Introduction
The Linnean shortfall, i.e. inadequate knowledge of species diversity, is one of the obstacles to the understanding of natural and modified ecosystem functioning (Hortal et al., Reference Hortal, de Bello, Diniz-Filho, Lewinsohn, Lobo and Ladle2015). In modified ecosystems, such as agroecosystems, there is ample knowledge about the so-called pest species. However, such species are frequently identified considering only external morphological features, disregarding the frequent presence of cryptic species (Joyce et al., Reference Joyce, Higbee, Haviland and Brailovsky2017; Paterson, Reference Paterson and Zaluck1991). To better understand the real diversity in agroecosystems, as well as to provide means to its management, it is important to properly name and describe this diversity (Lyal et al., Reference Lyal, Kirk, Smith and Smith2008). The classificatory understanding of any taxon leads to a reference system (Raposo et al., Reference Raposo, Kirwan, Lourenço, Sobral, Bockmann and Stopiglia2021), promoting information that will be conveniently used by agriculture (Douglas et al., Reference Douglas, Dang, Gill, Huber, Mason, Parker and Sinclair2009), in addition to other fields of knowledge, in the appropriate management of resources.
Commonly known as spittlebugs, the Cercopidae (Hemiptera: Auchenorrhyncha) (∼2,600 spp.; Bartlett et al., Reference Bartlett, Deitz, Dmitriev, Sanborn, Soulier Perkins, Wallace, Footit and Adler2018) play a significant role as xylem sap-suckers, which may impact host performance, and many species show affinity for nitrogen-fixing plants (Thompson, Reference Thompson1994). However, the true diversity of cercopids is unknown, with estimates that less than 20% of the cercopid fauna has been described (Kosztarab et al., Reference Kosztarab, O’Brien, Stoetzel, Deitz and Freytag1990). Also, natural history knowledge about cercopids is limited, with observations that many cercopids undergo nymphal development on roots or just below the soil surface, enveloped in foam secretions (Bartlett et al., Reference Bartlett, Deitz, Dmitriev, Sanborn, Soulier Perkins, Wallace, Footit and Adler2018). In susceptible forage grasses, severe cercopid outbreaks can cause physiological disorders in the above-ground biomass due to feeding injuries (Peck et al., Reference Peck, Morales and Castro2004).
Because of their feeding behaviour, most attention has been given to the few cercopid species of economic importance, feeding on the sap of various plants throughout their life stages. As an example, some spittlebugs are known to feed on sugarcane in the Neotropical region, including at least five known species of Mahanarva (Distant, Reference Distant1909): M. fimbriolata (Stål, Reference Stål1854), M. indentata (Walker, Reference Walker1858), M. liturata (Le Peletier & Serville, Reference Le Peletier de Saint-Fargeau and Serville1825), M. posticata (Stål, Reference Stål1855), and M. spectabilis (Distant, Reference Distant1909), among a total of 47 species of Mahanarva distributed from Mexico to South America (Castro-Valderrama et al., Reference Castro-Valderrama, Peck, Carvalho, Valdez–Carrasco and Romero–Nápoles2018; Schöbel and Carvalho, Reference Schöbel and Carvalho2021). The direct feeding of adults of Mahanarva spp. causes phytotoxemia, in contrast, nymphs constantly suck the sap of roots causing wilting and stunting (Resende et al., Reference Resende, Auad, Fonseca, Dos Santos and Vieira2012), reducing the production and quality of sugarcane (Madaleno et al., Reference Madaleno, Ravaneli, Presotti, Mutton, Fernandes and Mutton2008) as well as reducing sugarcane yield by up to 50% (Schöbel and Carvalho, Reference Schöbel and Carvalho2021). Also, these spittlebugs may be vectors of pathogenic agents (Bini et al., Reference Bini, Serra, Pastore, Brondi, Camargo, Monteiro-Vitorello, van Sluys, Rossi and Creste2023).
In Brazil, it is common to find M. fimbriolata, M. liturata, and M. spectabilis on sugarcane crops (Dias et al., Reference Dias, Auad, Magno, Resende, Fonseca and Silva2019; Dinardo-Miranda et al., Reference Dinardo-Miranda, da Costa, Fracasso, Perecin, de Oliveira, Izeppi and Lopes2014; Schöbel and Carvalho, Reference Schöbel and Carvalho2021). Mahanarva liturata can be easily distinguished from the other two species by its black head and pronotum, whereas in the other two species, these structures are brownish-red. Separation of M. fimbriolata and M. spectabilis in the field is difficult because they show similar external morphologies, and unambiguous identification is only possible through genitalic morphology inspected after dissection (Carvalho and Webb, Reference Carvalho and Webb2005). When revising the morphological diversity of cercopids feeding on sugarcane, we came upon a morphotype discordant with the previously recorded species. In this work, we investigate this morphotype combining different approaches and lines of evidence from morphological and molecular data, and propose a new species of Mahanarva that uses sugarcane as one of its host plants.
Material and methods
Specimen sampling
Specimens of Mahanarva spectabilis, M. fimbriolata and M. diakanta sp. n. were collected by hand or sweeping in sugarcane crops from 2014 to 2017, in ten Brazilian states in the North (Pará and Tocantins), Northeast (Piauí and Ceará), Midwest (Goiás, Mato Grosso, and Mato Grosso do Sul), Southeast (Minas Gerais and São Paulo) and South regions (Paraná). Additional specimens were accessed in two entomological collections of reference for Neotropical cercopids: the Coleção Pe. Jesus Santiago Moure, Departamento de Zoologia, Universidade Federal do Paraná, Curitiba, Paraná (DZUP) and Museu de Ciências e Tecnologia da Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul (MCTP).
We included geographical occurrence records only when we could confirm species identification through morphological analyses of the male genitalia. When geographic coordinates were not available from specimen labels, we retrieved the geographic coordinate to the municipality from gazetteers. Maps were generated with SimppleMappr (Shorthouse, Reference Shorthouse2010), using the countries, state/provinces, and relief layers. Then, maps were edited in Adobe Illustrator 2024.7.
General morphological procedures
Morphological terminology follows Fennah (Reference Fennah1968) and Paladini et al. (Reference Paladini, Takiya, Cavichioli and Carvalho2015), including the use of ‘tegmina’ for the forewings. All observed specimens are reported; label information for all specimens is listed in the examined material. Photographs were taken using a Nikon AZ100M and stacked with the software NIS Elements AR, available at the Department of Zoology, UFRGS. Measurements were taken in millimetres (mm). Genitalia were prepared with aqueous super saturated KOH solution, following Oman (Reference Oman1949). Line vector drawings were made over photographs taken under light microscopy and double-checked by comparison with specimens. Specimen measurements were taken using a Leica MZ125 microscope with an attached ocular micrometre, based on ten specimens per species; minimum and maximum sizes are presented in millimetres.
Geometric morphometric procedures
Through morphology, unambiguous specimen identification is possible only for males. Thus, our working dataset comprises 419 male specimens (M. fimbriolata, n = 63; M. spectabilis, n = 95; M. diakantha sp. n., n = 261) collected in geographically diversified sugarcane crop areas in Brazil. Hindwing shape was quantified based on a set of 16 homologous landmarks consisting of intersections between wing veins (fig. 1). Landmarks were digitised from the right hindwing of each specimen. Right wings were dissected, slide-mounted and photographed using an MshOt digital camera mounted to a Leica MZ12.5 under 8x magnification. Images were organised in a single .tps file using tpsUtil (Rohlf, Reference Rohlf2018) and digitised using tpsDig2 (Rohlf, Reference Rohlf2017).
Position of landmarks on hindwing (n = 16) of Mahanarva sp. Used for shape analysis through geometric morphometry. All landmarks are at vein intersections.
Shape information was extracted from the landmark configurations of all specimens and species at once by generalised Procrustes superimposition and projection to the tangent space (Dryden and Mardia, Reference Dryden and Mardia1998). To estimate the influence of mounting, imaging, and digitising on shape, 30 randomly selected male specimens (10 per species) were slide-mounted three times each. Each wing mounting was photographed once and each photograph was digitised thrice. This dataset, containing 270 landmark configurations, was tested for the two sources (mounting and digitising) of error by Procrustes ANOVA (Klingenberg et al., Reference Klingenberg, Barluenga and Meyer2002; Klingenberg and McIntyre, Reference Klingenberg and McIntyre1998), a method for quantifying relative amounts of variation at different levels, proposed to primarily quantify measurement error, asymmetry and variation among individuals. Error estimates due to specimen preparation, imaging and digitisation were negligible. For the remaining analyses, each specimen was slide-mounted, photographed, and digitised once.
Allometric effects of size on shape were tested using regressions with log transformed centroid size as independent variable and shape coordinates as dependent variable, under 10,000 iterations, and pooling variations within species groups (Klingenberg, Reference Klingenberg2016). Since we found an effect of size on shape (Sum of squares: Total, 0.71686416; Predicted, 0.01469667; Residual, 0.70216749; %SS predicted, 2,05%; p-value: <0.001), we used the residuals of regression models for size correction of shape data in further analyses.
To estimate the level of discrimination between species, we performed a canonical variate analysis using the residuals of shape on size regression. Through permutations, we performed an overall test of the group effect against the null hypothesis that there are no differences in means between any of the groups and pairwise tests between all possible pairs of species, each with 10,000 iterations and using Pillai’s trace statistics. To assess the level of correct species assignment, we performed pairwise discriminant function analysis for each species pair, using the leaving-one-out cross-validation procedure, with 10,000 iterations. All geometric morphometric analyses were performed using MorphoJ v.1.08.02 (Klingenberg, Reference Klingenberg2011).
Molecular diagnosis and genetic distance calculations
For the molecular study, we used part of the material previously identified through genitalic dissection. Specifically, we examined 12 specimens of M. spectabilis from three populations, three specimens of M. fimbriolata from Monte Alegre, MG, and 45 specimens of M. diakantha sp. n. from 14 different localities. Additionally, we included individuals from the following species in our analysis: M. tristis (Fabricius, 1803), M. tibialis (Signoret, 1862), M. integra (Walker, 1858), M. insignita (Fowler, 1897), and M. funebris (Distant, 1909) (Table S1). Genomic DNA was extracted from thoracic muscles of M. fimbriolata, M. spectabilis, M. diakantha sp. n., and M. tristis using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) according to the manufacturer’s protocol.
A fragment of the cytochrome c oxidase subunit I (COI) gene was amplified via polymerase chain reaction (PCR) using the primers C1-J-1718 (5′ GGAGGATTTGGAAATTGATTAGTTCC 3′) (Simon et al., Reference Simon, Frati, Beckenbach, Crespi, Liu and Flook1994) and C1-J-2441 (5′ GCTAATCATCTAAAAATTTTAATTCCTGTTGG 3′) (Tuda et al., Reference Tuda, Rönn, Buranapanichpan, Wasano and Arnqvist2006, modified from; Simon et al., Reference Simon, Frati, Beckenbach, Crespi, Liu and Flook1994). The PCR amplicons were then separated by agarose gel electrophoresis and visualised under ultraviolet light. Purification of the PCR products was performed using the ExoSAP-IT™ Express PCR Product Cleanup Reagent according to the manufacturer’s protocol. The purified products were sequenced bidirectionally using the Sanger method, with sequencing services provided by Macrogen (Seoul, South Korea). The quality of the COI sequences was evaluated by examining chromatograms in Geneious Prime 2023.2.1 software (http://geneious.com), and consensus sequences were generated for further analysis. The COI sequences have been deposited in GenBank under accession numbers PV034460–PV034519, and PV037363 (Table S1).
Genetic distances were calculated using the Kimura 2-parameters model (K2P) in MEGA 11.0 software (Tamura et al., Reference Tamura, Stecher and Kumar2021) with 5,000 bootstrap replications. For this analysis, the COI sequences of each species were grouped, with each species treated as a separate group.
For the phylogenetic analysis, a total of 65 COI sequences were used, including those we generated and others obtained from GenBank (Table S1). The 616 bp COI fragments were aligned using Mega 11.0 software (Tamura et al., Reference Tamura, Stecher and Kumar2021). The GTR + I evolutionary method was selected based on analysis conducted with MrModeltest 2.3 software (Nylander, Reference Nylander2004). A Bayesian phylogenetic hypothesis was constructed using MrBayes v3.1 (Ronquist and Huelsenbeck, Reference Ronquist and Huelsenbeck2003) with a run of 5 million generations and a burn-in of 10%, as determined by Tracer 1.7 software (Rambaut et al., Reference Rambaut, Drummond, Xie, Baele and Suchard2018). Finally, a consensus tree was calculated.
Results
Morphological analysis
Study of the external morphology and genitalia of male and female specimens of Mahanarva spp., utilising sugarcane, indicates that the colouration of M. diakantha sp. n. (fig. 2A–D), M. fimbriolata (fig. 2E–H), and M. spectabilis (fig. 3I–L) are very similar; however, there are some differences in the morphs, especially about the red colouration pattern. M. diakantha sp. n. exhibits yellow orangish or reddish tegmina combined with narrow or incomplete black longitudinal stripes and a narrow black stripe over the claval vein (fig. 2A–D), while M. fimbriolata is consistently red with the head and pronotum dark red and a slightly marked black stripe over the claval vein (fig. 2E–H). Also, in M. fimbriolata variations can occur in the black longitudinal stripes on the tegmina, which can be complete (fig. 2E,F), incomplete (fig. 2H), or absent (fig. 2G). On the other hand, M. spectabilis has wider longitudinal stripes than the other species (fig. 3K,L) also exhibits red or black morphs (fig. 3I,J). Furthermore, M. diakantha sp. n. specimens with yellow orangish tegmina (fig. 2B–D), featuring narrower black stripes than M. spectabilis (fig. 2B,C), or incomplete black longitudinal stripes (fig. 2D). Likewise, the yellow orangish tegmina pattern can be found in M. spectabilis, but the yellow longitudinal stripes are narrower than those of M. diakantha sp. n. (fig. 2K).
Colour variation of three Mahanarva spp. Usually associated with sugarcane in Brazil. (A–D) Mahanarva diakantha sp. n., Dorsal view. (E–H) Mahanarva fimbriolata, dorsal view. (I–L) Mahanarva spectabilis, dorsal view. Scale bars = 2 mm.
Mahanarva (Mahanarva) diakantha sp. n. (A,B) Habitus, (A) Dorsal view, (B) Lateral view; (C) Male pygofer, lateral view; (D) Paramere, lateral view; (E) Subgenital plate, ventral view; (F,G) Paramere, (F) Anterolateral view, (G) Frontal view; (H,I) Aedeagus, (H) Lateral view, (I) Dorsal view; (J) Female pygofer, ventral view; (K) Female first valvulae of ovipositor.
The male genitalia of M. diakantha sp. n. closely resembles those of M. fimbriolata and M. spectabilis. It is distinguished from M. fimbriolata by the presence of a bifid paramere spine (fig. 3F,G), whereas M. fimbriolata has a non-bifid paramere spine (fig. 4I,K,M). Compared to M. spectabilis, M. diakantha differs in the shape of the paramere spine, which is acute in M. diakantha (fig. 3D,F,G), while it is quadrangular and uniquely characteristic in M. spectabilis (fig. 4J).
Habitus and genitalia of Mahanarva fimbriolata and Mahanarva spectabilis. White circles next to the figure letters correspond to Mahanarva fimbriolata, while black circles correspond to Mahanarva spectabilis. (A–C) Habitus, dorsal view; (B–D) Habitus, lateral view; (E,F) Male pygofer, lateral view; (G,H) Male pygofer, ventral view; (I,J) Paramere, lateral view; (K,L) Paramere, anterolateral view; (M,N) Paramere, frontal view; (O,P) Aedeagus, lateral view; (Q,R) Aedeagus, dorsal view; (S,T) Female pygofer, lateral view.
The female genitalia of M. diakantha sp. n. (fig. 3K) and M. fimbriolata (fig. 4S) are very similar, both having a spoon-like basal process on the first ovipositor valvulae. In contrast, M. spectabilis differs from these two species by having a slender and longer basal process on the first ovipositor valvulae (fig. 4T). Generally, female genitalia in Cercopidae are conserved and exhibit less intrageneric variation than male genitalia.
Morphogeometrics discrimination
The forewing shape allows separating M. diakantha sp. n., M. fimbriolata, and M. spectabilis (Pillai’s trace: 1.0689, p-value: <0.001) as well as all pairs of species (p-values: <0.001). Major differences in forewing shape are observed in vein-crossings medially and in the apical margin (fig. 5). Also, most specimens are correctly assigned to species groups, with overall correct classification of 89.45%. However, lower levels of correct classification are observed between M. fimbriolata and M. diakantha sp. n. (table 1).
Multiple group discriminant function analysis plot based on first and second canonical variates for hindwing shape, showing separation between M. spectabilis and the other two species. Mahanarva fimbriolata and M. diakantha sp. n. Show some degree of overlap, but are largely identifiable (see Results and table 1). Shape variation associated with the extreme of each axis is depicted with deformation grids and vectors; distortions in the deformation grid indicate the locations of variation, while the vectors show the direction and magnitude of the distortion.
Classification of individuals to species of Mahanarva through discrimination function analysis of pairs of species assessed by leave-one-out cross-validation
Molecular discrimination
The analysis of COI fragments with a total of 676 bp in the 65 samples revealed the occurrence of 526 bp conserved nucleotide sites and 150 bp phylogenetically informative variable sites, considering the eight species of Mahanarva. The number of variable sites were lower when we compared only the three species that use sugar-cane crops, i.e. M. diakantha sp. n., M. fimbriolata, and M. spectabilis, with occurrence of 48 variable sites. The variable sites were originated by nucleotide substitutions. No insertions or deletions were noticed. Average nucleotide composition revealed a high A + T profile, corresponding to 68.6%. Analysis of interspecific genetic distance, considering all taxa, ranged from 0% between M. tibialis and M. funebris to 14.67% between M. funebris and M. integra and M. integra and M. tibialis. Lower genetic distances were found for the three species, ranging from 2.82% to 4.32%, with the lowest genetic distances between M. fimbriolata and M. diakantha sp. n. (table 2).
Genetic distance (mean ± standard error) among eight Mahanarva species
The Bayesian phylogenetic hypothesis for COI gene revealed that M. diakantha sp. n., M. fimbriolata, and M. spectabilis form three independent monophyletic groups with the other species as their sister groups (fig. 6). Mahanarva diakantha sp. n. is phylogenetically closer to M. fimbriolata than to M. spectabilis. All individuals of M. diakantha sp. n. comprise a monophyletic, albeit polytomous, group, meaning this COI fragment does not give evidence of geographical structure (fig. 6), despite the diverse geographic origin of the samples.
Bayesian phylogenetic tree of Mahanarva species based on the mitochondrial gene COI. The values in each branch/node correspond to the posterior probability.
Geographical distribution
Mahanarva fimbriolata is distributed (fig. 7A) mainly in southeastern Brazil, particularly in São Paulo, Minas Gerais, and Paraná. Mahanarva spectabilis has a broader distribution (fig. 7B) in central and southeastern Brazil, extending into Goiás, Mato Grosso do Sul, and São Paulo. Mahanarva diakantha sp. n. (fig. 7C) is found primarily in southern Brazil, especially in Paraná and Santa Catarina. The overlapping areas (fig. 7D) suggest that M. fimbriolata, M. spectabilis, and M. diakantha sp. n. occur in sympatry, particularly in southeastern Brazil. However, each species has distinct primary areas of occurrence, with M. spectabilis covering the widest range.
Occurrence record maps of (A) Mahanarva fimbriolata, (B) M. spectabilis, and (C) M. diakantha sp. n. (D) Composite image of occurrence records of each species, delimited by polygons created through the connection of extreme occurrence records of each species, highlighting the areas of probable sympatry between species. The border of Brazil is highlighted in a thicker black line, divisions within the country denote its states.
Taxonomy
Mahanarva diakantha Carvalho & Paladini sp. n.
Type material
Holotype male, BRAZIL, São Paulo, Salesópolis, Estação Biológica da Boracéia, 23-29.XI.2009, 23.6643ºS, 46.8896ºW, A. Paladini, D.R. Parizotto, P.C. Grossi, 1 male (DZUP). Paratypes: Mato Grosso do Sul: Corumbá, Serra do Amolar, 8-9.II.2019, 18º44′07″S, 57º33′12″W, A.P.Pinto leg. 1 male (DZUP); Goiás: Jussara, 15.II.2014, R. Loosli, 1 female (MCTP-74261); Minas Gerais: Passos, III. 1961\XI. 1963, C. Elias, 3 males (DZUP); Uberaba, 01-31.I.2017, 2 males (DZUP); Conceicao Das Alagoas, 11.II.2014, H. Oliveira, 1 male (MCTP-74258); Arapora, 11.II.2014, R. Zanni, 1 female (MCTP-74260); Campo Florido, 16.IV.2014, C. Palamin, 1 female (MCTP-74262); Iturama, 02.IV.2014, A. Carneiro, 1 female (MCTP-74263); São Paulo: Salesópolis, Estação Biológica da Boracéia, 23-29.XI.2009, 23.6643ºS, 46.8896ºW, A. Paladini, D.R. Parizotto, P.C. Grossi, 1 males (DZUP); Olímpia, 02.III.2001, P.S.M. Botelho, 1 male (DZUP); Monte Alto, 26.II.2001, J.F. Garcia, 1 male (DZUP); Teodoro Sampaio, Parque Estadual Morro do Diabo 22º31.5′S 52º21′W 300 m, 07.XII.2010, Melo & Luz leg. light trap, 1 male (DZUP); Cosmópolis, 01.III.1965, Moure, Mitchell, Nogueira, 1 male (DZUP); Araras, 07.II.2001, J.F. Garcia, 5 males (DZUP); Piracicaba, 01.III.2001, J.F. Garcia, 5 males (DZUP); Araraquara – Gavião Peixoto, 17.III.2014, V. Teles, 1 male (MCTP-74254); Guaira, 14.II.2014, C. Barella, 1 male (MCTP-74255); Ourinhos – Fazenda Imbirissu, – .II.2014, I. Silvério, 1 male (MCTP-74256); Promissao, 12.II.2014, C. Cassiano, 1 male (MCTP-74257); Jau – Potunduva, 28.III.2014, V. Teles, 1 female (MCTP-74259); Paraná: Pontal do Paraná, 11.III.2018, 25º42′20″S, 48º28′23″W, S. Foladori, 1 male (DZUP); Londrina, 19.IV.2016, 1 male (DZUP); Antonina, Reserva Natural da Guaricica, Alojamento Bom Jesus, 25º18′42″S 48º40′18″W 9 m, 23-27.X.2017, AP Pinto leg., 2 males (DZUP); Antonina, Res. Rio Cachoeira, 23-27.I.2017, 25.316ºS, 48.696ºW, R.R. Cavichioli, 1 male (DZUP); Turneiras do Oeste, REBIO das Perobas, 01-04.IV.2024, sweep, AC Domahovski & L Alasmar leg., 1 male (DZUP); São José dos Pinhais, 05.IV. 2014\25-28.II.2017, 25º36′18″S, 49º11′37″W, A.C. Domahovski, 2 males (DZUP); Santa Catarina: Itajaí, 18.I.1984, ER Silveira leg., 3 males (DZUP).
Measurements
Body length: ♂ 11.7–14.6, ♀ 12.6–14.0; Tegmina length: ♂ 10.6–11.2, ♀ 9.8–11.48; Tegmina width: ♂, 3.1–4, ♀ 3.5–3.92; Pronotum width: ♂ 4–4.5, ♀ 4.34–4.9.
Description
Head (fig. 3A,B) brownish red, compound eyes brownish red, rounded, arranged transversely; vertex smooth, rectangular with a slightly marked longitudinal carina; ocelli brownish closer to each other than to compound eyes; tylus smooth with a prominent longitudinal carina; antennae brownish red, pedicel sparsely setose, basal body of flagellum ovoid with one arista shorter than pedicel; postclypeus inflated and convex in profile (in males), angulated (in females), with one prominent longitudinal carina, lateral grooves strongly marked; rostrum reaching the mesocoxae. Thorax (fig. 3A,B) brownish red; pronotum brownish red, hexagonal, with a longitudinal carina; pronotum with anterior margin straight, lateral-anterior margins straight, lateral posterior margin slightly sinuous, posterior margin grooved; scutellum brownish red with slight central concavity, with horizontal grooves slightly marked; tegmina red with costal, apical and anal margins black, with two black, longitudinal stripes: one located between the veins R and M, extending to the apex, the other located over the claval area, apical reticulation developed; hindwings hyaline with brownish red venation, vein Cu1 not thickened at base; legs brownish red; metathoracic tibia with two lateral spines (basal spine equal in size to spines in apical crown; apical spine larger than spines in apical crown); apical crown of spines on tibia consisting of two rows; basitarsus with three rows of spines covered by long and dense setae; subungueal process present and quadrangular. Abdomen brownish red. Male. Pygofer with one process between anal tube and subgenital plates (fig. 3C); subgenital plates long with acute spine on apex and dorsal margin rounded near base (fig. 3C); parameres (fig. 3D–G) each with an apical spine bifurcated directed anteriorly, surpassing the paramere apex, dorsal margin rounded; aedeagus (fig. 3I–K) cylindrical with a pair of elongate dorsal processes inserted on the median third with apex turned upward. Female. Ovipositor (fig. 3J) with first valvulae (fig. 3K) long and slender with acute apex and one basal process poorly developed, rounded, directed downwards; second valvulae long, with apical third of dorsal margin serrate; third valvulae short and wide, with long ventral setae.
Remarks
Mahanarva diakantha is very similar to M. fimbriolata and M. spectabilis. It is easily distinguished from M. spectabilis by the shape of the paramere tooth, which is quadrangular and very characteristic in M. spectabilis. Additionally, M. spectabilis has a reddish-brown colouration on the head and pronotum. It can be differentiated from M. fimbriolata by the male genitalia with a single spine on the paramere, whereas M. diakantha sp. n. has a bifid paramere spine. Mahanarva diakantha sp. n. may exhibit colour polymorphism, with some specimens displaying a paler red (fig. 2B), a yellowish colour (fig. 2C,D) and others a more vivid red (fig. 2A). The longitudinal stripes on the tegmina can also vary in thickness.
Etymology
The Greek nouns: ‘di’ means two, double and ‘akantha’ means thorn, spine; the specific name ‘diakantha’ refers to the bifid paramere spine, a diagnostic feature of this species.
Examined material
BRASIL, Goiânia: Goianesia, Usina Jalles Machado, Fazenda Pai João XIV, 19.II.2014, 15°10′24″S, 48° 51′16″, A. Volpato & A. Carneiro leg. 49 males 6 females (MCTP); Quirinópolis, Usina Boa Vista, 11.II.2014, 18º27′58″S, 50º27′00″W, R. Zanni & A. Carneiro leg. 1 male (MCTP); Mato Grosso do Sul: Deodapolis, Usina Eldorado (Odebrecht), Fazendo Ceará Talhão, no collection date, 22°16′35″S, 54°10′07″W, A. Coelho leg. 12 males, 8 females (MCTP); Rio Brilhante, Usina Rio Brilhante (Biosev), Fazenda Ramalhete, no collection date, 21°48′11″S, 54º32′35″W, A. Coelho & L. Montans leg. 23 males, 3 females (MCTP); Minas Gerais: Araporã, Usina Alvorada, Fazenda Medalha, 11.II.2014, 18°30′22″S 49°12′17″W, R.Zanini & A. Carneiro leg. 27 males, 8 females (MCTP); Campo Florido, 11.II.2014, 19º37′13″S, 48º46′4″W, D. Oliveira & C. Palamin leg. 17 males, 1 female (MCTP); Campo Florido, Silvio Junior, 16.IV.2014, C. Palamin leg., 21 males (MCTP); Conceição do Alagoas, Usina Santo Angelo, 11.II.2014, 19°58′4″S, 48°33′53″W, H. Oliveira, C. Palamin leg. 17 males, 1 female (MCTP); Delta, Usina Caeté, 11.II.2014, 19°57′43″S, 47°47′8″W, D. Oliveira & C. Palamin leg. 16 males, 2 females (MCTP); Frutal, Usina Cerradão, 12.II.2014, 19°54′6″S, 49°13′18″W, H. Oliveira & C. Palamin leg. 19 males (MCTP); Iturama, Coruripe, Fazenda Bela Vista, 02.IV.2014, 19°48′07.4″S, 50°17′01.6″W, A. Carneiro leg. 15 males 5 females (MCTP); Pirajuba, Agropecuria Brunozzi, 11.II.2014, 19º57′20″S, 48º40′15″W, H. Oliveira & C. Palamin leg. 17 males, 2 females (MCTP); Planura, Fazenda Bagagem, 11.II.2014, 20º03′33″S, 48º36′18″W, H. Oliveira & C. Palamin leg. 15 males, 1 female (MCTP); Paraná: Bandeirantes, Usiban – Açúcar e Álcool Bandeirantes, 27.II.2014, R. Loosli & L. Montans leg. 12 males 4 females (MCTP);Campo Largo, 17.IX.1983, H. Fava, 2 males (MCTP); Curitiba, II.2008, A. Sakakibara, 1 male (MCTP); Jussara, Usina Melhoramentos, 15.II.2014, R. Loosli & L. Montans leg. 15 males, 36 females (DZUP); Quatiguá, 03.V.1980, H. Piratelo, 1 male (MCTP); Terra Roxa, I.1980, L. Guimarães, 1 male (MCTP); Santa Catarina: B. Camboreú, III.1981, Cavichioli, 1 male (MCTP); Itapoá, VIII.1984, E.R. Silveira, 3 males (MCTP); São Paulo: Adélia, Usina Colombo, 19.II.2014, 21º22′58″S, 48º57′2″W, F. Barruchelo & C. Palamin leg. 16 males, 2 females (MCTP); Américo Brasiliense, Usina Santa Cruz, Fazenda Apeninos, 19.II.2014, V. Teles leg. 18 males (MCTP); Araraquara, Raizen – Tamoio, 7.III.2014, V. Teles leg. 18 males (MCTP); Araras, Usina São João de Araras, 20.II.2014, N. Panaggio & V. Teles leg.19 males (MCTP); Assis, Agroterenas, 27.II.2014, 22º39′37″S, 50º25′07″W, L. Silverio & L. Montans leg. 19 males, 1 female (MCTP); Barra Bonita, Raizen – Barra, 28.III.2014, 22º28′34.8″S, 48º36′05.7″W, V. Teles leg. 12 males, 5 females (MCTP); Campinas, I-II.1981, Rossia, 1 male (MCTP); Cândido Mota, Nova América, no collection data, 22°45′19′S, 50°25′09″W, L. Silverio & L. Montans leg. 29 males (MCTP); Capivari, Raizen, Bom Retiro, Fazenda São Luis, 27.III.2014, 22°51′53″S, 47°26′26″W, V. Teles leg. 9 males 9 females (MCTP); Colorado, Usina Colorado, Fazenda Nelson Borin, no collection date, R. Loosli leg. 10 males, 2 females (MCTP); Guaíra, Usina Guaíra, 14.II.2014, 20º08′42″S, 48º22′1″W,Barella & C. Palamin leg. 20 males, 8 females (MCTP); Guaíra, Usina Mandu, 14.II.2014, 20º29′50″S, 48º22′14″W, C. Barella & C. Palamin leg. 17 males, 2 females (MCTP); Guariba, Usina Bonfim, 21.II.2014, C. Polizel & V. Teles leg. 18 males (MCTP); Jaú, Potunduva, 28.III.2014, 22º21′48″S, 48º41′16″W, V. Teles leg. 9 males, 2 males (MCTP); Junqueirópolis, Usina Rio Vermelho, no collection data, 21º30′38″S, 51º26′04″W, J. Junior & L. Montans leg. 6 males (MCTP); Lins, Usina Lins, Fazenda São João dos Dourados, 11.II.2014, 18°30′22″S, 49°12′17″W, L. Silverio & V. Tales leg. 18 males (MCTP); Mococa, Usina Ipiranga, 18.II.2014, 21º21′20″S, 47º05′10″W, N. Panaggio & V. Teles leg. 8 males, 10 females (MCTP); Monte Aprazível, Moreno, 13.II.2014, 20º45′55″S, 49º45′16″W, J. Salgado & Cyro Palamin leg. 18 males (MCTP); Nova Independência, Usina da Pedra, 12.II.2014, 20º59′41″S, 51º30′36″W, L. Chagas & C. Palamin leg. 4 males, 15 females (MCTP); Orindiuva, Bunge, 18.II.2014, 20º14′28″S, 49º17′9″W, J. Salgado & C. Palamin leg. 16 males (MCTP); Ourinhos, Usina São Luis, no collection date, L. Silverio & L. Montans leg. 18 males (MCTP); Paraguaçu Paulista, Usina Cocal I, 27.II.2014, 22°24′42″S, 50°34′25″W, L. Silverio & L. Montans leg. 17 males 19 females (MCTP); Pauliceia, Usina Caeté, no collection data, 21º18′56″S, 51º49′57″W, J. Junior & L. Montans leg. 13 males, 4 females (MCTP); Pereira Barreto, Usina Santa Adélia, 13.II.2014, 20º32′1″S, 51º13′49″W, L. Chagas & C. Palamin leg. 14 males, 9 females (MCTP); Piracicaba, Raizen – Costa Pinto, 3.IV.2014, 22º33′55″S, 47º42′03″W, V. Teles leg. 8 males, 10 females (MCTP); Pontal do Paranapanema, ACP Bioenergia, Fazenda Santa Rita da Serra, no collection date, A. Bozoli & L. Montans leg. 9 males, 10 females (MCTP); Porto Ferreira, Destilaria Muller, 2.IV.2014, 21º54′29″S, 47º29′15″W, 5 males (MCTP); Porto Ferreira, Usina Ferrari, 21.II.2014, N. Panaggio & V. Teles leg. 19 males (MCTP); Promissão, Usina Madhu, 12.II.2014, 21º44′33″S, 49º42′32″W, C. Cassiano & V. Teles leg. 12 males, 6 females (MCTP); Rafard, Raizen – Rafard, 27.III.2014, 23º05′59″S, 49º29′25″W, V. Teles leg. 4 males, 1 female (MCTP); Rio das Pedras, Raizen – Santa Helena, 27.II.2014, 22º51′10″S, 47º39′22″W, V. Teles leg. 10 males, 8 females (MCTP); Sebastianopolis do Sul, Noble, 15.II.2014, L. Chagas & C. Palamin leg. 5 males, 9 females (MCTP); Serrana, Usina da Pedra, 16.II.2014, 21º07′48″S, 47º40′31″W, RTV Ribeirão & C. Palamin leg. 4 males (MCTP); Valparaiso, Usina Da Mata, no collection date, 21º13′24″S, 50º52′13″W, C. Cassiano & L. Montans leg. 9 males, 10 females (MCTP).
Mahanarva fimbriolata (Stål 1854)
Figs. 2E–H; 4A,B,E,G,I,K,M,O,Q,S; 7C,D.
Monecphora fimbriolata (Stål, Reference Stål1854)
Tomaspis fimbriolata; (Lallemand, Reference Lallemand1912) (Catalogued); (Metcalf, Reference Metcalf and Raleigh1961) (Catalogued)
Mahanarva fimbriolata; (Fennah, Reference Fennah1968).
Measurements
Body length: ♂ 11.7–14.5; Tegmina length: ♂ 10.3–12; Tegmina width: ♂ 3.7–4.7; Pronotum width: ♂ 4–4.5.
Diagnosis
Head reddish (fig. 4A,B); tylus smooth and rectangular with a median well-marked carina; vertex smooth with a median well-marked carina; postclypeus angled in profile in female specimens with a longitudinal carina strongly marked, lateral grooves strongly marked. Tegmina bright red with costal, apical and anal contoured in black, a longitudinal black stripe originating on the r vein and reaching the apex and another thin black band stripe the claval vein. Male. Long subgenital plates with a slender and acute apex (fig. 4E,G), parameres with one subapical acute spine (fig. 4I,K,M), aedeagus with a pair of long and slender dorsal processes (fig. 4O,Q). Female. Ovipositor with first valvula long and slender with acute apex and one basal process developed, long and slender directed downwards (fig. 4S); second valvulae long, with apical third of dorsal margin serrate; third valvulae short and wide, with long ventral setae.
Remarks
This species exhibits a colour polymorphism, the colour variations occur in the black longitudinal stripes on the tegmina, which can be complete (fig. 2E,F), incomplete (fig. 2H), or absent (fig. 2G). However, it can be easily distinguished by the single paramere spine.
Examined material
Bahia: Rio de Contas, 28.i-03.ii.2005, Mielke, Casagrande, 1 male (DZUP); Mato Grosso, Cáceres, 19.III.1985, POLONOROESTE, C. Elias, 1 male (DZUP); Chap. Guimarães, 22-25.XI.1983, Exc. Dep. Zool-UFP, (Polonoroeste), 1 male (DZUP); Diamantino,10-14.II.1965, S. Laroca, 1 male (DZUP); Alpinopolis, III.1961, Claudionor Elias, 1 male (DZUP); Mato Grosso do Sul: Nova Alvorada do Sul, -.I.2013, Valerio, J.R. (MCTP-57184); Minas Gerais: Bom Despacho, 20.XI, 11 males (DZUP); Corinto, 1-15.XII.1979, C. Elias, 9 males (DZUP); Corinto, 1-15.XI.1979, C. Elias, 4 males (DZUP); Juiz de Fora, 20.X.1977, S.S. Andrade, 1 males (DZUP); P.N. Serra do Cipó, 09-13.XII.2021, 19º20′35″S, 43º37′08″W, R.R. Cavichioli, 3 males (DZUP); Passos, III. 1961, C. Elias, 2 males (DZUP); Coronel Pacheco, 30.III.2015, Auad, A.M. (MCTP-57213); Oratórios, 31.III.2012, Silva, L.A. (MCTP-70124); Leopoldina, 06.X.2005, Valverde, A.H.P. (MCTP-70131); Juiz de Fora, 13.XII.2005, Auad, A.M. (MCTP-70231); São Paulo: Araras, 10.I.1985, Araújo, J.R. (MCTP-70236); Miguelopolis, -.XII.2015, Miranda, L.L.D. (MCTP-57147); Piracicaba, 22.X.2015; Vieira, S.S. (MCTP-57152); Paraná: Curitiba, 23.III.1981, Andretta, 1 male (DZUP); Ponta Grossa, 12-39, Coleção F. Justus, 1 male (DZUP); Rio de Janeiro: Campos, V-1924, C. Moreira, 1 males (DZUP); Rondônia: Vilhena, 06.XI.1979, Penny, Arias, 1 male (DZUP); Vilhena, X-XII.1986, POLONOROESTE, C. Elias, 9 males (DZUP).
Mahanarva spectabilis (Distant, 1909)
Figs. 2I–L; 4C,D,F,J,H,L,N,P,R,T; 7B–D
Tomaspis spectabilis Distant, 1909; (Lallemand, Reference Lallemand1912) (Catalogued); (Metcalf, Reference Metcalf and Raleigh1961) (Catalogued).
Mahanarva spectabilis; (Carvalho and Webb, Reference Carvalho and Webb2005; Fennah, Reference Fennah1979).
Measurements
Body length: ♂ 12.5–14.6, ♀ 13.62–15; Tegmina length: ♂ 10.7–12.2, ♀ 11.2–11.6; Tegmina width: ♂ 3.1–4.2, ♀ 3.1–4.6; Pronotum width: ♂ 4.3–4.6, ♀ 3.7–4.7.
Diagnosis
Head (fig. 4C,D) reddish castaneous; tylus smooth and rectangular with a median carina slightly marked; vertex smooth with a median carina slightly marked; postclypeus angled in profile in female specimens with a longitudinal carina strongly marked, lateral grooves strongly marked. Tegmina bright red with costal, apical and anal margins contoured in black, a large black band above the costal margin almost reaching the apex and another thin black band over the claval vein. Male. subgenital plates long with a slender apex (fig. 4F,H), paremeres with one subapical spine quadrangular (fig. 4J,L,N), aedeagus with a pair of flattened hook-like dorsal processes (fig. 4P,R) Female. Ovipositor with first valvula long and slender with acute apex and one basal process developed, rounded, spoon-like directed downwards (fig. 4T); second valvulae long, with apical third of dorsal margin serrate; third valvulae short and wide, with long ventral setae.
Remarks
Mahanarva spectabilis exhibits a colour polymorphism, with both entirely red and black specimens (fig. 2I,J) and yellowish and reddish specimens with black longitudinal stripes on the tegmina (fig. 2K,L). However, it can be easily distinguished from M. fimbriolata and M. diakantha sp. n. by the aedeagus shape and quadrangular paramere spine.
Examined material
Ceará: Quixadá, Faz. Não me Deixes, 14.V.2014, 04.8107ºS, 38.9740ºW, G. Melo, B. Rosa, 1 female (DZUP); Distrito Federal: Planaltina, 17.XII,1976-24.I.1977, 15º35′S, 47º42′W, V.O.Becker, 2 males, 1 female (DZUP); Goiás: Bom Jesus, Usina Goiasa, 15.IV.2014, 18º03′45″S, 49º39′53″W, A. Carneiro leg. 15 males (MCTP); Chapadão do Céu, Usina Porto das Águas, 12.II.2014, 18º14′21″S, 52º33′26″W, M. Vilela & A. Carneiro leg. 15 males, 2 females (MCTP); Goiatuba, Usina Goiasa, 15.IV.2014, 18º00′53.42″S, 49º38′52.99″W, A. Carneiro leg. 15 males (MCTP); Jataí, Usina Raízen, Fazenda Rio Paraíso, 13.II.2014, 17°42′04″S, 51°35′54″W, M. Vilela & A. Carneiro leg. 24 males (MCTP); Jussara, 16.IV.81 D. Landó, 1 male, (DZUP); Maurilândia, Usina Vale do Verdão, 21.II.2014, 17º53′35″S, 50º21′20″W, M. Vilela & A. Carneiro leg. 26 males (DZUP); Neropolis, II.1977, Sakakibara, 1 male, 1 female (DZUP); Portlândia, Odebrecht Agua Emendada, 4.IV.2014, 17º24′53.87″S, 52º45′15.09″W, I. Martenfel leg. 24 males, 2 females (MCTP); Quirinópolis, Usina Boa Vista, 11.II.2014, 18º27′58″S, 50º27′00″ W, R. Zanni & A. Carneiro leg. 28 males (MCTP); Mato Grosso do Sul: Aquidauana, UEMS, 06.XII.2012, M. Savaris, S. Lampert, 1 female, (DZUP); Bonito, Serra do Bodoquena, Faz. Novo Horizonte, 03.III.2009, 20º54′50″S, 56º35′35″W, A. Paladini, 7 males, 4 females (DZUP); Chapadão do Sul, Usina IACO, 12.II.2014, 18º47′43″, 52º53′10″W, M. Vilela & A. Carneiro leg. 26 males (MCTP); Chapadão, 01-31.III.2016, 7 male, 2 females (DZUP); Dourados, Faz. Itahum, 20.II.2009, 22º06′34″S, 55º19′08″W, A. Paladini, 4 males, (DZUP); Dourados, Reserva Florestal Faz. Coqueiro, 18\19.II.2009, 22º12′34″S, 54º54′56″W, A. Paladini, D.R. Parizotto, P.C. Grossi, 6 males, 4 females (DZUP); Miranda, 1-28.II.2015, 1 male, 1 female (DZUP); Ponta Porã, Usina Monte Verde (BUNGE), Fazenda Passatempo, no collection data, 22º32′23″S, 55º43′40″W, A. Coelho & L. Montans leg. 22 males, 11 females (MCTP); Porto Murtinho, Faz. Progresso, 23.II.2009, 21º35′57″S, 57º45′26″W″ A. Paladini, D.R. Parizotto, P.C. Grossi, 2 males, 2 females (DZUP); Sidrolândia, 08.III.2001, P.S.M. Botelho, 6 males (DZUP); Rio Brilhante, 21-27.I.1971, V.O. Becker leg., 1 male (DZUP); Mato Grosso: Arenápolis, Luiz Bróggio, IV.2014, 14º38′09.38″S, 56º57′31.34″W, I. Martenfel leg. 14 males, 5 females (MCTP); Barra do Bugres, Barra álcool, IV.2014, 15º00′41.76″S, 57º15′30.30″W, I. Martenfel leg. 32 males, 21 females (MCTP); Buriti, 15.II.1967, N. Tangerini, 2 males (DZUP); Buriti, Chapada, 17.I.1970, N. Tangerini, 1 male (DZUP); C. Guimarães, 09.12.1983, F. L. da Cruz, 2 males (DZUP); Cáceres, XI.1984-III.1985, POLONOROESTE, C. Elias, 72 males, 12 females (DZUP); Campo Novo do Parecis, 07.II.2001, P.S.M. Botelho, 1 male, 1 female (DZUP); Chap. Guimarães, 22-25.XI.1983, Exc. Dep. Zool-UFP, (Polonoroeste), 4 males (DZUP); Chapada dos Guimarães, 08.I.1987, C. Elias, 1 male, 1 female (DZUP); Chapada dos Guimarães, Aldeia Velha, 1-31.XII.2016, 15º26′14″S, 55º45′30″W, P.R.O.A. Correa, 2 males (DZUP); Chapada dos Guimarães, Exc. Dep. Zool. UFPR, III-XII.1983, 9 males, 8 females (DZUP); Chapada dos Guimarães, II.1965, S. Laroca, 3 males (DZUP); Chapada, 12.XI.2013, G. Melo, 4 males, (DZUP); Chapada, XI.1963, M. Alvarenga, 1 female (DZUP); Cuiabá, 18.IV.2006, Brachiaria brizantha, J.F. Garcia, 7 males, 1 female (DZUP); Cuiabá, I-II.1965, S. Laroca, 16 males (DZUP); Denise, Itamarati, Fazenda Cristo Rei, 03.IV.2014, 14°38′42.44″S, 56°59′58.92″W, I. Martenfel leg. 25 males, 2 females (MCTP); Guaíba, 19.I.1975, S. Laroca, 1 female (DZUP); Lambari do Oeste, Cooperb, 3.IV.2014, 15º20′27.95″S, 57º59′39.91″W, I. Martenfel leg. 11 males, 10 females (MCTP); P.N. Chapada dos Guimarães, 14.I.2013, M. Savaris, S. Lampert, 1 male, (DZUP); P.N. Chapada dos Guimarães, Vale da Benção, 17.I.2013, M. Savaris, S. Lampert, 2 males, (DZUP); P.N. Chapada dos Guimarães, Vale do Eco, 17.I.2015, M. Savaris, S. Lampert, 1 male, (DZUP); Rondonópolis, X.1963, M. Alvarenga, 1 female (DZUP); Minas Gerais: Araxá, 22.XI.1965, C. Elias, 2 male (DZUP); Corinto, 1-15.XII.1979, C. Elias, 15 males, 6 females (DZUP); Paracatu, 06.XII.1978, L.A.S. Mello, 3 males (DZUP); Uberaba, 01-31.I.2017, 2 males, 1 female (DZUP); Pará: Novo Progresso, Faz. Florentino, XI.2010-III.2011, 07º07′45.71, 55º23′21.13″W, D. Krinski, 35 males, 33 females (DZUP); Paraná: Altamira do Paraná, Est. da Bota, 21-24.III.2011, Grossi, Weiss, 3 male (DZUP); Campo Largo, 25.IV.1981, 1 female (DZUP); Curitiba, 15.IV.1993, M. Kobayashi, 1 female (DZUP); Curitiba, 10.X.1983, Cortes F., 1 male (DZUP); Guarapuava, Estancia S. Clara, 24.XII.1976, V. Graf, 1 male (DZUP); Guaratuba, 9-10.X.2010, 25º49′54″S, 48º46′0″W, P.C. Grossi, 1 male (DZUP); Londrina, 19.IV.2018, 2 males, (DZUP); Paranavaí, 15.V.1961, Laroca, Marston, 2 males (DZUP); Piraquara, 19.IV.1981, R. Lolis, 1 female (DZUP); Piraquara, 5.XI.1983, Busato, N leg., 1 male (DZUP); Terra Boa, 01-03.I.1985, J.A.Rafael, 1 male, 1 female (DZUP); Tuneiras do Oeste, REBIO das Perobas, 01-04.IV.2024, A.C. Domahovski, L. Alasmar, 4 males (DZUP); Ponta Grossa, XII.1934, Pedreira, 1 male (DZUP); Nova Esperança, 5.IX.1983, M. Eto leg., 1 male (DZUP); J.M. Tavora, 08.IX.1982, Furushu B.I. leg., 1 male (DZUP); Irati, 12.IX.1983, Zarpelhon S.F. leg., 1 male (DZUP); São João, XII.1983, Eng. Deltão, 1 male (DZUP); Piauí: União, Usina Canvap, IV.2014, 04º49′22″S, 42º52′49″W, 17 males, 2 females (MCTP); Rio Grande do Sul: São Francisco de Paula, Porteiro Velho, 14-17.XII.2009, −29,480720º, −50,174436º, A. Paladini, 1 male, (DZUP); Rondônia: Ouro Preto d′Oeste, 15.III.1988, C. Elias, 3 males (DZUP); Porto Velho, X.1965, 1 male (DZUP); Vilhena, 06.XI.1979, Penny, Arias, 1 male (DZUP); Santa Catarina: Italópolis, 11.IV.1981, Gilmar Woehl, 1 male (DZUP); Itapoá, 21.IV.1981, M.G. Grossi, 1 female (DZUP); Rio Caraguatá, III.1953, 21º48ºS, 52º27′W, Fritz Plaumann, 4 males (DZUP); São Paulo: Araras, 07.II.2001, J.F. Garcia, 1 female (DZUP); Barueri, VIII.1958, K. Leneo, 1 male (DZUP); Batatais, XII.1967, Pe. J. Moure, 1 male, 1 female (DZUP); Brasilândia, 13.II.2001, P.S.M. Botelho, 2 males, 3 females (DZUP); Junqueirópolis, Usina Rio Vermelho, no collection data, 21º30′38″S, 51º26′04″W, J. Junior & L. Montans leg. 3 males (MCTP); Monte Aprazível, Moreno, 13.II.2014, 20º45′55″S, 49º45′16″W, J. Salgado & Cyro Palamin leg. 1 male (DZUP); Olimpia, 02.III.2001, P.S.M. Botelho, 3 male, 2 female (DZUP); Piracicaba, 01.III.2001, J.F. Garcia, 1 female (DZUP); Teodoro Sampaio, X.1977, M. Alvarenga, 11 males (DZUP); Pirassununga, Centro Nacional de Pesquisa e Conservação da Biodiversidade Aquática Continental (CEPTA-ICMBIO), 14.XII.2023, −21.9299, −47.3747, 549 m, Pano Branco, AP Pinto, E. Denck, L. Polizei & RC Varella, 1 male (DZUP); Ribeirão Preto, Estação Ecológica de Ribeirão Preto (mata de Santa Teresa), 24.I.2009, 21º31′S 47º50′W, Grupo VII curso de verão em Entomologia, 1 female (DZUP); Tocantins: Gurupi, 11-XI-1993, Jaci, 13 males, 9 females, (DZUP); Palmas, 10.XI.2013, 1 male, (DZUP); Palmas, Taquaruçu, Fazenda Encantada, 10º15′2.3″S, 48º07′33.6″W, 30.xi-7.xii.2012, T.K. Krolow, H.I.L. Lima, 2 males (DZUP); Palmas, 1-30.IV.2016, Arm. Luminosa, 1 male (DZUP).
Discussion
Multiple sources of information and different analytical approaches allowed the identification of a new species of Mahanarva with relevant importance for sugarcane crops. This type of approach has been increasing as taxonomists agree that the evaluation of several lines of evidence provides more robust species hypotheses (Pante et al., Reference Pante, Schoelinck and Puillandre2015). Integrative taxonomy has been helping in more precise species delimitation in diverse groups of insects, especially when species show wide distributions (e.g. Namyatova et al., Reference Namyatova, Dzhelali and Konstantinov2024), high morphological variability (e.g. Schutze et al., Reference Schutze, Virgilio, Norrbom and Clarke2017) or, on the other hand, represent cryptic species complexes (e.g. Wang et al., Reference Wang, Lei, Wang, Cameron, Navas Castillo, Liu, Maruthi, Omongo, Delatte, Lee, Krause-Sakate, Ng, Seal, Fiallo-Olivé, Bushley, Colvin and Liu2024), which is the case here.
Mahanarva diakantha sp. n., M. fimbriolata, and M. spectabilis are the species most frequently found feeding on sugarcane in this study. M. fimbriolata is, indeed, the most frequent species in papers about Neotropical cercopids from 2001 to 2022 (Paladini, personal observation). However, these species show several morphological similarities, which may be subtle to the unadvised observer. As shown here, the general body colour is highly variable intraspecifically, but the colour of the head, the pronotum and the tegmina are quite reliable to the separation of M. spectabilis from M. fimbriolata and M. diakantha sp. n. in the field. On the other hand, the proper morphological identification of M. fimbriolata and M. diakantha sp. n. is only reliable through male genital dissection – a common situation in insect taxonomy, in the context of either the species isolation or the cryptic female choice hypotheses of genital evolution (Eberhard and Lehmann, Reference Eberhard and Lehmann2019; e.g. Fernández-Aldea et al., Reference Fernández-Aldea, Barão, Grazia and Ferrari2014). As shown here, M. fimbriolata and M. diakantha sp. n. can be identified by the differences in the spine of the paramere. Similar cases can be common in Cercopidae, as observed in the Neotropical genera Maxantonia Schmidt, 1922, and Prosapia Fennah, 1949, where species exhibit significant colour polymorphism in their tegmina and subtle differences in their genitalia (Castro-Valderrama et al., Reference Castro-Valderrama, Peck, Carvalho, Valdez-Carrasco and Romero-Nápoles2020; Nast, Reference Nast1979).
In concert with these morphological evidences, two other lines of evidence support the hypothesis that M. diakantha sp. n. is an independent lineage: hindwing shape and COI based genetic evidence. Geometric morphometry has been increasingly used in species discrimination, including for the Cercopidae (e.g. Armendáriz-Toledano et al., Reference Armendáriz-Toledano, López-Posadas, Utrera-Vélez, Nápoles and Castro-Valderrama2023), because this method is sensitive enough to detect subtle intra and interspecific differences in shapes (e.g. Barão et al., Reference Barão, Goncalves, Mielke, Kronforst and Moreira2014; Fernández-Aldea et al., Reference Fernández-Aldea, Barão, Grazia and Ferrari2014; Lorenz et al., Reference Lorenz, Almeida, Almeida-Lopes, Louise, Pereira, Petersen, Vidal, Vírginio and Suesdek2017), which is essential when distinguishing between closely related species. In our study, consistent with the findings on general morphology, we could separate the three species with geometric morphometrics, sometimes exceeding 90% accuracy in pairwise species discrimination. Parallel to the results in terminal colour and genitalia, M. fimbriolata and M. diakantha sp. n. are more alike in hindwing shape, with correct classification based on hindwing shape varying from 74 to 87%. Lower values of correct classification to M. fimbriolata in relation to M. diakantha sp. n. may be an artefact of smaller sample sizes, since M. fimbriolata was the least sampled in our dataset.
The molecular genetic findings, including the phylogenetic hypothesis and the genetic distances, are also in line with the occurrence of a new Mahanarva species using sugarcane as a host plant. This is corroborated by the Bayesian phylogenetic analysis of the COI gene, which revealed a monophyletic lineage for M. diakantha sp. n., with M. fimbriolata as the closest sister species. As expected, the species morphologically most similar to M. diakantha sp. n., M. fimbriolata and M. spectabilis, clustered closer together with it compared to other Mahanarva species included in the phylogeny. This reinforces the close relationship between these three species, which are the main pests of sugarcane in Brazil. Regarding the genetic distances, the values between the three closely related species are not high (lower than the mean for all species, which is approximately 9.8%), and are lower compared to differences with the other tested Mahanarva spp. This provides support for defining a new species based on molecular data. The COI genetic distance values might be higher when compared to those used to define new species in other insect groups. In fact, empirical values for species delimitation vary across insect taxa (Zhang and Bu, Reference Zhang and Bu2022), and there is no defined threshold for Cercopidae, highlighting the need to establish such values for future analyses. It is also noteworthy that in other well-recognised Mahanarva spp., genetic distances may be low or even 0%, as seen between M. funebris and M. tibialis. Conversely, in some insect groups, as for example, leaf-footed bugs, intraspecific genetic differentiation can be high, as observed in Asian populations of Cletus punctiger (Dallas, 1852) (Coreidae), which exhibits an interpopulation genetic distance of 4.35% (Zhang et al., Reference Zhang, Lv, Yi, Zhu and Bu2017). Finally, since the low COI distances between M. fimbriolata and M. diakantha, further studies should include more specimens of both species to investigate possible phylogeographic structure.
At present, there are no specific records in the scientific literature about the sympatry of M. fimbriolata and M. spectabilis in sugarcane. Due to this lack of studies, there is no information available regarding the ecological implications of such sympatry in agricultural environments. According to Schöbel and Carvalho (Reference Schöbel and Carvalho2020), the suitable areas of M. fimbriolata and M. spectabilis resulting from niche modelling are convergent, with distribution limits to including the southern, central, and northeastern regions of Brazil. One of the main issues related to the study of Cercopidae is the low occurrence records (Schöbel and Carvalho, Reference Schöbel and Carvalho2020). Our results show that the three species probably occur in sympatry in southeastern Brazil, particularly in the states of São Paulo, Minas Gerais and Espírito Santo. This sympatry suggests that these species could co-occur in agroecological systems, as for example sugarcane crops. While M. spectabilis has a broader distribution, M. fimbriolata and M. diakantha n. sp. share a substantial portion of their ranges. The occurrence of these species in sympatry can raise important ecological questions regarding interspecific interactions, such as resource partitioning or potential competition within sugarcane crops. The ecological implications of their coexistence, if any, are still unknown, underscoring the need for further studies on behavioural ecology, host preferences, and population dynamics in shared environments.
It is also interesting to note that the oldest specimens we could find of M. diakantha n. sp. dated from 1961. All records before the year 2000’s of M. diakantha n. sp., from the two entomological collections we accessed, were from specimens previously identified as M. fimbriolata. There are numerous published articles focusing on M. fimbriolata on sugarcane, particularly addressing the use of biological control with entomopathogenic fungi (Loureiro et al., Reference Loureiro, Batista Filho, Almeida, Mendes and Pessoa2012), damage estimation (Dinardo-Miranda and Gil, Reference Dinardo-Miranda and Gil2007), and the influence of different sugarcane genotypes on infestation levels (Dinardo-Miranda et al., Reference Dinardo-Miranda, Ferreira and Carvalho2001). Studies have increased with the emergence of M. fimbriolata as a significant pest of sugarcane and it has become the subject of agronomic studies aiming to better understand its management and the extent of damage it causes. It is important to note, however, that most of these studies do not specify the procedures used for species identification, nor do they mention species confirmation by a taxonomist (e.g. personal communication). Given the high degree of morphological similarity among Mahanarva species – especially in colouration and external morphology – it is likely that misidentifications may have occurred in some of these papers. Since M. fimbriolata is the most frequent Neotropical cercopid species in the literature, especially regarding its interaction with sugarcane production (Paladini, Reference Paladini, Takiya, Cavichioli and Carvalho2015, personal observation), we can only wonder how many of these identifications might have confused M. fimbriolata with M. diakantha or M. spectabilis.
The misidentification of species of economic importance has led to significant economic losses and the rapid increase of populations. For example, the misidentification of species of Liriomyza (Diptera: Agromyzidae), the serpentine leafminers, allowed L. trifolii (Burgess) to emerge as the main pest of some horticulture because of failure of quarantine procedure, lack of basic biological studies and disregard of insecticide resistance (Ferguson, Reference Ferguson2004; Parrella and Keil, Reference Parrella and Keil1984). The proper identification of insects at early stages of crop colonisation is necessary since culture managers have limited actions available for their management and, if insect populations become established, the environmental impact of chemical control over large areas may be unacceptable (Kaloudis et al., Reference Kaloudis, Anastopoulos, Yialouris, Lorentzos and Sideridis2005). Thus, establishing accurate reference taxonomy is a crucial first step for reliable pest species identification, either based on molecular or morphological data (Mutanen et al., Reference Mutanen, Kivela, Vos, Doorenweerd, Ratnasingham, Hausmann, Huemer, Dincă, van Nieukerken, Lopez-Vaamonde, Vila, Aarvik, Decaëns, Efetov, Hebert, Johnsen, Karsholt, Pentinsaari, Rougerie, Segerer, Tarmann, Zahiri and Godfray2016).
Also, closely related insect species can exhibit different insecticide resistance patterns and levels of antibiosis. Two potato pests, Phthorimaea operculella and P. absoluta (Lepidoptera: Gelechiidae), show distinct genetic mutations conferring resistance to various insecticides, with P. absoluta displaying more mutations and higher resistance (Zhu et al., Reference Zhu, Chen, Liu, Lin, Liang, Nauen, Li and Gao2024). In damselflies, the smaller, fast-paced Ischnura pumilio (Odonata: Coenagrionidae) unexpectedly showed 8 times less sensitivity to chlorpyrifos than its larger, slow-paced congener I. elegans, contradicting trait-based predictions (de Beeck et al., Reference de Beeck, Verheyen and Stoks2018). Differential insecticide susceptibility can also drive species displacement, as observed in the leafminer flies Liriomyza trifolii and L. sativae, where L. trifolii’s lower susceptibility to avermectin and cyromazine has led to its dominance over L. sativae in invaded areas (Gao et al., Reference Gao, Reitz, Wei, Yu and Lei2012). Similarly, Cardona et al. (Reference Cardona, Fory, Sotelo, Pabon, Diaz and Miles2004) found varying levels of antibiosis resistance in Brachiaria spp. to five spittlebug species, ranging from very high to absent depending on the species. They also observed true tolerance in some Brachiaria genotypes to specific spittlebug species, while others exhibited a combination of tolerance and antibiosis. This evidence becomes even more relevant when considering tests of plant resistance to M. fimbriolata under laboratory conditions. Some experiments use stock breeding populations of ‘M. fimbriolata’ (e.g. Dinardo-Miranda et al., Reference Dinardo-Miranda, da Costa, Fracasso, Perecin, de Oliveira, Izeppi and Lopes2014, Reference Dinardo-Miranda, Fracasso, Perecin, Oliveira, Lopes, Izeppi and Anjos2016, Reference Dinardo-Miranda, Fracasso, Silva and Miranda2021). Others do not (e.g. Grisoto et al., Reference Grisoto, Vendramim, Lourenção, Usberti and Olinda2018; Melo et al., Reference Melo, Tomaz, Soares, Kuki, Peternelli and Barbosa2017; Pabón-Valverde et al., Reference Pabón-Valverde, Soares, Tomaz, Pimentel, Peternelli and Barbosa2018). Field assays usually sample specimens directly on host plants (e.g. Kassab et al., Reference Kassab, Loureiro, Rossoni, Pereira, Mota, Barbosa and Costa2015). Most applied studies do not deposit vouchering specimens or indicate how specimens were identified. Consequently, identification cannot be double-checked. Since many Mahanarva spp. are red-coloured and similar to such an extent that it is impossible to distinguish them without genital analysis (Schöbel and Carvalho, Reference Schöbel and Carvalho2021) this results in uncertain identifications. This has major consequences, since insect-plant interactions are complex and species-specific responses when developing pest management strategies are of utmost importance, especially when closely related species can have distinct physiological and biochemical mechanisms underlying their resistance to pesticides and plant defences.
In conclusion, the integration of morphological, geometric morphometric, and molecular evidence strongly supports the recognition of Mahanarva diakantha as a distinct species alongside M. fimbriolata and M. spectabilis, based on two criteria: (1) diagnosability, i.e. the appearance of fixed differences (Cracraft, Reference Cracraft and Johnston1983; Nixon and Wheeler, Reference Nixon and Wheeler1990), observed through morphological and shape analysis; and (2) monophyly (de Queiroz and Donoghue, Reference de Queiroz and Donoghue1988; Donoghue, Reference Donoghue1985), based on the phylogenetic analysis of COI fragments and genetic distances between taxa. These findings highlight the importance of accurate species identification in addressing the ecological and economic challenges posed by pest species. Misidentifications, as seen in historical records of M. diakantha, can lead to ineffective pest management strategies, exacerbating crop losses and environmental impacts. This study underscores the necessity of rigorous taxonomic frameworks, combining diverse analytical approaches, to ensure precise species delimitation. Moreover, the variations in pesticide resistance and plant interactions among closely related insect species emphasise the critical need for species-specific management strategies in agricultural systems. Going forward, the Brazilian sugarcane industry would be well-served by collaborative efforts on a large scale to monitor, identify and track the species-specific incidence and pest behaviour of this important pest complex.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0007485325100503.
Acknowledgements
We are thankful to Antonio Soares for bringing our attention to this species and providing access to most of the material of M. diakantha used here. AP has a research fellowship from Conselho Nacional de Desenvolvimento Científico e Tecnológico, CNPq (process number 308201/2023-0); KRB is a fellowship recipient of Programa de Educação Tutorial (PET/SESu/MEC); ACD is post-doctoral fellow from Fundação Carlos Chagas Filho de Amparo à Pesquisa do Rio de Janeiro, FAPERJ (process number E-26/204.206/2021); DCC-d-M is supported by CNPq (process number 309979/2023-4) and Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP (process number 2023/02581-2).
Competing interests
The authors declare none.
