Introduction
Soil salinity existed long before humans and agriculture; however, the problem has been aggravated by agricultural practices such as irrigation (Zhu, Reference Zhu2001). It is estimated that about 20% of irrigated agricultural land throughout the world is adversely affected by salinity. Plants differ greatly in their tolerance to salinity, with rice (Oryza sativa L.) being the most sensitive cereal. Rice is the primary food source for over half of the world's population and has been the subject of countless breeding programmes to increase its productivity and tolerance to both biotic and abiotic stresses. Analysis of the molecular mechanisms underlying salinity tolerance is being undertaken to provide practical contributions to food production, particularly to mitigate the effects of increasing salinization and climate change.
In rice, differences among genotypes account for its response towards salinity (Zeng, Reference Zeng2005). The importance of genes hidden in the primary rice gene pool (including low-yielding ancestors and traditional landraces) to enhance rice performance in stress conditions was previously illustrated (Ali et al., Reference Ali, Xu, Ismail, Fu, Vijaykumar, Gao, Domingo, Maghirang, Yu, Gregorio, Yanaghihara, Cohen, Carmen, Mackill and Li2006). Since the most common forms of genetic variation within natural populations are single nucleotide polymorphisms (SNPs) and small insertions and deletions (indels), a further step can be achieved by investigating such variation in key-responsive genes from diverse germplasm (Raghavan et al., Reference Raghavan, Naredo, Wang, Atienza, Liu, Qiu, McNally and Leung2007). While we are now in the ‘next-generation sequencing’ era, many research programmes have limited funding and need more cost-effective, high-throughput techniques. The EcoTILLING method allows SNPs and indels discovery and the delineation of haplotypes at loci of interest (Comai et al., Reference Comai, Young, Till, Reynolds, Greene, Codomo, Enns, Johnson, Burtner, Odden and Henikoff2004). We are using EcoTILLING to explore the natural variability existing in rice germplasm at key genes related to salinity tolerance. Although this large-scale analysis is still ongoing, we have already obtained promising results showing high genetic variability in rice germplasm at salinity tolerance loci and the potential to deliver superior alleles for breeding programmes targeting salinity tolerance.
Materials and methods
We used 375 genotypes that represent the diversity present in O. sativa, which were selected from the set genotyped by single sequence repeats in the ‘Generation Challenge Program’ with a population structure similar to that of Garris et al. (Reference Garris, Tai, Coburn, Kresovich and McCouch2005). Deoxyribonucleic acid (DNA) was extracted from leaf tissue according to Fulton et al. (Reference Fulton, Chunwongse and Tanksley1995). DNA from all samples was brought to a concentration of 0.5 ng/μl. For EcoTILLING, DNA from each genotype was contrasted with either ‘IR64’ (against indica, admixed and Aus accessions) or ‘Nipponbare’ (against japonica, aromatic and admixed) separately, in a 1:1 ratio.
Target genes were SalT (LOC_Os01g24710) and OsCPK17 (LOC_Os07g06740). Primers were designed (based on the ‘Nipponbare’ genome sequence) with Primer3 software to amplify part of an intron and the 3′-untranslated region (UTR) of OsCPK17 (forward – AATTGGAGGTTGGGCCATAG; reverse – TGTGAGGTGGAAGAAGCAAAC) and the second exon and the 3′-UTR region of SalT (forward – ACCACTCAACACCGGTAGGACACT; reverse – GCAGATTAAACTGGGCTCCTCTGA), corresponding to 979 and 825 bp products, respectively.
The polymerase chain reaction (PCR) was performed in 14 μl final volume, using 3.5 ng of total DNA as template, 0.4 U/reaction of Taq DNA polymerase (Promega, Madison, WI, USA). The PCR cycling conditions were set at 95°C for 3 min, followed by 35 cycles of 95°C for 20 s, 61–64°C (depending on primer specificity) for 30 s, 72°C for 30 s and a final extension of 7 min at 72°C. The PCR products were denatured at 99°C for 10 min and renatured initially at 70°C for 20 s followed by 69 cycles with a temperature decrease by 0.3°C per cycle. Celery juice extract (CJE) was produced by the technique of Till et al. (Reference Till, Burtner, Comai and Henikoff2004). The mismatch cleavage (CJE digestion optimized for each primer) and EcoTILLING analysis in agarose gel were performed according to Raghavan et al. (Reference Raghavan, Naredo, Wang, Atienza, Liu, Qiu, McNally and Leung2007).
Results and discussion
Rice cultivars with different salt sensitivities have been studied using transcriptomic approaches (Walia et al., Reference Walia, Wilson, Condamine, Liu, Ismail, Zeng, Wanamaker, Mandal, Xu, Cui and Close2005, Reference Walia, Wilson, Zeng, Ismail, Condamine and Close2007; Kumari et al., Reference Kumari, Panjabi, Kushwaha, Sopory, Singla-Pareek and Pareek2009; Senadheera et al., Reference Senadheera, Singh and Maathuis2009), revealing highly significant differences in gene regulatory mechanisms between genotypes. A clear example of the importance of genotypic differences between varieties towards salt stress was given by the allelic differences found in OsHKT8 gene between two different genotypes (Ren et al., Reference Ren, Gao, Li, Cai, Huang, Chao, Zhu, Wang, Luan and Lin2005). The six nucleotide substitutions in the coding region leading to four amino acid changes present in ‘Nona Bokra’ enhanced the overall Na+ transport activity (Ren et al., Reference Ren, Gao, Li, Cai, Huang, Chao, Zhu, Wang, Luan and Lin2005), showing the importance of discovering superior alleles in salt stress-related genes.
We are presently evaluating the haplotype groups of OsCPK17 and SalT genes by EcoTILLING. OsCPK17 encodes a calcium-dependent protein kinase, and its promoter contains cis elements responsive to various stress stimuli. Wan et al. (Reference Wan, Lin and Mou2007) showed that OsCPK17 is down-regulated by salt, cold and drought, indicating its importance in stress signal transduction in rice. The SalT gene was first isolated and characterized from the roots of rice plants treated with salt (Claes et al., Reference Claes, Dekeyser, Villarroel, Vandenbulcke, Bauw, Vanmontagu and Caplan1990) and co-localizes with the Saltol Quantitative Trait Loci. Although several studies have already been performed (Claes et al., Reference Claes, Dekeyser, Villarroel, Vandenbulcke, Bauw, Vanmontagu and Caplan1990; Zhang and Blumwald, Reference Zhang and Blumwald2001; de Souza et al., Reference de Souza, Ferreira, Dias, Queiroz, Branco, Bressan-Smith, Oliveira and Garcia2003), the function of SalT is not clearly understood.
In our EcoTILLING assay, we amplified c. 1 kb targets of each gene using specific primers. If the amplicons differ in sequence content between the reference and target germplasm, heteroduplex mismatch molecules will occur on re-annealing. Digestion with CJE endonuclease reveals bands other than full-length products indicating SNPs or/and indels. By comparing the digestion patterns, haplotypes can be assigned, as shown in Fig. 1. The number, position and type of SNPs in the haplotypes were validated by sequencing the PCR amplicons.
Analysis of the EcoTILLING digestion patterns in agarose gel for OsCPK17 in different rice varieties. The varieties shown were contrasted with ‘IR64’ and created four haplotype groups (A, B, E and D) according to CJE-cleaved products. 1, PATNAI 23; 2, CODE NO. 31293; 3, TOS7564; 4, KHAO PON; 5, MALLIGAI (KOTTAMALLI SAMBA); 6, TUNGHWANPEI; 7, DE ABRIL; 8, LAGEADO; 9, BALA; 10, SINNA SITHIRA KALI; M, molecular marker.
The analysis of the EcoTLLING digestion patterns identified ten haplotypes for OsCPK17 and six haplotypes for SalT (Table 1). For OsCPK17, haplotypes A and G (which include the reference types ‘IR64’ and ‘Nipponbare’, respectively) are more frequent, whereas E, F, I and J are very rare (each represented by one accession). The observed mismatches were explained by 15 SNPs or indels with most of the indels being detected in repetitive sequences: (CT), (T) or (GT). All polymorphisms detected in OsCPK17 do not seem to interfere with 3′-splice sites. As of now, we have found 23 SNPs or indels in the SalT gene. Haplotype A is the most frequent and includes both reference genotypes ‘IR64’ and ‘Nipponbare’. The transition T/C (position 1108) is a silent mutation, whereas the transition A/C (position 1159) leads to a glutamate to aspartate change. Since these two amino acids belong to the same group, this change may have little or no consequence on protein structure/function. The remaining SNPs and indels were located in the 3′-UTR region. These variations may be of significance since it is now recognized that 3′-UTRs play crucial roles in the post-transcriptional regulation of gene expression through the modulation of nucleocytoplasmic messenger ribonucleic acid (mRNA) transport, regulation of mRNA polyadenylation and translation, translation efficiency, sub-cellular localization and messenger stability (Mignone et al., Reference Mignone, Grillo, Licciulli, Iacono, Liuni, Kersey, Duarte, Saccone and Pesole2005).
Sequence and position of the SNPs and indels found in OsCPK17 and SalT genes
Our large-scale analysis is also targeting and analysing other regions of SalT and OsCPK17, as well as of other genes important in salinity tolerance. We will further assess the relevance of the DNA variations by testing association with salinity tolerance phenotypes. Eventually, we hope to uncover novel superior alleles that can be used in rice-breeding programmes for salt stress tolerance.
Acknowledgements
This work was financially supported by Fundação para a Ciência e a Tecnologia (Portugal) through the project FCT- PTDC/AGR-GPL/70920/2006. Sónia Negrão gratefully acknowledges FCT-Portugal for the financial support (SFRH/BPD/34593/2007). All the plant material was kindly provided by the International Rice Genebank, located at the International Rice Research Institute (IRRI, The Philippines). We also thank Ma. Elisabeth B. Naredo (IRRI) for the laboratory support, and Isabel Abreu (IBMC, Portugal) for the protein analysis and help with the CJE production. Nelson Saibo is also acknowledged for the critical review of this manuscript.
