Introduction
Approximately one-third of all mammalian proteins are synthesized in the endoplasmic reticulum (ER), transported to the Golgi apparatus and processed in a destination-dependent manner (Kanapin et al., Reference Kanapin, Batalov, Davis, Gough, Grimmond, Kawaji, Magrane, Matsuda, Schönbach, Teasdale and Yuan2003). These proteins, including growth factors and hormones, are essential for differentiation and cellular communication. ER-to-Golgi trafficking is a highly conserved and essential process for the proper sorting and delivery of membrane-bound and secretory proteins (Barlowe and Miller, Reference Barlowe and Miller2013). TRAnsport Protein Particle (TRAPP) complexes are tethering factors for COPII vesicles, and the TRAPPIII complex specifically mediates the assembly of the COPII vesicle outer layer during their formation (Zhao et al., Reference Zhao, Li, Luo, Siu, Gan, Zhang, Wu, Chan and Yu2017). TRAPP complexes are integral for intracellular vesicle transportation (Hall et al., Reference Hall, Sawant, Gu, Sikora, Rollo, Velasco, Kim, Segev, Christodoulou and Van Bergen2024).
The TRAPP complexes also function in final vesicle fusion to target membranes, a molecular event physically orchestrated by soluble NSF-attachment protein (SNAP) receptors (SNAREs) and mediated by molecular switches (Galindo and Munro, Reference Galindo and Munro2023). These molecular switches, Rabs and Arfs, are active when GTP is bound and inactive when GDP is bound (Cherfils and Zeghouf, Reference Cherfils and Zeghouf2013). Rabs and Arfs are controlled by guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs) (Galindo and Munro, Reference Galindo and Munro2023). The TRAPPII complex is a GEF for Rab11, which regulates Golgi-to-plasma membrane transport, and the TRAPPIII complex is a GEF for Rab1, which regulates ER to Golgi transport (Hall et al., Reference Hall, Sawant, Gu, Sikora, Rollo, Velasco, Kim, Segev, Christodoulou and Van Bergen2024). Mammalian TRAPPCII and III share a core set of subunits that includes TRAPPC1–6B (Galindo and Munro, Reference Galindo and Munro2023). TRAPPC1 and TRAPPC4 form the catalytic site at which TRAPPCII and III will activate Rab11 or Rab1, respectively. In vivo activation of Rabs requires additional subunits of TRAPPCII and TRAPPCIII (Hall et al., Reference Hall, Sawant, Gu, Sikora, Rollo, Velasco, Kim, Segev, Christodoulou and Van Bergen2024).
The majority of known cellular and molecular functions of TRAPP proteins has been performed primarily in vitro and in yeast models. The shared core TRAPP subunits are highly conserved with mammalian orthologs of all yeast TRAPP subunits (Riedel et al., Reference Riedel, Galindo, Muschalik and Munro2018). When gene function is removed in mouse models, four complex members are homozygous lethal prior to organogenesis: Trapp1, Trappc4, Trappc11, Trappc12 (Dickinson et al., Reference Dickinson, Flenniken, Ji, Teboul, Wong, White, Meehan, Weninger, Westerberg, Adissu, Baker, Bower, Brown, Caddle, Chiani, Clary, Cleak, Daly, Denegre, Doe, Dolan, Edie, Fuchs, Gailus-Durner, Galli, Gambadoro, Gallegos, Guo, Horner, Hsu, Johnson, Kalaga, Keith, Lanoue, Lawson, Lek, Mark, Marschall, Mason, McElwee, Newbigging, Nutter, Peterson, Ramirez-Solis, Rowland, Ryder, Samocha, Seavitt, Selloum, Szoke-Kovacs, Tamura, Trainor, Tudose, Wakana, Warren, Wendling, West, Wong, Yoshiki, Wurst, MacArthur, Tocchini-Valentini, Gao, Flicek, Bradley, Skarnes, Justice, Parkinson, Moore, Wells, Braun, Svenson, Hrabě de Angelis, Herault, Mohun, Mallon, Henkelman, Brown, Adams, Lloyd, McKerlie, Beaudet, Bućan and Murray2016). Trappc8 is sub-viable at birth, and five subunits are homozygous viable: Trappc2, Trappc2l, Trappc6b, Trappc9, Trappc10 (IMPC). The remaining five subunits have not been studied in vivo (Trappc3, Trappc3l, Trappc5, Trappc6a, Trappc13).
There are multiple human disease associations with TRAPP complex members, collectively known as TRAPPopathies, which include Spondyloepiphyseal Dysplasia Tarda, neurodevelopmental disorder, limb girdle muscle dystrophy and cancer (Hall et al., Reference Hall, Sawant, Gu, Sikora, Rollo, Velasco, Kim, Segev, Christodoulou and Van Bergen2024). TRAPPC4 is one of two proteins that have limb girdle muscular dystrophy and cancer phenotypes (Hall et al., Reference Hall, Sawant, Gu, Sikora, Rollo, Velasco, Kim, Segev, Christodoulou and Van Bergen2024).
Early development is a tightly regulated process, with carefully orchestrated and essential morphogenetic events making the first third of gestation particularly susceptible to genetic perturbations. Following initial post-fertilization cleavage divisions, the first differentiation events are completed by embryonic day 3.5 (E3.5) in the mouse, with the formation of a morphologically evident blastocyst, which remains unattached to maternal uterus. Successful blastocyst development requires specification of the first lineages: initially the inner cell mass (ICM) and trophectoderm (TE). The ICM is pluripotent and gives rise to both embryonic and extraembryonic lineages, while the TE contributes only to extraembryonic tissues. During these preimplantation stages, the blastocyst remains within a spherical protein matrix, the zona pellucida (ZP). At approximately ∼E4.0, the blastocyst expands, hatches from the ZP and implants into the maternal epithelium. Each step is essential for continued development. Here we present characterization of Trappc4 mutant mouse embryos, which fail to implant resulting in early embryonic lethality.
Results/discussion
Expression of murine TRAPP complex subunits
We first examined expression of all TRAPP complex subunits to identify embryonic stage (Figure 1A) and/or adult tissue (Figure 1B) specific expression. Pooled RNA from wild-type embryos at zygote, 2-cell, morula, blastocyst, E6.5, and E7.5 stages were used to synthesize cDNA. Intron-spanning primers were used to determine where each gene is expressed. Trappc1, −3, −4, −6b, and −8 are expressed at all embryonic stages tested (Figure 1A). Trappc2 shows dynamic expression – being robustly expressed in zygotes, weakly in 2 cell embryos, not expressed in morula but then transcribed again in blastocysts and gastrula. Trappc2l, −5, −11 and −13 are each expressed in all stages except for 2-cell embryos, which is consistent with transcriptomics data that also show low expression at the zygote and 2-cell stages compared to later stages (Lab 2025). Trappc3l is robustly expressed in zygotes but is not expressed in later stages, suggesting it is an oocyte specific transcript (also consistent with other data sets, Lab 2025). Trappc6a was not expressed in any of the embryonic stages tested. Trappc9 is robustly expressed in zygotes but then decreases as development proceeds, being absent at E7.5. Interestingly, a unique transcript variant of Trappc9 appears to be expressed only at the 2-cell stage (Figure 1A). Trappc12 levels appear to vary and it is not expressed in morula (Figure 1). Trappc2, Trappc3l, Trappc6b, Trappc8 and Trappc11 have robust zygotic expression compared to other embryonic stages, suggesting maternal loading of RNA into oocytes, and possible roles during early post-fertilization events. Although there is relatively low expression of several TRAPP subunits in 2-cell and morula, each one of these genes exhibits robust expression in zygotes, suggesting that the proteins (and TRAPP complexes) are still functional despite low or no RNA at these stages.
Expression of the 15 murine TRAPP complex subunit genes. Intron spanning primers designed against the 15 TRAPP complex subunit transcripts were used to amplify cDNA from pooled litters of different stages of embryo development (zygote, 2-cell, morula, blastocyst, E6.5, E7.5) and adult tissues (brain, heart, kidney, liver, lung, ovary, testis, tongue). Mrpl17 serves as cDNA control. NTC, no template control.
Figure 1. Long description
A table showing the expression of 15 murine TRAPP complex subunit genes across different stages of embryo development and adult tissues. The table is divided into two panels, A and B. Panel A focuses on different stages of embryo development, while Panel B focuses on various adult tissues. Each panel lists the expression levels of the 15 TRAPP complex subunit genes, with Mrpl17 serving as the cDNA control. The stages of embryo development include zygote, 2-cell, morula, blastocyst, E6.5, and E7.5. The adult tissues include brain, heart, kidney, liver, lung, ovary, testis, and tongue. Each row represents a different TRAPP complex subunit gene, and each column represents a different stage of embryo development or adult tissue. The expression levels are indicated by the presence or absence of bands in each cell. Panel A: The table shows the expression levels of the 15 TRAPP complex subunit genes at different stages of embryo development. The stages are listed as column headers: Zygote, 2-Cell, Morula, Blastocyst, E6.5, E7.5, and NTC. Each row represents a different TRAPP complex subunit gene: Trappc1, Trappc2, Trappc2l, Trappc3, Trappc3l, Trappc4, Trappc5, Trappc6a, Trappc6b, Trappc8, Trappc9, Trappc10, Trappc11, Trappc12, Trappc13, and Mrpl17. The expression levels are indicated by the presence or absence of bands in each cell. Panel B: The table shows the expression levels of the 15 TRAPP complex subunit genes in various adult tissues. The tissues are listed as column headers: Brain, Heart, Kidney, Liver, Lung, Ovary, Testis, Tongue, and NTC. Each row represents a different TRAPP complex subunit gene: Trappc1, Trappc2, Trappc2l, Trappc3, Trappc3l, Trappc4, Trappc5, Trappc6a, Trappc6b, Trappc8, Trappc9, Trappc10, Trappc11, Trappc12, Trappc13, and Mrpl17. The expression levels are indicated by the presence or absence of bands in each cell.
We also examined expression of each subunit in 8 adult tissues – brain, heart, kidney, liver, lung, ovary, testis and tongue (Figure 1B), representing diverse lineages. Trappc1, Trappc2, Trappc2l, Trappc3, Trappc4, Trappc5, Trappc6b, Trappc8, and Trappc13 are expressed in all tissues. Tongue showed very low or no expression of Trappc3l, Trappc6a, Trappc9, Trappc10, Trappc11 and Trappc12. Consistent with its embryonic expression, Trappc3l was only expressed in ovary, and very weakly in testis, further suggesting a germ cell-specific transcript is present in oocytes (and possibly spermatogonia). Trappc6a, Trappc11 and Trappc12 were highly expressed in ovary and testis compared to the other tissues tested. Overall, these results indicate widespread expression of TRAPP subunits in adult tissues, with some developmental differences suggesting TRAPP sub-complexes may form during specific embryonic stages. Widespread expression also suggests that both TRAPPCII and TRAPPCIII complexes are active in all cell types, perhaps not surprising given the fundamental role of ER-to-Golgi trafficking.
Trappc4 mutant preimplantation embryos are indistinguishable from littermates
Initial findings from the IMPC indicated the Trappc4 homozygous mutant embryos could not be recovered at E9.5. Consistent with our early lethality phenotyping pipeline, we performed Trappc4 +/− x Trappc4 +/− timed matings to identify and analyse Trappc4 knockout embryos during early development. The mutant allele used for these studies has a genomic deletion removing exons 2–5 (Figure 2A), allowing for robust genotyping of every embryo to distinguish wild-type (WT), heterozygous (HET) and homozygous mutant (MUT) embryos (see Materials and Methods). Dissections at E7.5 indicated that Trappc4 mutant embryos are not present at gastrulation stages. Four E7.5 litters yielded 32 embryos with zero homozygous mutants recovered (n = 11 WT, n = 21 HET, n = 0 MUT, Figure 2B).
Trappc4 knockout validation and lineage assessment. (A) Schematic comparison of WT and MUT Trappc4 alleles (not to scale). Elbowed arrows indicate primers used for RT-PCR shown in D. Triangle represents CRISPR Cas9-mediated deletion of 2900 bp. (B) Table showing genotypes of embryos recovered through timed Trappc4 +/− x Trappc4 +/− matings dissected at E7.5 and E3.5. (C) Representative brightfield images of Trappc4 Wild type (WT) (n = 21), Heterozygote (HET) (n = 59), and Mutant (MUT) (n = 19) E3.5 embryos. (D) RT-PCR results of single E3.5 embryos indicating complete absence of normal Trappc4 mRNA. Mrpl12 is loading control, “G” is genomic DNA control, “NTC” is no template control. (E) Representative maximum confocal intensity projection of immunofluorescence of E3.5 embryos. DAPI stains nuclei (blue), CDX2 marks TE cells (red), SOX2 marks ICM cells (white). n = 4 WT, n = 19 HET, n = 4 MUT. (F) Bar chart comparing total cell number (DAPI + cells) between each genotype. (G) Bar chart comparing TE lineage (CDX2+) cell numbers. (H) Bar chart comparing ICM (SOX2+) cell numbers. Each circle represents one embryo analysed in each group. Statistical analyses were performed using one-way ANOVAs. “ns” indicates not statistically significant. Scale bars represent 50 µm.
Since mutant embryos were not recovered at E7.5, post-implantation, we next flushed heterozygous intercross litters at E3.5 and found that Trappc4 mutant embryos form morphologically normal blastocysts which are indistinguishable from littermates (Figure 2C). At E3.5 mutants are recovered at expected Mendelian ratios (Figure 2B). To confirm that the mutants lack WT Trappc4 transcript, we designed RT-PCR primers within the CRISPR-deleted exons. As expected, no WT Trappc4 RNA can be amplified from mutant embryos (Figure 2D).
To assess if the initial lineage specification is occurring in the absence of TRAPPC4, we performed whole-mount immunofluorescence with antibodies identifying cells of TE (caudal type homeobox 2 (CDX2)), and ICM (sex determining region Y-box two (SOX2)) (Figure 2E). Careful analysis and counting of cells indicate no significant differences between genotypes with regard to total cell number, or the quantity or percentage of ICM and TE lineages (Figure 2F–H), indicating that Trappc4 mutants properly segregate ICM and TE.
Trappc4 mutants do not form normal ICM outgrowths
Because we could not recover mutants at E7.5, and E3.5 mutants appear normal, we performed outgrowth assays on cultured blastocysts to assess if Trappc4 mutants hatch and form typical outgrowths where we can assess both ICM colony formation and TE differentiation (Figure 3A). Control blastocysts hatch from the ZP, forming a single layer of adherent TE cells containing large nuclei, and a tightly compacted ICM colony with stem cell characteristics (Figure 3A, dotted lines). Although mutant embryos are able to hatch from the ZP and a TE monolayer is evident, there is no mutant ICM colony, but instead each mutant culture contained a loose collection of necrotic cells that were not attached to the rest of the outgrowth, which easily floated away when the dish was moved (arrowheads, Figure 3A). Based on these findings, we suspect that in mutants the ICM is dying – either at E3.5 or during the 72 h in vitro in culture, which might have clinical relevance for assisted reproductive technology (ART). Trappc4 mutant blastocysts are morphologically normal prior to implantation (E3.5), yet no mutants can be recovered in vivo four days later (E7.5). Studies report that blastocyst TE grade is a strong predictor for live birth (Belal et al., Reference Belal, Majzoub Karamalla, Kheiry, Mohamed Mostafa Gamea, Saeed Alatam and Elagab2026). Since Trappc4 mutant blastocysts have morphologically normal TE, successfully hatch from the ZP, but fail to produce post-implantation embryos, there may be clinical relevance to anembryonic pregnancies (Carlson and Tafti, Reference Carlson and Tafti2026).
Cell death assessment in mutants. (A) Outgrowth assay of Trappc4 +/− x Trappc4 +/− litters (n = 4 WT, n = 9 HET, n = 9 MUT). E3.5 embryos cultured for 72 hours at 37°C in 5% O2, 5% CO2 atmosphere in a humidified incubator. Dotted circles enclose inner cell mass (ICM). Arrowheads indicate necrotic floating cells. Scale bar represents 100 µm. (B) Phospo-p53 (P-p53) -mediated cell death assessment in E3.5 embryos. Representative z-section images of immunofluorescence of E3.5 embryos. DAPI stains nuclei (blue) and P-p53, an apoptotic marker (green). Scale bars represent 50 µm. n = 4 WT, n = 19 HET, n = 4 MUT. Scale bar represents 50 µm. (C–E) Bar charts comparing P-p53+ cells between genotypes and lineage-specific cell populations. The circles represent the embryos analyzed in each group. Statistical analyses were performed using one-way ANOVAs. “ns” indicates not statistically significant.
To test the possibility that the Trappc4 mutant ICM is dying at E3.5, we performed immunofluorescence using phospho-p53 (P-p53) on blastocysts from Trappc4 +/- x Trappc4 +/- (n = 4 WT, n = 19 HET, n = 4 MUT, Figure 3B). Surprisingly, we found no difference in the total number of P-p53-positive cells between genotypes (one-way ANOVA, p = 0.3875, Figure 3C–E). Additionally, there is no difference in the number of P-p53-positive cells in specific lineages when P-p53 was examined in concert with either CDX2 (TE) or SOX2 (ICM) immunofluorescence (Figure 3C–E).
Materials and methods
Animals
The authors assert that all use of animals and experiments contributing to this work were approved by the UMass Institutional Animal Care and Use Committee. Knockout (KO) alleles used were produced by Baylor College of Medicine: C57BL/6NJ-Trappc4em1(IMPC)Bay/Mmmh. The Trappc4 KO allele was generated by a deletion of exons 2, 3 and 4 via injection of CAS9 protein and guide sequences 5’-CCGCACCAGCCCACTTCCGCAGC-3’ and 5’-CCTACGGAAACCCTGTGTCCTCA-3’. Further allele details are available at https://www.mmrrc.org/catalog/sds.php?mmrrc_id=66947
Embryo retrieval, culture and genotyping
Embryos were generated by heterozygote intercrosses. Males and females were housed together, and the presence of a vaginal plug in the morning indicated E0.5 of development. E3.5 embryos were collected by flushing the uterus with outgrowth media (described below) for outgrowths, or with phosphate-buffered saline (PBS) with 0.03% (w/v) polyvinylpyrrolidone for other purposes. Embryos were cultured at 37°C and 5% O2, 5% CO2 atmosphere in a humidified incubator. Genotypes of individual embryos were determined by genomic PCR using the following primers: Trappc4 WT (515 bp) F1: 5′-ACCAGTGGGACAGCTATTCG-3′ and R1: 5′-TAGCCGGCCTAGAGACAGAT-3′ and MUT (339 bp) F2: 5′-ACCAGTGGGACAGCTATTCG-3′ and R2: 5′-CCAAAAGTGCCAGCCTTCTC-3′. Loss of WT Trappc4 transcript in mutants was demonstrated using RT-PCR primers designed within the deletion (F3: 5’- CCATGCAGTGTTGGCCATCA -3’ and R3: 5’-AGTTTGTGGTCCTGGCAGAC -3’). For all results shown, a minimum of three embryos of each genotype were assessed (more in most cases, as indicated in results).
RNA extraction, complementary DNA synthesis, RT-PCR analysis and quantitative RT-PCR
RNA was isolated from pooled wild-type embryo litters collected at zygote, 2-cell, morula and blastocyst stages. RNA was also isolated from single wild-type embryos collected at E6.5 and E7.5 stages. Brain, heart, kidney, liver, lung, ovary, testis and tongue samples were collected from adult wild-type C57BL/6NJ mice and RNA was isolated from those samples as well. RNA was isolated using the Zymo Quick-DNA/RNA Microprep Plus Kit (Zymo Research, D7005) and was converted into complementary DNA (cDNA) using the BioRad iScript cDNA Synthesis Kit (BioRad 1708890), according to the manufacturer’s protocol. RT-PCR was performed for 38 cycles of 30 s at 60°C, 72°C and 95°C with the following primers:
Mrpl17 (414 bp), 5’-CCATCTGCTGCGGAACTTG-3′, 5’-TTGCGTCCTGGTTATGGTG-3′; Trappc1 (142 bp), 5’- CCATTCGTTCGTTTGTCAGCA -3′, 5’- CCCACGCCCAAGTCAGTATT -3′; Trappc2 (194 bp), 5’- CTCATCTCGGCTCCTCCCTA -3′, 5’- TCGTCCACAAGGTCAAGAGC -3′; Trappc2l (455 bp), 5’- TCCGACAGAGAGTGAGCTCA -3′, 5’- ACTCAGGGAGCAGAAAGGGA -3′; Trappc3 (296 bp), 5’- ACCTATGGAGCGCTTGTCAC -3′, 5’- TCGGGAAGCTCCACAAAGTC -3′; Trappc3l (305 bp), 5’- AGAGCAAAGGCAGTAGAGCG -3′, 5’- CCAGCCGTGTTCCAATGTTG -3′; Trappc4 (385 bp), 5’- TCCCAGCTATCTCCGGAACA -3′, 5’- AAGGCTGCTACAACAGGACC -3′; Trappc5 (378 bp), 5’- CAGCACAGTTCCGGTTGAGA -3′, 5’- CCTTGACGAAGAGCAATGCG -3′; Trappc6a (319 bp), 5’- TACCTCCCGAGCTGACCAAT -3′, 5’- AGTCCGTCCATGTGCTTCTG -3′; Trappc6b (255 bp), 5’- TCATTCAGCTGTCTGCAGGA -3′, 5’- AACGATTTGCTCCAACGCAG -3′; Trappc8 (274 bp), 5’- CTCGCCTCACTTCCGAAGTT -3′, 5’- TCTGATGCTGGCATGGACTG -3′; Trappc9 (241 bp), 5’- TGTGCTCGGCTTCAGTCATT -3′, 5’- CATGCCACGCTTCTGAATCG -3′; Trappc10 (370 bp), 5’- AGTGCACCTTGCTCCTCTTC -3′, 5’- GCTGTGTTGGCTGTTTCAGG -3′; Trappc11 (339 bp), 5’- ACAATACCCCACTGGATGCG -3′, 5’- TCCAGGGCCTCTGTCCATAA -3′; Trappc12 (435 bp), 5’- GGCTGTGTTTGCTGGAAGTG -3′, 5’- AACCAGAGCTGCAAGGAGTC -3′; Trappc13 (397 bp), 5’- AGGCCATCCCAGACACTGTA -3′, 5’- TCACTGCACAAAGCTGACGA -3′.
Outgrowth assays
Blastocysts were harvested at E3.5 and cultured individually in iBiTreat dishes (µ-slide 8 well, 80826-90) with Dulbecco Modified Eagle Medium (Lonza, Allendale, NJ, USA) containing 10% (v/v) fetal bovine serum (Atlanta Biologicals, Flowery Branch, GA, USA), 1% (v/v) GlutaMAX (Thermo Fisher Scientific) and 1% (v/v) Penn-strep. Embryos were kept in culture for 72 h at 37°C and 5% O2, 5% CO2 atmosphere in a humidified incubator, followed by imaging and genotyping.
Immunofluorescence
Freshly dissected E3.5 embryos and outgrowths were fixed in 4% (w/v) paraformaldehyde for 10 minutes at room temperature, permeabilized in 1% (v/v) Triton-X and blocked with 0.1% (w/v) bovine serum albumin (BSA) supplemented with 0.01% (v/v) Tween20 and 20 μg/mL Fab fragment. Primary antibodies were diluted in 0.1% BSA supplemented with 0.01% Tween 20 (block) and incubated overnight at 4°C. The embryos were then rinsed with block for 30 min, followed by incubation with secondary antibodies at room temperature for an hour. Next, embryos were stained with DAPI in PBS (1 μg/mL) for 3 min and rinsed thoroughly. Images were taken with a Nikon Eclipse Ti Series inverted microscope with a C2 confocal attachment.
The primary antibodies used and their dilution include SOX2 (R and D Systems Cat# AF2018, RRID:AB_355110, 1:200), CDX2 (BioGenex Cat# MU392A, RRID:AB_2923402, 1:200); phospho-p53 (Ser15) (P53) (Cell Signaling Technology Cat# 9284S, RRID:AB_331464, 1:50).
The secondary antibodies used include Alexa Fluor 488 donkey anti-mouse (Thermo Fisher Scientific, A21202, 1:500); Alexa Fluor 546 donkey anti-rabbit (Thermo Fisher Scientific, A10040, 1:500); Alexa Fluor 647 donkey anti-goat (Thermo Fisher Scientific, A21447, 1:500); and DAPI (Molecular Probes, 1 μg/mL).
Quantification of cell number
The analysis was conducted using the Nikon Elements Analysis 3.1 software. The quantity of DAPI+, CDX2+, SOX2+ and P-p53+ cells were manually counted for statistical comparison. Statistical analyses were performed using Prism (Version 10). To assess statistical differences among three or more groups, one-way analysis of variance (ANOVA) was conducted. Multiple one-way ANOVA tests were used to compare several metrics between wild types, heterozygotes and mutants. Measurements compared were the quantities of total cells, SOX2+ cells relative to total cells, CDX2+ cells relative to total cells, P-p53+ cells relative to total cells, P-p53+ and SOX2+ cells relative to SOX2+ cells and P-p53+ and CDX2+ cells relative to CDX2+ cells. Statistical significance was set as p = 0.05.
Conclusions
Here we show that nearly all mammalian TRAPP complex subunits are widely expressed throughout early development and in adult tissues of the mouse (Figure 1). Trappc4 mutant embryos are present and appear morphologically indistinguishable from littermates at E3.5, but none are recovered at E7.5, suggesting that Trappc4 is required for survival at post-implantation stages (Figure 2B, C). Mutant and control E3.5 embryos exhibit no difference in the total number of cells per embryo (Figure 2F), nor in number or percentage of ICM and CDX2-positive cells (Figure 2G, H). However, when subjected to outgrowth assays, mutant embryos form highly irregular cultures with apparent dying ICM after 72 hours in vitro. Instead of a compact and tightly adhered ICM colony, loose clumps of small, rounded cells are detached and readily float away from where the ICM should be (Figure 3A). Analysis of cell death with P-p53 revealed no difference in cell death between mutants and controls (Figure 3C–E). These results indicate that loss of Trappc4 is early embryonic lethal at peri-implantation stages between embryo hatching (∼E4.0) and gastrulation stages (∼E7.5) and may provide a model for clinical scenarios where anembryonic pregnancies detected by ultrasound after transfer of morphologically normal blastocysts (Carlson and Tafti, Reference Carlson and Tafti2026). Additionally, although there are several documented cases of Trappc4 mutations resulting in neurodevelopmental disorder with epilepsy, spasticity and brain atrophy (OMIM, 2023). These are predominantly splice site and/or hypomorphic mutations and likely not null alleles. Further investigation of the role of Trappc4 in early development is needed to understand the mechanism by which Trappc4 mutations induce neurodevelopmental disorders in humans.
Author contributions
Sarah S. Mirza: Conceptualization-Equal, Formal analysis-Equal, Writing – original draft-Equal, Writing – review & editing-Equal; Louise Bassom: Formal analysis-Equal, Investigation-Equal, Writing – review & editing-Supporting; Minjun Ahn: Formal analysis-Equal, Investigation-Supporting; Jesse Mager: Conceptualization-Equal, Resources-Lead, Supervision-Lead, Writing – original draft-Equal, Writing – review & editing-Equal.
Competing interests
The authors declare none.
Funding information
This work was supported in part by NIH T32 GM135096 to SSM and NIH HD083311 to JM.
Open access
