pourabad, Laudani, Campolo, Zappalà, Rahmani, Mohammadi and Palmeri2019). As a result, the target mRNAs were reduced, and the obvious defective phenotypes were observed in the resultant T. absoluta larvae having ingested E. coli-generated dsArgK, dsRpL10, or dsRpS11 (figs. 3–5).
Interestingly, injection of 200 ng dsCDA1 into 2-day-old T. absoluta pupae decreases the target mRNA level by 28.92%, 43.68%, and 46.51% at 24, 48, and 72 h after treatment and causes 53.2% lethality (Zhou et al., Reference Zhou, Zhang, Xu, Liu, Liu, Ma and Yang2024). Microinjection of 600 ng chromatin-remodelling ATPase genes ISWI and BRM into pre-emergent late female T. absoluta pupae declines the corresponding mRNA levels by 45.39 and 35.32%, and reduces fecundity (Ji et al., Reference Ji, Wu, Bi, Wang, Zhang, Wan, Lü and Liu2022). Obviously, the T. absoluta pupae are more sensitive to dsRNA than the larvae. The expression of core RNAi components fluctuates across life stages (Rodrigues et al., Reference Rodrigues, Dhandapani, Duan and Palli2017; You et al., Reference You, Zhang, Huang, Merchant, Zhou and Li2020; Gupta et al., Reference Gupta, Singh, Kaur, Pandher, Kaur, Goel, Kaur and Rathore2021). Therefore, the RNAi efficacy may vary throughout the whole developmental process. For example, differential mortality has been reported in larvae and adults of Musca domestica and Delia radicum following RNAi treatment (Powell et al., Reference Powell, Pyati, Cao, Bell, Gatehouse and Fitches2017), highlighting the difference in RNAi efficacy during various development stages (Camargo Rde et al., Reference Camargo Rde, Herai, Santos, Bento, Lima, Marques-Souza and Figueira2015).
Conclusions
In summary, oral administration of E. coli generated dsRNAs targeting three housekeeping genes, TaArgK, TaRpL10, and TaRpS11, into the third-instar larvae caused a significant reduction in corresponding target mRNA levels, led to larval lethality and reduced adult emergence in T. absoluta. Therefore, TaArgK, TaRpL10, and TaRpS11 were viable targets for RNAi. Among them, TaRpS11 is the best RNAi target gene, followed by TaArgK. Our findings provide potential and safe target genes for pest control of T. absoluta.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0007485326101047.
Financial support
This research was supported by Major Science and Technology Projects in Xinjiang (2023A02006).
Author contributions
G.-Q.L. and L.J. conceptualised and designed the study. J.P., L.-L.L., Y.-K.W., and Z.-Y.W. performed the experiments and analysed the data. G.-Q.L. and W.-C.G. supervised the study. G.-Q.L. and W.-C.G. wrote the manuscript with input from all of the authors. All of the authors edited the manuscript and approved the final manuscript.
Competing interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Data and materials availability
All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials.
