Hostname: page-component-7b7567c8c-2rsb6 Total loading time: 0 Render date: 2026-11-13T05:59:18.960Z Has data issue: false hasContentIssue false
  • English
  • Français

Depressive Symptoms are Associated with low Serotonin Levels in Plasma but are not 5–HTTLPR Genotype Dependent in Older Adults

Published online by Cambridge University Press:  30 April 2021

Pedro Enrique Trujillo-HernándezOpen the ORCID record for Pedro Enrique Trujillo-Hernández[Opens in a new window],
Aide Sáenz-GalindoOpen the ORCID record for Aide Sáenz-Galindo[Opens in a new window],
Odila Saucedo-CárdenasOpen the ORCID record for Odila Saucedo-Cárdenas[Opens in a new window],
María de los Ángeles Villarreal-ReynaOpen the ORCID record for María de los Ángeles Villarreal-Reyna[Opens in a new window],
Mauricio Andrés Salinas-SantanderOpen the ORCID record for Mauricio Andrés Salinas-Santander[Opens in a new window],
Ana Laura Carrillo-CervantesOpen the ORCID record for Ana Laura Carrillo-Cervantes[Opens in a new window],
Reyna Torres-ObregónOpen the ORCID record for Reyna Torres-Obregón[Opens in a new window] and
Sandra Cecilia Esparza-GonzálezOpen the ORCID record for Sandra Cecilia Esparza-González[Opens in a new window]
Pedro Enrique Trujillo-Hernández
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Aide Sáenz-Galindo
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Odila Saucedo-Cárdenas
Affiliation:
Universidad Autónoma de Nuevo León (Mexico)
María de los Ángeles Villarreal-Reyna
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Mauricio Andrés Salinas-Santander
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Ana Laura Carrillo-Cervantes
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Reyna Torres-Obregón
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
Sandra Cecilia Esparza-González*
Affiliation:
Universidad Autónoma de Coahuila (Mexico)
*
Correspondence concerning this article should be addressed to Cecilia Esparza González. Universidad Autónoma de Coahuila. 25280 Saltillo (Mexico). E-mail: sceciliaesparza@gmail.com
Rights & Permissions [Opens in a new window]

Abstract

Depressive symptoms are diagnosed by physicians using scales but their pathophysiology is unclear. Low serotonin (5–HT) levels play an important role in depression, and the 5–HT transporter (5–HTT) is an important regulator of plasma serotonin levels and reuptake. Additionally, the 5–HTT gene-linked polymorphic region (5–HTTLPR) is associated with depression. The aim was to clarify the roles of plasma serotonin levels in plasma and the 5HTTPLR polymorphism in depressive symptoms in older adults. A total of 84 older adult participants were evaluated. Depressive symptoms were measured using the Center for Epidemiologic Studies Depression Scale of 20 items (CESD–20). The plasma serotonin levels were determined by ELISA, and the 5–HTTLPR genotype was analyzed by PCR. Depressive symptoms were present in 39.3% (N = 33) of the participants. The median plasma serotonin level was 204.34 ng/mL (SD = 93.88). A significant correlation was found between the CESD–20 scale and plasma serotonin levels (r = –.256; p = .019). Low serotonin levels were associated with the presence of depressive symptoms (p = .001). The 5–HTTLPR analysis showed that of the 84 older adults, 35.7% had the SS genotype, 10.7% had the LL genotype, and 53.6% were heterozygous. The 5–HTTLPR polymorphism was not associated with depressive symptoms (p = .587) and plasma serotonin levels (p = 0.391). Depressive symptoms correlate with low serotonin levels in plasma, but not with the 5–HTTLPR polymorphism in older Mexican adults.

Keywords

depressive symptoms5–HTTLPR polymorphismplasma serotonin

Information

Type
Research Article
Information
The Spanish Journal of Psychology , Volume 24 , 2021, e28
Copyright
© Universidad Complutense de Madrid and Colegio Oficial de Psicólogos de Madrid 2021

Depression is defined as a mental disorder with principal comorbidities, such as anxiety, altered mood and sleep, persistent feelings of sadness, hopelessness and disinterest in life projects, anhedonia, metabolic problems that affect the weight and energy of the patient, and increased negative thoughts and ideas towards life. According to DSM–5 criteria, a diagnosis of depression can be made if the patient shows 5 or more symptoms for 2 weeks and at least one of the following symptoms: Depressed mood or loss of interest or pleasure (American Psychiatric Association [APA], 2015).

This disorder can become chronic or recurrent and alter the performance of daily activities, and in severe cases, could lead to suicide (Jayasingam et al., Reference Jayasingam, Omar, Mustamil, Hashim and Bakar2020). Depression is currently considered one of the top 10 causes of psychiatric disability and is predicted to be the second leading cause of disability worldwide by 2020 after heart disease (World Health Organization [WHO], 2017).

Contrary to beliefs, depression in the elderly is not a natural part of aging. Identifying this condition is important and providing timely and appropriate treatment will help restore health. However, if depression remains untreated, it could lead to cognitive and social deterioration and increased disability (Burke et al., Reference Burke, Goldfarb, Bollam and Khokher2019). Since symptoms of depression are considered a normal part of aging, only 15% of older adults receive appropriate treatment (Christensen et al., Reference Christensen, Oernboel, Nielsen and Bech2019).

Several methods can assess and identify depressive symptoms (measurement scales). These scales (pencil and paper instruments) allow health professionals to identify whether a patient has symptoms of depression. Among the different scales to identify symptoms of depression, the CESD–20 is a research tool that has been validated in different populations, including Mexico (Gonzalez et al., Reference González, Nuñez, Merz, Brintz, Weitzman, Navas, Camacho, Buelna, Wassertheil-Smoller, Perreira, Isasi, Choca, Talavera and Gallo2017; Malakouti et al., Reference Malakouti, Pachana, Naji, Kahani and Saeedkhani2015; van Dam & Earleywine, Reference Van Dam and Earleywine2011).

These scales are associated with biological and social factors (e.g., deficiency of neurotransmitters and loss of a spouse, friends, or work) (Alghadir et al., Reference Alghadir, Gabr and Al-Eisa2016; Paykel et al., Reference Paykel, Cooper, Ramana and Hayhurst1996) that influence the development of depression; however, the pathophysiology of the disease is not clear (Jesulola et al., Reference Jesulola, Micalos and Baguley2018).

Depression is associated with a decrease in serotonin levels in both the brain and blood (Bamalan & Al Khalili, Reference Bamalan and Al Khalili2020; Cha & Hong, Reference Cha and Hong2015). Patients with recurrent episodes of depressive disorder and without medication show lower plasma serotonin levels (Aleksovski et al., Reference Aleksovski, Neceva, Vujović, Manusheva, Rendevski, Novotni, Filipce, Spasovska, Sofijanova, Aleksovski and Gjorgoski2018). Increased plasma serotonin levels showed improvement in a murine model of depression using an antidepressant compared with animals that did not receive the antidepressant (Park et al., Reference Park, Kim, Kim, Yang, Seo, Jung, Jang, Kim and Lee2018). Similar to these findings, elevated serotonin concentrations in plasma improve depression symptoms in patients receiving selective serotonin reuptake inhibitors (SSRI) (Pehrson et al., Reference Pehrson, Leiser, Gulinello, Dale, Li, Waller and Sanchez2015). Researchers have determined that low levels of serotonin inhibit the response to treatment with SSRI in patients with depression (Holck et al., Reference Holck, Wolkowitz, Mellon, Reus, Nelson, Westrin and Lindqvist2019).

The serotonin transporter (SERT) is a protein that is found in the platelet plasma membrane. It regulates circulating serotonin levels by inducing the accumulation of serotonin within platelets (Amador & McDonald, Reference Amador and McDonald2018). The SERT protein expressed in platelets is identical to that found in neurons, displaying similar structural and functional properties in both tissues (Mammadova-Bach et al., Reference Mammadova-Bach, Mauler, Braun and Duerschmied2018).

Other studies have shown that the serotonin transporter gene (SCL6A4) has a polymorphic region in its promoter sequence (5–HTTLPR) that has two forms, one long (L) and one short (S); the S allelic form is associated with depression (Gao et al., Reference Gao, Yuan, Sun, Wang, He and Liu2014; Grzesiak et al., Reference Grzesiak, Beszłej, Waszczuk, Szechiński, Szewczuk-Bogusławska, Frydecka, Dobosz, Jonkisz, Lebioda, Małodobra and Mulak2017).

Few studies have investigated the presence of polymorphisms according to the concentration of peripheral serotonin and 5–HTTLPR polymorphisms were identified in autistic children, where a high concentration of serotonin was reported in plasma but no association was found between the concentration and genotype (S/S, S/L, or L/L) (Meguid et al., Reference Meguid, Gebril and Khalil2015). The pathophysiology of depression is complex, and an endless number of factors are involved. Thus, our objective was to determine the association between biological and genetic factors and depressive symptoms using the CESD–20 Depression Scale.

Method

Study Participants

Eighty-four elderly adults from the Family Care and Integration Center (CAIF) of Saltillo, Coahuila, Mexico, were randomly selected from the list provided by the administration of the Integral Family Development (DIF) System of the State of Coahuila. The size of the sample was determined considering the total number of elderly who attended the CAIF on the day of data collection; non-probabilistic convenience sampling was used. The protocol met the requirements of the Ethics Committee of the University Hospital and the ethical recommendations contained in the Declaration of Helsinki.

Individuals over 60 years of age who provided written informed consent, knew how to read and write, and obtained a score < 6 in the Pfeffer Functional Activities Questionnaire (FAQ), which measures functional changes related to cognitive impairment, were included. Older adults taking antidepressants and smokers were excluded from the study. People on antidepressant treatment were eliminated because the drugs have been shown to alter the concentration of serotonin in plasma (Holck et al., Reference Holck, Wolkowitz, Mellon, Reus, Nelson, Westrin and Lindqvist2019).

All participants were informed about the study protocol, blood sampling, and the scale used (CESD–20). For the collection of sociodemographic data, a Personal Data Card was used that consisted of 11 questions about the participant’s age, marital status, occupation, religion, sex, the occurrence of falls in the last year, household composition, health status, and whether he or she takes any medication.

Assessment of Depressive Symptoms

The Center for Epidemiologic Studies Depression Scale 20–item version (CESD–20) (Radloff, Reference Radloff1977) in Spanish was used to measure depressive symptoms. Each participant was interviewed by the nursing staff. The items assess various components of depression, such as depressed mood, feelings of worthlessness, hopelessness, and loss of appetite. Each item is related to the frequency with which the symptoms occurred in the week before its application.

The participant is asked how many days in the last week he or she has had these symptoms. The response options are 0 days, 1 to 2 days, 3 to 4 days, and 5 to 7 days, or all days, coded with values from 0 to 3. The possible range is from 0 to 60; that is, the higher the score, the greater the presence of depressive symptoms. It has four reverse-worded items (4, 8, 12, and 16) that refer to conditions of positive affect. The cutoff point was 16 points as an indicator of clinically significant depressive symptoms (Radloff & Locke, Reference Radloff, Locke, Weissman, Myers and Ross1986)

The psychometric properties of the CESD–20 according to Radolff (1977) are the following: a) Internal consistency of .85 for the general population and .90 for psychiatric patients; b) the test-retest reliability is .54 for the general population and .53 for psychiatric patients; c) the non-response percentage is low, so its acceptability is high. The scale is generalizable since the analysis by subgroups contains alpha coefficients greater than .80. In the Mexican population, it has a Cronbach´s alpha of .74 to .85 that explains 50.6% of the variance (Aguilera-Guzmán et al., Reference Aguilera-Guzmán, García and García2004; Escobar Bravo et al., Reference Escobar Bravo, Botigué Satorra, Jürschik Giménez, Nuin Orrio and Blanco Blanco2013). To evaluate the structure of the CESD–20 in the studied sample, internal consistency values were estimated, Cronbach’s alpha (α) to establish the reliability of the scale, obtaining a result of .72.

Plasma Serotonin Levels

Peripheral blood samples were collected and sent to a certified laboratory for clinical analysis. Plasma serotonin levels were analyzed by ELISA (Serotonin ELISA; Immuno-Biological Laboratories, Minneapolis, MN). The detection range was 0/15–2500 ng/mL, and the sensitivity 6.2 ng/mL. According to the literature, normal serotonin levels oscillate between 101 and 283 ng/mL (Bamalan & Al Khalili, Reference Bamalan and Al Khalili2020). A concentration of 101 ng/mL was used to categorize 2 groups according to the serotonin levels, under and upper groups.

Analysis of the 5–HTTLPR Polymorphism

The phenol-chloroform technique was used to extract DNA (Ghaheri et al., Reference Ghaheri, Kahrizi, Yari, Babaie, Suthar and Kazemi2016). Polymorphisms were determined by polymerase chain reaction (PCR), following a previously described protocol. The forward primer was 5’– GGCGTTGCCGCTCTGAATGC –3 and the reverse primer 5’– GAGGGACTGAGCTGGACAACCAC –3’ (McCauley et al., Reference McCauley, Olson, Dowd, Amin, Steele, Blakely, Folstein, Haines and Sutcliffe2004). The cycle conditions included an initial denaturation of 94 °C for 5 min, followed by 40 cycles of 95 °C for 1 min, 63 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products were analyzed on 3% agarose gel containing ethidium bromide. The L and S alleles corresponded to 528 and 484 base pair fragments, respectively (Collier et al., Reference Collier, Stöber, Li, Heils, Catalano, Di Bella, Arranz, Murray, Vallada, Bengel, Müller, Roberts, Smeraldi, Kirov, Sham and Lesch1996).

Statistical Analysis

Descriptive analysis was performed (measures of central tendency and frequencies) and qualitative values as percentages. The chi-square (χ2) test measured categorical variables, and when the number was lower than 5, Fisher´s exact test was used. Spearman´s correlation was performed to correlate the CESD–20 score and the plasma serotonin concentration. Analyses of the allele and genotypic frequencies were performed using the Hardy-Weinberg formula (genotype frequency = p2 + 2pq + q2 and allelic frequency = p + q = 1). The Cochran-Armitage trend test was used to associate genotypes and the CESD–20 or serotonin concentration (Runde, Reference Runde2013). The Mann-Whitney U test was used to compare quantitative variables.

Odds ratios (ORs) were determined to estimate the presence of 5– HTTLPR polymorphisms, and if the serotonin concentration is associated with the CESD–20 scale. A p-value < .05 was considered statistically significant. All of the statistical analyses were performed using SPSS software version 21 (IBM, Corp., Armonk, NY).

Results

Sample Characteristics

The mean age was 68.68 (SD = 6.2) years. Most of the participants were women (75%) and the median serotonin level was 204.34 (SD = 93.88) ng/mL. Regarding these variables, 54.7% of the participants were not in a relationship and 78.6% lived alone; only 11.9% reported working, and 78.6% had some type of illness (40.1% had diabetes, 37.4% hypertension, and 1.1% Parkinson). Table 1 shows some sociodemographic data that are considered risk factors to develop depressive symptoms, such as living alone, being unemployed, and comorbidities.

Table 1.

Demographic Characteristics of All Participants according to CESD-20 Screening

Note. χ2 and Fisher Test; *p < 0.05 significative difference; aSpearman Coefficient -.256 p = 0.019

Detection of Depression using the CESD–20 Scale

According to the CESD–20, 39.3% (M = 31. 6; SD = 10.1) and 60.7% (M = 8; SD = 4.5) of the participants had and did not have depressive symptoms, respectively. The overall mean was 15.6 (SD = 12.9) (Table 1). Regarding gender, more women than men showed depressive symptoms; a difference that approached statistical significance (p = .053). Social variables were also analyzed (having a partner, living accompanied, and occupation). The variables were compared by proportions using Fisher´s exact test (N ˂ 5) or χ2. There was no association between depressive symptoms and remaining unemployed (p = .0804). Additionally, variables related to functionality—falls during the year, the use of a support device, and comorbidities— were analyzed and the statistical analysis showed an association between comorbidities and depressive symptoms according to the CEDS–20 (p = .0312). Thus, serotonin levels were significantly lower in participants with depressive symptoms (CESD–20) than in those without depressive symptoms (p = .001).

A nonparametric correlation analysis was performed using Spearman´s coefficient. A significant correlation was found between the CESD–20 scale and the plasma serotonin levels of the participants (r = –.256; p = .019). Based on previous studies, the normal peripheral levels of serotonin are 101 to 283 ng/ml. Thus, the population was divided into two groups according to the serotonin level, levels lower than 101.0 ng/ml, and normal levels (above 101.1 ng/ml). The CESD–20 scores were associated with the plasma serotonin concentration (p = .0251) (Table 1)

Analysis of the Population according to Genotype

The presence of the 5–HTTLPR polymorphism was classified as wild-type homozygous LL, heterozygous LS, and homozygous SS. Analysis of the 5–HTTLPR polymorphism showed proportions of 35.7% for the SS, 10.7% for the LL, and 53.6% for the LS polymorphism; however, 89.3% of the Mexican sample had the S allele. No significant difference was found between the allelic variants; thus, the sample was in Hardy-Weinberg equilibrium (Table 2). Frequency analyzes revealed that the presence of polymorphisms was not associated with the CESD–20 score and serotonin levels (p = .587; p = .391, respectively).

Table 2.

Polymorphism Frequency according to the Measurement Instruments

Note. a Cochran-Armitage trend test. p < .05 significative difference.

b χ2 = 0.27, p = .60; c χ2 = 0.4, p = .518; d χ2 = 1.1; p = .29; e χ2 = 0.26, p = .60.

Discussion

The objective of this study was to determine the association between biological and genetic factors and depressive symptoms using the CESD–20 scale. In our current sample, the internal consistency of the CESD–20 was analyzed using Cronbach’s alpha, obtaining acceptable values (.72); similar values have been reported in the Mexican population (Bojorquez & Snyder, Reference Bojorquez and Snyder2009).

In this study, 39.3% of the participants showed depressive symptoms and there was a higher incidence of depressive symptoms in women (63.4%) than in men (36.4%). These data corroborate previous reports in which the prevalence of depressive symptoms was higher in women, especially in elderly women (Carayanni et al., Reference Carayanni, Stylianopoulou, Koulierakis, Babatsikou and Koutis2012; Girgus et al., Reference Girgus, Yang and Ferri2017). Although the results were not statistically significant, there is a trend related to gender and depressive symptoms in the study population (p = .053). The present study was limited by the small number of participants, and like other research, the small sample did not permit controlling for additional covariates such as gender (Lewis et al., Reference Lewis, Camsari, Sonmez, Nandakumar, Gresbrink, Daskalakis and Croarkin2019).

Concerning social variables, such as marital status, living alone, or being unemployed, we did not find an association between these variables and the presence of depressive symptoms. The findings corroborated those in the literature that both marital status and living alone in the elderly are not risk conditions for their health (McLaren, Reference McLaren2018; Paykel et al., Reference Paykel, Cooper, Ramana and Hayhurst1996); in contrast, social isolation represents a risk factor for developing depression (Evans et al., Reference Evans, Llewellyn, Matthews, Woods, Brayne and Clare2019). However, we found that unemployment was not associated with depressive symptoms. This could be related to the daily activity this group of older adults receives at the CAIF (Sarkar et al., Reference Sarkar, Kattimani, Premarajan and Roy2017). Previous literature also demonstrated an association between the presence of comorbidities and depression (Panagioti et al., Reference Panagioti, Bower, Kontopantelis, Lovell, Gilbody, Waheed, Dickens, Archer, Simon, Ell, Huffman, Richards, van der Feltz-Cornelis, Adler, Bruce, Buszewicz, Cole, Davidson, de Jonge and Coventry2016). In addition, pathologies such as diabetes have been shown to affect serotonin synthesis in the brain as well as decreased tryptophan in plasma, with this condition being a risk factor for developing depression since it also suggests antidepressant-induced diabetes mellitus (Manjarrez-Gutiérrez & Hernández-Rodríguez, Reference Manjarrez-Gutiérrez and Hernández-Rodríguez2016; Nguyen et al.,Reference Nguyen, Roussin, Rousseau, Montastruc and Montastruc2018; Prabhakar et al., Reference Prabhakar, Gupta, Kanade and Radhakrishnan2015).

In this study, low serotonin plasma levels correlated with high scores in the CESD–20, indicating that low serotonin levels are associated with depressive symptoms; although the sample size was small, Spearman´s coefficient was close to the intermediate value and showed statistical significance (Amor Andrés et al., Reference Amor Andrés, Holgado-Tello, Lasa-Aristu, Domínguez-Sánchez and Delgado Egido2015). These results were consistent with the correlation between a decreased concentration of plasma serotonin and a mood disorder (Paul-Savoie et al., Reference Paul-Savoie, Potvin, Daigle, Normand, Corbin, Gagnon and Marchand2011; Tong et al., Reference Tong, Zhang, Yuan, Jiang, Zhang, Xu, Ding, Li, Zhou and Zhang2015). Similarly, low serotonin levels in plasma were associated with nonresponses to treatment using selective serotonin reuptake inhibitors (SSRI) (Saldanha et al., Reference Saldanha, Kumar, Ryali, Srivastava and Pawar2009).

Additionally, women with postpartum depression showed low serotonin levels in plasma in a case-control study (Xie et al., Reference Xie, Xie, Krewski and He2018). Furthermore, it was recently established that low serotonin levels in plasma were associated with patients with a low response to antidepressant treatment, presenting depressive symptoms (Holck et al., Reference Holck, Wolkowitz, Mellon, Reus, Nelson, Westrin and Lindqvist2019). Additionally, platelets with low serotonin levels are a reliable biomarker in suicide risk assessment (Giurgiuca et al., Reference Giurgiuca, Schipor, Caragheorgheopol, Crasan, Postolache, Tudose, Prelipceanu and Cozman2016). Thus, lower levels of serotonin in plasma suggest an increased presence of depressive symptoms according to the CESD–20 score.

Analysis of the 5–HTTLPR polymorphism revealed that 89.2% of the sample harbored the S allele, a finding that, in the literature, was associated with developing depressive symptoms (Hu et al., Reference Hu, Zhou, Li, Deng, He, Ye and Ning2019). This prevalence of the allele S is consistent with a recent report in which the S allele showed a prevalence of 78.9% in Mexican adolescents (Sarmiento-Hernández et al., Reference Sarmiento-Hernández, Ulloa-Flores, Camarena-Medellín, Sanabrais-Jiménez, Aguilar-García and Hernández-Muñoz2019). In contrast, in this study, no significant association was observed between the 5–HTTLPR polymorphism and depressive symptoms, as measured by the CESD–20 score. However, our result was consistent with reports showing no association between the 5–HTTLPR polymorphism and major depression in the Colombian population (Perez-Olmos et al., Reference Pérez-Olmos, Bustamante and Ibáñez-Pinilla2016). Additionally, other authors have reported the importance of stress as a priority factor in developing depressive symptoms and not the presence of the S allele; furthermore, the lack of association could be due to the age of the study group because age is a factor in the association between the S allele and depression, with a significant association in patients younger than 37 years (Brummett et al., Reference Brummett, Boyle, Siegler, Kuhn, Ashley-Koch, Jonassaint, Züchner, Collins and Williams2008).

The null association between these two variables can also be due to the scale used to determine the depressive symptoms; differences have been reported in evaluations depending on the scale used (Gao et al., Reference Gao, Yuan, Sun, Wang, He and Liu2014; Rief et al., Reference Rief, Bleichhardt, Dannehl, Euteneuer and Wambach2018; Roppolo et al., Reference Roppolo, Mulasso, Gobbens, Mosso and Rabaglietti2015).

Additionally, plasma serotonin levels were not associated with the presence of the 5–HTTLPR polymorphism; findings that are consistent with those previously reported that the mean 5–HTT RNA expression level was not associated with the 5–HTTLPR genotype in patients or controls (Iga et al., Reference Iga, Watanabe, Numata, Umehara, Nishi, Kinoshita, Inoshita, Shimodera, Fujita and Ohmori2016). Another report supporting the results demonstrated that plasma serotonin levels are not associated with the presence of the 5–HTTLPR polymorphism in autistic children (Meguid et al., Reference Meguid, Gebril and Khalil2015). These results are consistent with reports where the increase in plasma serotonin levels is observed when patients receive treatment and show a good response to clinical symptoms (Saldanha et al., Reference Saldanha, Kumar, Ryali, Srivastava and Pawar2009; Spreux-Varoquaux et al., Reference Spreux-Varoquaux, Gailledreau, Vanier, Bothua, Plas, Chevalier, Advenier, Pays and Brion1996). Likewise, this protective effect of depressive symptoms correlates with the results obtained with the increase in 5–HTT mRNA in response to treatment using antidepressants for 32 weeks (Kao et al., Reference Kao, Chang and Lung2018).

Based on these results, clinical intervention is suggested, such as exercise to increase plasma serotonin levels (Zimmer et al., Reference Zimmer, Stritt, Bloch, Schmidt, Hübner, Binnebößel, Schenk and Oberste2016), thus avoiding symptoms of depression (Kvam et al., Reference Kvam, Kleppe, Nordhus and Hovland2016). One of the limitations of this study was the number of participants and differences in the participant characteristics in each group. To identify differences in the genotype of the SLC6A4 gene, samples with a larger number of participants, as well as homogeneous populations, are needed (Culverhouse et al., Reference Culverhouse, Saccone, Horton, Ma, Anstey, Banaschewski, Burmeister, Cohen-Woods, Etain, Fisher, Goldman, Guillaume, Horwood, Juhasz, Lester, Mandelli, Middeldorp, Olié, Villafuerte and Bierut2018; Zhu, et al., Reference Zhu, Klein‐Fedyshin and Stevenson2017). Additionally, the CESD–20 score, the only screening tool used, would serve better as a supplement to a clinical diagnosis. Specifically for genotype analysis, it is more difficult to detect effects in smaller samples and it would be necessary to increase the sample to improve the statistical power of the methodology; however, with this sample size, it is possible to identify the clear association between the blood concentration of serotonin with the CESD–20 score.

Plasma serotonin levels correlate with the scores obtained using the CESD–20 scale. If an older adult has low plasma levels of serotonin, higher CESD–20 scores likely indicate states of depression. Variables such as comorbidities are influential factors that can cause the elderly to develop depression. The S allele has a high prevalence in the Mexican population participating in this study. Based on these results, we suggest investigating the prevalence of polymorphisms in larger samples to determine this risk factor to prioritize developing anti-depression programs.

The first author (Pedro Enrique Trujillo Hernández) expresses his appreciation to CONACyT for his Master´s scholarship.

Footnotes

Conflicts of Interest: None

Funding Statement: This study was supported by IMSS funding project number FIS/IMSS/PROT/G13/1242 awarded to O. S-C.

References

Aguilera-Guzmán, R. M., García, M. S. C., & García, F. J. (2004). Características psicométricas de la CES-D en una muestra de adolescentes rurales mexicanos de zonas con alta tradición migratoria. Salud mental, 27(6), 57–66.Google Scholar
Aleksovski, B., Neceva, V., Vujović, V., Manusheva, N., Rendevski, V., Novotni, A., Filipce, A., Spasovska, A., Sofijanova, A., Aleksovski, V., & Gjorgoski, I. (2018). SSRI-reduced platelet reactivity in non-responding patients with life-long Recurrent Depressive Disorder: Detection and involved mechanisms. Thrombosis Research, 165, 24–32. https://doi.org/10.1016/j.thromres.2018.03.006CrossRefGoogle ScholarPubMed
Alghadir, A. H., Gabr, S. A., & Al-Eisa, E. (2016). Effects of physical activity on trace elements and depression related biomarkers in children and adolescents. Biological Trace Element Research, 172(2), 299–306. https://doi.org/10.1007/s12011-015-0601-3CrossRefGoogle ScholarPubMed
Amador, M. H. B., & McDonald, M. D. (2018). The serotonin transporter and nonselective transporters are involved in peripheral serotonin uptake in the Gulf toadfish, Opsanus beta. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 315(6), R1154–R1166. https://doi.org/10.1152/ajpregu.00137.2018CrossRefGoogle ScholarPubMed
American Psychiatric Association. (2015). Depressive disorders: DSM–5® selections. American Psychiatric Pub.Google Scholar
Amor Andrés, P. J., Holgado-Tello, F. P., Lasa-Aristu, A., Domínguez-Sánchez, F. J., & Delgado Egido, B. (2015). Estructura factorial de la Escala de Balance Afectivo en población normativa [Factorial structure of the Affect Balance Scale in a normative population]. Clínica y Salud, 26(2), 73–80. http://doi.org/10.1016/j.clysa.2015.03.001CrossRefGoogle Scholar
Bamalan, O. A., & Al Khalili, Y. (2020, October 3). Physiology, serotonin. StatPearls. https://www.ncbi.nlm.nih.gov/books/NBK545168/Google Scholar
Bojorquez, I., & Snyder, N. (2009). Psychometric characteristics of the Center for Epidemiological Studies - Sepression Scale (CES-D), the 10- and 20-item versions, in women from a rural area in Mexico. Salud Mental, 32, 299–307.Google Scholar
Escobar Bravo, M. A., Botigué Satorra, T., Jürschik Giménez, P., Nuin Orrio, C., & Blanco Blanco, J. (2013). Sintomatología depresiva en ancianos. La influencia del género [Depressive symptoms in elderly women. The influence of gender]. Revista Española de Geriatría y Gerontología, 48(2), 59–64. http://doi.org/10.1016/j.regg.2012.07.003CrossRefGoogle Scholar
Brummett, B. H., Boyle, S. H., Siegler, I. C., Kuhn, C. M., Ashley-Koch, A., Jonassaint, C. R., Züchner, S., Collins, A., & Williams, R. B. (2008). Effects of environmental stress and gender on associations among symptoms of depression and the serotonin transporter gene linked polymorphic region (5–HTTLPR). Behavior Genetics, 38(1), 34–43. https://doi.org/10.1007/s10519-007-9172-1CrossRefGoogle Scholar
Burke, A. D., Goldfarb, D., Bollam, P., & Khokher, S. (2019). Diagnosing and treating depression in patients with Alzheimer’s disease. Neurology and Therapy, 8, 325–350. https://doi.org/10.1007/s40120-019-00148-5CrossRefGoogle ScholarPubMed
Carayanni, V., Stylianopoulou, C., Koulierakis, G., Babatsikou, F., & Koutis, C. (2012). Sex differences in depression among older adults: Are older women more vulnerable than men in social risk factors? The case of open care centers for older people in Greece. European Journal of Ageing, 9(2), 177–186. https://doi.org/10.1007/s10433-012-0216-xCrossRefGoogle Scholar
Cha, M. Y., & Hong, H. S. (2015). Effect and path analysis of laughter therapy on serotonin, depression and quality of life in middle-aged women. Journal of Korean Academy of Nursing, 45(2), 221–230. https://doi.org/10.4040/jkan.2015.45.2.221CrossRefGoogle ScholarPubMed
Christensen, K. S., Oernboel, E., Nielsen, M. G., & Bech, P. (2019). Diagnosing depression in primary care: A Rasch analysis of the major depression inventory. Scandinavian Journal of Primary Health Care, 37(1), 105–112. https://doi.org/10.1080/02813432.2019.1568703CrossRefGoogle ScholarPubMed
Collier, D. A., Stöber, G., Li, T., Heils, A., Catalano, M., Di Bella, D., Arranz, M. J., Murray, R. M., Vallada, H. P., Bengel, D., Müller, C. R., Roberts, G. W., Smeraldi, E., Kirov, G., Sham, P., & Lesch, K. P. (1996). A novel functional polymorphism within the promoter of the serotonin transporter gene: Possible role in susceptibility to affective disorders. Molecular Psychiatry, 1(6), 453–460.Google ScholarPubMed
Culverhouse, R. C., Saccone, N. L., Horton, A. C., Ma, Y., Anstey, K. J., Banaschewski, T., Burmeister, M., Cohen-Woods, S., Etain, B., Fisher, H. L., Goldman, N., Guillaume, S., Horwood, J., Juhasz, G., Lester, K. J., Mandelli, L., Middeldorp, C. M., Olié, E., Villafuerte, S., … Bierut, L. J. (2018). Collaborative meta-analysis finds no evidence of a strong interaction between stress and 5–HTTLPR genotype contributing to the development of depression. Molecular Psychiatry, 23(1), 133–142. https://doi.org/10.1038/mp.2017.44CrossRefGoogle Scholar
Evans, I. E. M., Llewellyn, D. J., Matthews, F. E., Woods, R. T., Brayne, C., Clare, L., & CFAS-Wales Research Team. (2019). Living alone and cognitive function in later life. Archives of Gerontology and Geriatrics, 81, 222–233. https://doi.org/10.1016/j.archger.2018.12.014CrossRefGoogle ScholarPubMed
Gao, Z., Yuan, H., Sun, M., Wang, Z., He, Y., & Liu, D. (2014). The association of serotonin transporter gene polymorphism and geriatric depression: A meta-analysis. Neuroscience Letters, 578, 148–152. https://doi.org/10.1016/j.neulet.2014.06.046CrossRefGoogle ScholarPubMed
Ghaheri, M., Kahrizi, D., Yari, K., Babaie, A., Suthar, R. S., & Kazemi, E. (2016). A comparative evaluation of four DNA extraction protocols from whole blood sample. Cellular and Molecular Biology (Noisy-le-Grand, France), 62(3), 120–124. http://doi.org/10.14715/cmb/2016.62.3.20Google ScholarPubMed
Girgus, J. S., Yang, K., & Ferri, C. V. (2017). The gender difference in depression: Are elderly women at greater risk for depression than elderly men? Geriatrics, 2(4), Article 35. https://doi.org/10.3390/geriatrics2040035CrossRefGoogle ScholarPubMed
Giurgiuca, A., Schipor, S., Caragheorgheopol, A., Crasan, A., Postolache, E., Tudose, C., Prelipceanu, D., & Cozman, D. (2016). Platelet serotonin as biomarker for assessing suicidal behavior in patients with Bipolar I disorder. Acta Endocrinologica (Bucharest), 12(3), 275–281. http://doi.org/10.4183/aeb.2016.275CrossRefGoogle ScholarPubMed
González, P., Nuñez, A., Merz, E., Brintz, C., Weitzman, O., Navas, E. L., Camacho, A., Buelna, C., Wassertheil-Smoller, S., Perreira, K., Isasi, C. R., Choca, J., Talavera, G. A., & Gallo, L. C. (2017). Measurement properties of the Center for Epidemiologic Studies Depression Scale (CES–D 10): Findings from HCHS/SOL. Psychological Assessment, 29(4), 372–381. http://doi.org/10.1037/pas0000330CrossRefGoogle Scholar
Grzesiak, M., Beszłej, J. A., Waszczuk, E., Szechiński, M., Szewczuk-Bogusławska, M., Frydecka, D., Dobosz, T., Jonkisz, A., Lebioda, A., & Małodobra, M., & Mulak, A. (2017). Serotonin-related gene variants in patients with irritable bowel syndrome and depressive or anxiety disorders. Gastroenterology Research and Practice, 2017, Article 4290430. https://doi.org/10.1155/2017/4290430CrossRefGoogle ScholarPubMed
Holck, A., Wolkowitz, O. M., Mellon, S. H., Reus, V. I., Nelson, J. C., Westrin, Å., & Lindqvist, D. (2019). Plasma serotonin levels are associated with antidepressant response to SSRIs. Journal of Affective Disorders, 250, 65–70. https://doi.org/10.1016/j.jad.2019.02.063CrossRefGoogle ScholarPubMed
Hu, J., Zhou, B., Li, Y., Deng, Y., He, Q., Ye, J., & Ning, Y. (2019). The interaction between estradiol change and the serotonin transporter gene (5–HTTLPR) polymorphism is associated with postpartum depressive symptoms. Psychiatric Genetics, 29(4), 97–102. http://doi.org/10.1097/YPG.0000000000000222CrossRefGoogle ScholarPubMed
Iga, J.-I., Watanabe, S., Numata, S., Umehara, H., Nishi, A., Kinoshita, M., Inoshita, M., Shimodera, S., Fujita, H., & Ohmori, T. (2016). Association study of polymorphism in the serotonin transporter gene promoter, methylation profiles, and expression in patients with major depressive disorder. Human Psychopharmacology: Clinical and Experimental, 31(3), 193–199. https://doi.org/10.1002/hup.2527CrossRefGoogle ScholarPubMed
Jayasingam, S., Omar, S., Mustamil, N. M., Hashim, R. C., & Bakar, R. A. (2020). “Depression a silent killer", supporting and sustaining well-being in the workplace: Insights from a developing economy. Emerald Publishing Limited (pp. 13–62). https://doi.org/10.1108/978-1-83982-692-420201003CrossRefGoogle Scholar
Jesulola, E., Micalos, P., & Baguley, I. J. (2018). Understanding the pathophysiology of depression: From monoamines to the neurogenesis hypothesis model-are we there yet? Behavioural Brain Research, 341, 79–90. https://doi.org/10.1016/j.bbr.2017.12.025CrossRefGoogle ScholarPubMed
Kao, W.-T., Chang, C.-L., & Lung, F.-W. (2018). 5–HTT mRNA level as a potential biomarker of treatment response in patients with major depression in a clinical trial. Journal of Affective Disorders, 238, 597–608. https://doi.org/10.1016/j.jad.2018.06.035CrossRefGoogle ScholarPubMed
Kvam, S., Kleppe, C. L., Nordhus, I. H., & Hovland, A. (2016). Exercise as a treatment for depression: A meta-analysis. Journal of Affective Disorders, 202, 67–86. https://doi.org/10.1016/j.jad.2016.03.063CrossRefGoogle ScholarPubMed
Lewis, C. P., Camsari, D. D., Sonmez, A. I., Nandakumar, A. L., Gresbrink, M. A., Daskalakis, Z. J., & Croarkin, P. E. (2019). Preliminary evidence of an association between increased cortical inhibition and reduced suicidal ideation in adolescents treated for major depression. Journal of Affective Disorders, 244, 21–24. https://doi.org/10.1016/j.jad.2018.09.079CrossRefGoogle ScholarPubMed
Malakouti, S. K., Pachana, N. A., Naji, B., Kahani, S., & Saeedkhani, M. (2015). Reliability, validity and factor structure of the CES-D in Iranian elderly. Asian Journal of Psychiatry, 18, 86–90. http://doi.org/10.1016/j.ajp.2015.08.007CrossRefGoogle ScholarPubMed
Mammadova-Bach, E., Mauler, M., Braun, A., & Duerschmied, D. (2018). Autocrine and paracrine regulatory functions of platelet serotonin. Platelets, 29(6), 541–548. http://doi.org/10.1080/09537104.2018.1478072CrossRefGoogle ScholarPubMed
Manjarrez-Gutiérrez, G., & Hernández-Rodríguez, J. (2016). Clinical and basic studies on diabetes and brain serotonin. International Journal Endocrinology and Metabolic Disorders, 2, Article 2. http://doi.org/10.16966/2380-548X.123Google Scholar
McCauley, J. L., Olson, L. M., Dowd, M., Amin, T., Steele, A., Blakely, R. D., Folstein, S. E., Haines, J. L., & Sutcliffe, J. S. (2004). Linkage and association analysis at the serotonin transporter (SLC6A4) locus in a rigid‐compulsive subset of autism. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics, 127(1), 104–112. https://doi.org/10.1002/ajmg.b.20151CrossRefGoogle Scholar
McLaren, S. (2018). The relationship between living alone, sense of belonging, and depressive symptoms among older men: The moderating role of sexual orientation. Aging & Mental Health, 24, 103–109. http://doi.org/10.1080/13607863.2018.1531373CrossRefGoogle ScholarPubMed
Meguid, N. A., Gebril, O. H., & Khalil, R. O. (2015). A study of blood serotonin and serotonin transporter promoter variant (5–HTTLPR) polymorphism in Egyptian autistic children. Advanced Biomedical Research, 4, Article 94. http://doi.org/10.4103/2277-9175.156658Google ScholarPubMed
Nguyen, T. T. H., Roussin, A., Rousseau, V., Montastruc, J.-L., & Montastruc, F. (2018). Role of serotonin transporter in antidepressant-induced diabetes mellitus: A pharmaco epidemiological–pharmacodynamic study in VigiBase®. Drug Safety, 41(11), 1087–1096. https://doi.org/10.1007/s40264-018-0693-8CrossRefGoogle Scholar
Panagioti, M., Bower, P., Kontopantelis, E., Lovell, K., Gilbody, S., Waheed, W., Dickens, C., Archer, J., Simon, S., Ell, K., Huffman, J. C., Richards, D. A., van der Feltz-Cornelis, C., Adler, D. A., Bruce, M., Buszewicz, M., Cole, M. G., Davidson, K. W., de Jonge, P., … Coventry, P. A. (2016). Association between chronic physical conditions and the effectiveness of collaborative care for depression: An individual participant data meta-analysis. JAMA Psychiatry, 73(9), 978–989. http://doi.org/10.1001/jamapsychiatry.2016.1794CrossRefGoogle ScholarPubMed
Park, B.-K., Kim, Y. R., Kim, Y. H., Yang, C., Seo, C.-S., Jung, I. C., Jang, I.-K., Kim, S.-H., & Lee, M. Y. (2018). Antidepressant-like effects of Gyejibokryeong-hwan in a mouse model of reserpine-induced depression. BioMed Research International, 2018, Article 5845491. https://doi.org/10.1155/2018/5845491CrossRefGoogle Scholar
Paul-Savoie, E., Potvin, S., Daigle, K., Normand, E., Corbin, J.-F., Gagnon, R., & Marchand, S. (2011). A deficit in peripheral serotonin levels in major depressive disorder but not in chronic widespread pain. The Clinical Journal of Pain, 27(6), 529–534. http://doi.org/10.1097/AJP.0b013e31820dfedeCrossRefGoogle ScholarPubMed
Paykel, E. S., Cooper, Z., Ramana, R., & Hayhurst, H. (1996). Life events, social support and marital relationships in the outcome of severe depression. Psychological Medicine, 26(1), 121–133. https://doi.org/10.1017/S0033291700033766CrossRefGoogle ScholarPubMed
Pehrson, A. L., Leiser, S. C., Gulinello, M., Dale, E., Li, Y., Waller, J. A., & Sanchez, C. (2015). Treatment of cognitive dysfunction in major depressive disorder—a review of the preclinical evidence for efficacy of selective serotonin reuptake inhibitors, serotonin–norepinephrine reuptake inhibitors and the multimodal-acting antidepressant vortioxetine. European Journal of Pharmacology, 753, 19–31. https://doi.org/10.1016/j.ejphar.2014.07.044CrossRefGoogle ScholarPubMed
Pérez-Olmos, I., Bustamante, D., & Ibáñez-Pinilla, M. (2016). Polimorfismo del gen del transportador de serotonina (5–HTT) y trastorno de depresión mayor en pacientes en Bogotá, Colombia [Serotonin transporter gene (5–HTT) polymorphism and major depressive disorder in patients in Bogota, Colombia]. Biomédica, 36(2), 285–294. http://doi.org/10.7705/biomedica.v36i3.3014CrossRefGoogle Scholar
Prabhakar, V., Gupta, D., Kanade, P., & Radhakrishnan, M. (2015). Diabetes-associated depression: The serotonergic system as a novel multifunctional target. Indian Journal of Pharmacology, 47(1), 4–10. https://doi.org/10.4103/0253-7613.150305Google ScholarPubMed
Radloff, L. S. (1977). The CES-D Scale: A self-report depression scale for research in the general population. Applied Psychological Measurement, 1(3), 385–401. https://doi.org/10.1177/014662167700100306CrossRefGoogle Scholar
Radloff, L. S., & Locke, B. Z. (1986). The community mental health assessment survey and the CES-D Scale. In Weissman, M. M., Myers, J. K., & Ross, C. E. (Eds). Community surveys of psychiatric disorders (pp. 177–189). Rutgers University Press.Google Scholar
Rief, W., Bleichhardt, G., Dannehl, K., Euteneuer, F., & Wambach, K. (2018). Comparing the efficacy of CBASP with two versions of CBT for depression in a routine care center: A randomized clinical trial. Psychotherapy and Psychosomatics, 87(3), 164–178. http://doi.org/10.1159/000487893CrossRefGoogle Scholar
Roppolo, M., Mulasso, A., Gobbens, R. J., Mosso, C. O., & Rabaglietti, E. (2015). A comparison between uni-and multidimensional frailty measures: Prevalence, functional status, and relationships with disability. Clinical Interventions in Aging, 10, 1669–1678. http://doi.org/10.2147/CIA.S92328Google ScholarPubMed
Runde, M. (2013). Statistical methods for detecting genotype-phenotype association in the presence of environmental covariates [Master’s thesis, Institutt for Matematiske fag]. CORE. https://core.ac.uk/download/pdf/52106326Google Scholar
Saldanha, D., Kumar, N., Ryali, V. S. S. R., Srivastava, K., & Pawar, A. A. (2009). Serum serotonin abnormality in depression. Medical Journal Armed Forces India, 65(2), 108–112. https://doi.org/10.1016/S0377-1237(09)80120-2CrossRefGoogle ScholarPubMed
Sarkar, S., Kattimani, S., Premarajan, K. C., & Roy, G. (2017). Impact of attendance in a daycare centre on depression among elderly in rural Puducherry: A pre-& post-intervention study. The Indian Journal of Medical Research, 146 (Suppl. 2), 68–76. http://doi.org/10.4103/ijmr.IJMR_857_15CrossRefGoogle Scholar
Sarmiento-Hernández, E. I., Ulloa-Flores, R. E., Camarena-Medellín, B., Sanabrais-Jiménez, M. A., Aguilar-García, A., & Hernández-Muñoz, S. (2019). Association between 5–HTTLPR polymorphism, suicide attempt and comorbidity in Mexican adolescents with major depressive disorder. Actas Españolas de Psiquiatría, 47(1), 1–6.Google ScholarPubMed
Spreux-Varoquaux, O., Gailledreau, J., Vanier, B., Bothua, D., Plas, J., Chevalier, J.-F., Advenier, C., Pays, M., & Brion, S. (1996). Initial increase of plasma serotonin: A biological predictor for the antidepressant response to clomipramine? Biological Psychiatry, 40(6), 465–473. https://doi.org/10.1016/0006-3223(95)00449-1CrossRefGoogle ScholarPubMed
Tong, Q., Zhang, L., Yuan, Y., Jiang, S., Zhang, R., Xu, Q., Ding, J., Li, D., Zhou, X., & Zhang, K. (2015). Reduced plasma serotonin and 5-hydroxyindoleacetic acid levels in Parkinson’s disease are associated with nonmotor symptoms. Parkinsonism & Related Disorders, 21(8), 882–887. https://doi.org/10.1016/j.parkreldis.2015.05.016CrossRefGoogle ScholarPubMed
Van Dam, N. T., & Earleywine, M. (2011). Validation of the Center for Epidemiologic Studies Depression Scale—Revised (CESD-R): Pragmatic depression assessment in the general population. Psychiatry Research, 186(1), 128–132. https://doi.org/10.1016/j.psychres.2010.08.018CrossRefGoogle Scholar
World Health Organization. (2017). Mental health. [cited 29 Agosto 2029]. https://www.who.int/mental_health/world-mental-health-day/2017/en/Google Scholar
Xie, R., Xie, H., Krewski, D., & He, G. (2018). Plasma concentrations of neurotransmitters and postpartum depression. Zhong Nan Da Xue Xue Bao Yi Xue Ban, 43(3), 274–281. http://doi.org/10.11817/j.issn.1672-7347.2018.03.007Google ScholarPubMed
Zhu, J., Klein‐Fedyshin, M., & Stevenson, J. M. (2017). Serotonin transporter gene polymorphisms and selective serotonin reuptake inhibitor tolerability: Review of pharmacogenetic evidence. Pharmacotherapy: The Journal of Human Pharmacology and Drug Therapy, 37(9), 1089–1104. https://doi.org/10.1002/phar.1978CrossRefGoogle ScholarPubMed
Zimmer, P., Stritt, C., Bloch, W., Schmidt, F. P., Hübner, S. T., Binnebößel, S., Schenk, A., & Oberste, M. (2016). The effects of different aerobic exercise intensities on serum serotonin concentrations and their association with Stroop task performance: A randomized controlled trial. European Journal of Applied Physiology, 116(10), 2025–2034. http://doi.org/10.1007/s00421-016-3456-1CrossRefGoogle ScholarPubMed
Figure 0

Table 1.Demographic Characteristics of All Participants according to CESD-20 Screening

Figure 1

Table 2.Polymorphism Frequency according to the Measurement Instruments